Prosecution Insights
Last updated: October 02, 2026
Application No. 18/266,712

TAU BIOSENSOR CELL LINES

Non-Final OA §102§103§112
Filed
Jun 12, 2023
Priority
Dec 21, 2020 — provisional 63/128,370 +1 more
Examiner
WESTON, ALYSSA G
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Board of Regents of the University of Texas System
OA Round
1 (Non-Final)
60%
Grant Probability
Moderate
1-2
OA Rounds
2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 60% of resolved cases
60%
Career Allowance Rate
67 granted / 112 resolved
At TC average
Strong +51% interview lift
Without
With
+50.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
55 currently pending
Career history
176
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
33.9%
-6.1% vs TC avg
§102
30.3%
-9.7% vs TC avg
§112
23.3%
-16.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 112 resolved cases

Office Action

§102 §103 §112
DEATAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority The instant application is a national stage entry under 35 USC 371 of PCT/US2021/064590, filed 21 December 2021. Acknowledgment is made of Applicant’s claim for benefit under 35 USC 119(e) to US Provisional Application No. 63128370, filed 21 December 2020. Status of the Claims Applicant’s submission filed 12 August 2026 has been entered. Claims 1-7 and 14-31 are pending. Claim 22 has been amended, while claims 8-13 have been cancelled without prejudice or disclaimer and claims 27-31 have been newly added. Election/Restrictions Applicant’s election without traverse of Group VI, encompassing claims 22 and 27-31 in the reply filed on 21 July 2026 is acknowledged. The requirement is still deemed proper and is therefore made FINAL. Accordingly, claims 1-7, 14-21, and 23-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Therefore, prosecution on the merits commences for claims 22 and 27-31. It is of note that even though claims 27-31 were not presented within the original restriction requirement filed 12 February 2026, they are encompassed by the elected invention. Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.831-1.834 because it does not contain a “Sequence Listing XML” as a separate part of the disclosure. A “Sequence Listing XML” is required because the most recent filing receipt (filed 01 November 2023) for the instant application lists the “Filing or 371(c) date” as 12 June 2023. As this date is after 01 July 2022, the sequence listing is required to follow ST.26 guidelines as opposed to ST.25 guidelines. Therefore, a “Sequence Listing XML” file is required and not the “Sequence TXT” file that is currently on file. Required response - Applicant must provide: • A “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2.; together with o A statement that indicates the basis for the amendment, with specific references to particular parts of the application as originally filed, as required by 37 CFR 1.835(a)(3); o A statement that the “Sequence Listing XML” includes no new matter as required by 37 CFR 1.835(a)(4) AND • A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(a)(2), consisting of: o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); o A copy of the amended specification without markings (clean version); and o A statement that the substitute specification contains no new matter. Specification The preliminary amendments to the Specification filed 12 June 2023 and 19 July 2023 are acknowledged and entered into the application file. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 31 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 31: The instant claim recites the limitation “wherein the cell expresses Tau RD(P301S)”. While parentheticals can be used as abbreviations, the use of parentheticals adjacent to terms which recite alternate names or isoforms renders the claim indefinite because it is not clear whether the items within the parentheticals are required or optional. Appropriate correction is required. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 31 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 31: The instant claim recites the limitation “wherein the cell expresses Tau RD(P301S)”. However, parent claim 30 already requires the cell to comprise a first polynucleotide that comprises SEQ ID NO: 6 and a second polynucleotide that comprises SEQ ID NO: 7 – which each encode for the P301S mutation. See, for example, the sequence listing descriptors for SEQ ID NO: 6 (FM5 CMV 246-378aa P301S Tau mClover3) and SEQ ID NO: 7 (FM5 CMV 246-378aa P301S Tau mCerulean3) filed 12 June 2023. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 22 is rejected under 35 U.S.C. 103 as being unpatentable over Buee et al (US 2022/0017611 A1) in view of Perez-Ruiz et al (Analytica Chimica Acta, 2018). Buee et al is considered prior art under 35 USC 102(a)(2), with an effective filing date of 13 December 2018. Perez-Ruiz et al is considered prior art under 35 USC 102(a)(1). Regarding claim 22: Buee et al disclose a method wherein a HEK 293 biosensor cell comprising a vector comprising polynucleotides encoding P301S mutated-Tau RD (MTBD-P301S) fused to either Cyan Fluorescent Protein (CFP) or Yellow Fluorescent Protein (YFP) is subject to a seeding assay and analyzed for a Forster Resonance Energy Transfer (FRET) signal that occurs from MTBD-P301S aggregation (Paragraphs [0051], [0094]-[0100], [0116]-[0119], [0128]-[0129], [0144], [0202]-[0204]; Figure 5). Buee et al further disclose that an enzyme-linked immunosorbent assay (ELISA) can be utilized to quantify the amount of Tau protein within a sample in vitro (Paragraphs [0129, [0131]). Buee et al do not disclose that attomolar levels of seed tau protein are detected within the sample, as required by instant claim 22. Perez-Ruiz et al, however, disclose the use of a digital ELISA to quantify attomolar protein Tau concentrations within a sample ex vivo (Abstract; Pages 76-80; Figures 1, 4). Therefore, it would have been prima facie obvious to have modified the method of Buee et al such that a digital ELISA is utilized to quantify attomolar levels of Tau protein, as detailed in Perez-Ruiz et al. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to analyze concentrations of Tau that are below the detection limits of conventional ELISA, as the more sensitive testing allows for the early diagnosis of neurodegenerative disorders (Perez-Ruiz et al: Page 80), and would have had a reasonable expectation of success given that the disclosures of Buee et al and Perez-Ruiz et al are concerned with utilizing ELISAs to quantity concentrations of Tau protein. See MPEP § 2143(I)(G). Consequently, Buee et al as modified by Perez-Ruiz et al render obvious a method of quantifying attomolar concentrations of Tau protein, wherein a HEK 293 biosensor cell comprising a vector that comprises two polynucleotides encoding MTBD-P301S fused to either CFP or YFP is subject to a seeding assay, evaluated for a FRET signal to indicate MTBD-P301S aggregation, and then measured for attomolar concentrations of seed Tau protein via digital ELISA. This therefore renders obvious the method of the instant claim. Claims 22 and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Buee et al (US 2022/0017611 A1) in view of Perez-Ruiz et al (Anal Chim Acta, 2018), and further in view of Dave et al (WO 2020/061164 A1, of record on IDS filed 19 December 2023). The discussion of Buee et al as modified by Perez-Ruiz et al regarding claim 22 can be observed above and is relied upon herein, the content of which is incorporated in its entirety. Buee et al as modified by Perez-Ruiz et al render obvious instant claim 22. Dave et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2), with a publication date of 26 March 2020. Regarding claim 27: As aforementioned in the discussion of instant claim 22 above, Buee et al disclose that the HEK 293 biosensor cell comprises a vector comprising polynucleotides encoding MTBD-P301S fused to either CFP or YFP. The combination of Buee et al and Perez-Ruiz et al fail to teach that the MTBD-P301S is fused to a fluorescent reporter having a sequence of instant SEQ ID NO: 2 or instant SEQ ID NO: 3, as required by instant claim 27. Dave et al, however, disclose fluorescent reporters for use within HEK 293 cells (Pages 2, 31). Dave et al further disclose that the fluorescent reporter includes a mCLOVER3 protein or a CERULEAN protein, wherein the mCLOVER3 protein has a polynucleotide sequence of SEQ ID NO: 4 (Pages 8, 10-12, 14-15, 17-19, 21-25, 29). It is of note that SEQ ID NO: 4 of Dave et al has 100% sequence identity to instant SEQ ID NO: 2. See sequence alignment at end of Office action. Therefore, it would have been prima facie obvious to have substituted the YFP fluorescent reporter gene of Buee et al with the mCLOVER3 fluorescent reporter gene of Perez-Ruiz et al, as doing so would have been a simple substitution of one fluorescent reporter gene variant for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the invention would have recognized that the two fluorescent reporter genes are functionally comparable, as they are both capable of use within HEK 293 cells, and thereby would have been able to substitute the two fluorescent reporter gene variants with predictable results. Consequently, Buee et al as modified by Perez-Ruiz et al and Dave et al render obvious a method of quantifying attomolar concentrations of Tau protein, wherein the HEK 293 biosensor cell comprises a vector comprising a polynucleotide encoding MTBD-P301S fused to mCLOVER3, which has a polynucleotide sequence of SEQ ID NO: 4. As SEQ ID NO: 4 of Dave et al has 100% sequence identity to instant SEQ ID NO: 2, this therefore renders obvious the method of the instant claim. Allowable Subject Matter Instant claims 28-30 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The following is a statement of reasons for the indication of allowable subject matter: the sequence of instant SEQ ID NO: 1 is allowable over the prior art, as there is no sequence that has 100% sequence identity. It is of note that SEQ ID NO: 2 of Platt et al (US 2011/0041191 A1, of record on IDS filed 19 December 2023) has 99.6% identity to instant SEQ ID NO: 1, wherein SEQ ID NO: 2 of Platt et al comprises a silent mutation (T[Wingdings font/0xE0]C) at nucleotide position 1848. See sequence alignment at end of Office action. However, the ordinary artisan would not have arrived at the method of the instant invention without the use of impermissible hindsight, as the sequence of Platt et al is not linked to a reporter, nor utilized within seeding assays to determine attomolar levels of a seed tau protein. It is also of note that instant SEQ ID NOs: 6-7 fully comprise the sequence of instant SEQ ID NO: 1. See sequence alignment at end of Office action. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALYSSA G WESTON/Examiner, Art Unit 1633 Sequence Alignment Query Match 100.0%; Score 714; Length 717; Best Local Similarity 100.0%; Matches 714; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy (INSTANT SEQ ID NO: 2) vs Db (DAVE ET AL SEQ ID NO: 4) Qy 1 GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4 GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGC 63 Qy 61 GACGTAAACGGCCACAAGTTCAGCGTCCGCGGCGAGGGCGAGGGCGATGCCACCAACGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 64 GACGTAAACGGCCACAAGTTCAGCGTCCGCGGCGAGGGCGAGGGCGATGCCACCAACGGC 123 Qy 121 AAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 124 AAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTC 183 Qy 181 GTGACCACCTTCGGCTACGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 184 GTGACCACCTTCGGCTACGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAG 243 Qy 241 CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTCTTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 244 CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTCTTTC 303 Qy 301 AAGGACGACGGTACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 304 AAGGACGACGGTACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTG 363 Qy 361 AACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 364 AACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAG 423 Qy 421 CTGGAGTACAACTTCAACAGCCACTACGTCTATATCACGGCCGACAAGCAGAAGAACTGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 424 CTGGAGTACAACTTCAACAGCCACTACGTCTATATCACGGCCGACAAGCAGAAGAACTGC 483 Qy 481 ATCAAGGCTAACTTCAAGATCCGCCACAACGTTGAGGACGGCAGCGTGCAGCTCGCCGAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 484 ATCAAGGCTAACTTCAAGATCCGCCACAACGTTGAGGACGGCAGCGTGCAGCTCGCCGAC 543 Qy 541 CACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 544 CACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC 603 Qy 601 CTGAGCCATCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 604 CTGAGCCATCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTG 663 Qy 661 CTGGAGTTCGTGACCGCCGCCGGGATTACACATGGCATGGACGAGCTGTACAAG 714 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 664 CTGGAGTTCGTGACCGCCGCCGGGATTACACATGGCATGGACGAGCTGTACAAG 717 Query Match 99.6%; Score 397.4; Length 2277; Best Local Similarity 99.7%; Matches 398; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy (INSTANT SEQ ID NO: 1) vs Db (PLATT ET AL SEQ ID NO: 4) Qy 1 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1687 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 1746 Qy 61 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1747 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 1806 Qy 121 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACATGTCTCGGGAGGCGGCAGT 180 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 1807 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCTCGGGAGGCGGCAGT 1866 Qy 181 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1867 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 1926 Qy 241 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1927 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 1986 Qy 301 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1987 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 2046 Qy 361 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 399 ||||||||||||||||||||||||||||||||||||||| Db 2047 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 2085 Query Match 100.0%; Score 399; Length 9735; Best Local Similarity 100.0%; Matches 399; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy (INSTANT SEQ ID NO: 1) vs Db (INSTANT SEQ ID NO: 6) Qy 1 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3211 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 3270 Qy 61 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3271 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 3330 Qy 121 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACATGTCTCGGGAGGCGGCAGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3331 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACATGTCTCGGGAGGCGGCAGT 3390 Qy 181 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3391 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 3450 Qy 241 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3451 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 3510 Qy 301 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3511 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 3570 Qy 361 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 399 ||||||||||||||||||||||||||||||||||||||| Db 3571 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 3609 Query Match 100.0%; Score 399; Length 9735; Best Local Similarity 100.0%; Matches 399; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy (INSTANT SEQ ID NO: 1) vs Db (INSTANT SEQ ID NO: 7) Qy 1 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3211 GCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAAC 3270 Qy 61 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3271 CTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGC 3330 Qy 121 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACATGTCTCGGGAGGCGGCAGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3331 AACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACATGTCTCGGGAGGCGGCAGT 3390 Qy 181 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3391 GTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTA 3450 Qy 241 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3451 GGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGAC 3510 Qy 301 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3511 TTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGC 3570 Qy 361 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 399 ||||||||||||||||||||||||||||||||||||||| Db 3571 GGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTC 3609
Read full office action

Prosecution Timeline

Jun 12, 2023
Application Filed
Aug 31, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735677
METHOD FOR PRODUCING ASTROCYTE-LIKE CELLS
3y 6m to grant Granted Sep 15, 2026
Patent 12723062
METHODS OF TREATING MITOCHONDRIAL DISORDERS
2y 3m to grant Granted Sep 01, 2026
Patent 12686849
COMPOSITIONS AND METHODS FOR IMPROVING EMBRYO DEVELOPMENT
2y 5m to grant Granted Jul 21, 2026
Patent 12668781
MATERIALS AND METHODS FOR THE MANUFACTURE OF PLURIPOTENT STEM CELLS
2y 2m to grant Granted Jun 30, 2026
Patent 12624338
METHOD AND DEVICE FOR TARGET CELL SEPARATION
2y 10m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
60%
Grant Probability
99%
With Interview (+50.9%)
3y 5m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 112 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month