Prosecution Insights
Last updated: October 02, 2026
Application No. 18/267,144

METHOD FOR PROGRAMMABLE CONTROL OF RNA TRANSCRIPT LEVELS WITH AUTOREGULATED CRISPR-CAS13D

Final Rejection §103§112
Filed
Jun 14, 2023
Priority
Dec 17, 2020 — provisional 63/127,110 +1 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Florida Research Foundation Inc.
OA Round
2 (Final)
58%
Grant Probability
Moderate
3-4
OA Rounds
6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
118 granted / 203 resolved
-1.9% vs TC avg
Strong +65% interview lift
Without
With
+65.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
72 currently pending
Career history
262
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
30.3%
-9.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 203 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status and Withdrawn Rejections/Objections Applicant’s amendments filed June 17, 2026, amending claims 2, 11-13, 15, 19, 23, 43 and 68 is acknowledged. Claims 1-3, 11-13, 15, 19, 23, 25, 30-31, 33, 38, 43, 46-47, 51, 68 and 92 are pending. The amendments to claims 2, 11-13, 15, 19 and 23 overcome the §112(b) rejections of those claims. The amendment to claim 43 overcomes the §112(a) rejection of claims 43, 46-47, 51 and 68 for new matter. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Election by Original Presentation Newly submitted/amended claim 43 is directed to an invention that is independent or distinct from the invention originally claimed for the following reasons: The invention of claims 1 and 43 are distinct products that function via different mechanisms and require different components. In the previous claim set, claims 43, 46-47 and 51 depended from claim 1, which is directed to an Cas13d-ZF-KRAB fusion protein. As amended, claim 43 is independent and does not require any features of claim 1. As indicated in the previous office action (pages 11-12), Inventors took two approaches to developing an autoregulating Cas13d protein ([0338]-0339]). The first, as claimed by claim 1, employs a Cad13d domain fused to a zinc finger domain and a KRAB transcriptional repressor domain. The Cas13d-ZnF-KRAB can bind to the ZnF-binding sequence cloned upstream of the fusion protein coding sequence to reduce transcription of the fusion protein coding sequence ([0338]). The second approach, termed GENO throughout the Specification, and now claimed by independent claim 43, employs a Cas13d pre-crRNA sequence near the Cas13d coding sequence. The Cas13d domain in the second approach does not appear to be fused to any other domain. When Cas13d binds its own transcript at the pre-crRNA sequence, Cas13d will cleave the transcript, thereby reducing expression ([0339]). Examiner could find no instance where there was any suggestion of using a "Cas13d processing sequence" or a "pre-crRNA" together with a Cas13d-ZnF-KRAB fusion protein. Thus the inventions are distinct. Since applicant has received an action on the merits for the originally presented invention (i.e., the Cas13d-ZnF-KRAB fusion proteins, this invention has been constructively elected by original presentation for prosecution on the merits. Accordingly, claims 43, 46-47, 51 and 68 withdrawn from consideration as being directed to a non-elected invention. See 37 CFR 1.142(b) and MPEP § 821.03. To preserve a right to petition, the reply to this action must distinctly and specifically point out supposed errors in the restriction requirement. Otherwise, the election shall be treated as a final election without traverse. Traversal must be timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are subsequently added, applicant must indicate which of the subsequently added claims are readable upon the elected invention. Should applicant traverse on the ground that the inventions are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing the inventions to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the inventions unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other invention. Claims 1-3, 11-13, 15, 19, 23, 25, 30-31, 33, 38, 43 and 92 are pending and under examination. Drawings The drawings filed June 17, 2026 are objected to because the figure label in FIG. 4C is upside down. Rule 37 C.F.R. 1.84(p)(1) indicates that reference characters must be oriented in the same direction as the view so as to avoid having to rotate the sheet. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112(a) – New Matter - Maintained The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 92 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a maintained NEW MATTER rejection. MPEP 2163.II.A.3.(b) states, “when filing an amendment an applicant should show support in the original disclosure for new or amended claims” and “[i]f the originally filed disclosure does not provide support for each claim limitation, or if an element which applicant describes as essential or critical is not claimed, a new or amended claim must be rejected under 35 U.S.C. 112a, as lacking adequate written description". According to MPEP § 2163.I.B, "While there is no in haec verba requirement, newly added claim limitations must be supported in the specification through express, implicit, or inherent disclosure" and "The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117". Claim 92 recites “A viral vector comprising the nucleic acid molecule of claim 1, the viral vector comprising a nucleic acid sequence of any one of SEQ ID NOs: 178-179. The combination of 1) the nucleic acid encoding a Cas13d-ZnF-KRAB fusion protein with 2) SEQ ID NOs 178-179 appears to represent new matter. According to the Specification, Inventors took two approaches to developing an autoregulating Cas13d protein ([0338]-0339]). The first employs a Cad13d domain fused to a zinc finger domain and a KRAB transcriptional repressor domain. The Cas13d-ZnF-KRAB can bind to the ZnF-binding sequence cloned upstream of the fusion protein coding sequence to reduce transcription of the fusion protein coding sequence ([0338]). The second approach, termed GENO throughout the Specification, employs a Cas13d pre-crRNA sequence near the Cas13d coding sequence. The Cas13d domain in the second approach does not appear to be fused to any other domain. When Cas13d binds its own transcript at the pre-crRNA sequence, Cas13d will cleave the transcript, thereby reducing expression ([0339]). There is no explicit disclosure or even a hint of suggestion in the Specification to combine the two approaches into a single autoregulatory mechanism. All disclosures of a “pre-crRNA sequence” or “Cas13d processing sequence” are in reference only to a “Cas13d” or “Cas13d protein” (e.g., see [0380]). Examiner could find no instance where there was any suggestion of using a “Cas13d processing sequence” or a “pre-crRNA” together with a Cas13d-ZnF-KRAB fusion protein. According the Specification, SEQ ID NOs 178-179 are AAV vectors (i.e., viral vectors) comprising a GENO_CUG1 or GENO_non-targeting cassettes (pages 122-128). GENO is the acronym used for the second approach – incorporating a pre-crRNA sequence into the mRNA transcript of Cas13d (See e.g., [0347]). There is no disclosure in the Specification of a viral vector encoding 1) a GENO cassette and 2) a Cas13d-ZnF-KRAB fusion protein. Since no basis has been identified for claim 92, it is rejected as incorporating new matter. Response to Arguments - §112(a) Applicant argues that claim 92 depends from claim 1 “and further defines the nucleic acid sequence of claim 1.” Applicant argues that express support for claim 92 [sic] is provided at paragraph [0306] of the specification (Remarks, page 14). This argument has been fully considered but is not persuasive. Claim 1 requires nucleic acid segments encoding a ZnF domain and transcriptional repressor domain, in addition to the Cas13d domain. However, SEQ ID NOs 178 and 179 are listed as “GENO” (Sequence Table, pages 122-128), which do not encode ZnF or transcriptional repressors. There is no evidence in the Specification that an AAV vector like those of SEQ ID NO 178 and 179 also encode a ZnF and transcriptional repressor domain. Thus, the combination of the protein domains of claim 1 and the Cas13d-directed crRNA is considered new matter. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 11-13, 15, 19, 30 and 38 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (Abudayyeh et al., Nature (2017), 550: 280-284 and Supplemental Material; of record) in view of Hsu (US 20190062724 A1, published February 28, 2019; of record). Claims 2, 12 and 13 are evidenced by Gross (Gross et al., Neuron (2013) 78: 971-985; of record). Claims 12 and 13 are further evidenced by Bensussen (Bensussen et al., iScience (2020), 23: 101330; of record) and Genbank (MT612432.1, Cloning vector pAAV-EF1A-DIO-Gephyrin.FingR-GFP-CCR5TC, complete sequence, published June 27, 2020; of record). This is a maintained rejection. Regarding claim 1, Abudayyeh teaches a negative feedback system for Cas13a fusion protein expression (page 283, ¶2; Fig 4c). Abudayyeh teaches a fusion protein comprising a Cas13a domain fused to a zinc finger (ZF) domain fused to a KRAB(A) domain (i.e., a transcriptional repressor domain) (Fig 4c). Abudayyeh teaches a nucleic acid comprising 1) the coding sequence for the Cas13a-ZF-KRAB fusion protein and 2) a ZF binding site 5’ of and operably linked to the coding sequence of the fusion protein (Fig 4c). Abudayyeh teaches the ZF domain can bind the ZF-binding site and repress transcription of the Cas13a-ZF-KRAB(A) fusion protein (Fig 4c). Abudayyeh does not teach the negative feedback fusion protein comprises a Cas13d domain. Hsu teaches the identification and characterization of a Type VI-D (i.e., Cas13d) protein family ([0007]). Hsu teaches one such Type VI-D CRISPR effector isolated from Eubacterium siraeum, and names it Cas13d ([0520]). Hsu teaches EsCas13d processes its own CRISPR array into guides, sufficiently cleaves target ssRNA, can be rendered catalytically inactive by mutating catalytic residues in the HEPN domains, and displays bystander RNA cleavage, all similar to Cas13a ([0520]-[0523]). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the EsCas13d protein taught in Hsu in place of the Cas13a protein in the negative feedback fusion protein of Abudayyeh. It would have amounted to the simple substitution of one known Cas13 protein for another by known means to yield predictable results. The skilled artisan would have predicted that the substitution could be made because Hsu teaches that Cas13d has many of the same characteristics of Cas13a. Because the prior art recognizes the equivalence of Cas13a and Cas13d for the purpose of processing and binding a cognate crRNA and cleaving target RNA, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II. Nevertheless, the skilled artisan would have been motivated to make a Cas13d-ZF-KRAB(A) fusion protein for the purpose of controlling expression of Cas13d in a similar fashion that Abudayyeh uses to control expression of Cas13a. Regarding claim 2, Abudayyeh teaches that the negative feedback system was based on the self-targeting ZF and KRAB repressor reported in Gross et al., Neuron (2013) 78: 971-985 (page 283, ¶2; reference 16). Gross teaches a self-targeting ZF-KRAB comprising a left ZF domain from human CCR5 fused to KRAB(A) (Supp Experimental Procedures, ¶1). Gross teaches the DNA sequence of the ZF binding site is gtcatcctcatc (i.e., SEQ ID NO 21) (Supp Experimental Procedures, ¶1). Therefore, the nucleic acid comprising the Cas13d-ZF-KRAB(A) negative feedback system rendered obvious above contained a zinc finger binding sequence with SEQ ID NO: 21). Regarding claim 3, Abudayyeh teaches the negative feedback system also comprises a promoter (Methods, column 2, ¶1). Regarding claim 11, Hsu teaches the amino acid sequence of EsCas13d is SEQ ID NO 1 ([0041]), which has 99% sequence identity with SEQ ID NO 2 (see OA appendix in the previous office action, pages 1-2). Regarding claims 12 and 13, Abudeyyah and Gross do not disclose the amino acid sequence of the ZF-KRAB(A) fusion protein. However, Bensussen teaches using the negative feedback regulated system comprising the CCR5 ZF protein fused to KRAB(A) that was described in Gross (page 2, ¶3). Bensussen teaches the name of the viral construct used to deliver the CCR5ZF-KRAB fusion protein to cells is AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC (page 2, ¶3; Supp Table 1). Genbank teaches the nucleotide sequence of AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC (pages 2-3). Genbank teaches an open reading frame comprising the amino acid sequence of the FingR-eGFP-CCR5 ZF-KRAB(A) (pages 1-2). The amino acid sequence comprises a sequence that is 100% identical to SEQ ID NO 20 (see OA Appendix in the previous office action, page 3) and 100% identical to SEQ ID NO 24 (see OA Appendix in the previous office action, page 4). Therefore, the nucleic acid comprising the Cas13d-ZF-KRAB(A) negative feedback system rendered obvious above encoded a zinc finger domain comprising SEQ ID NO: 20 and a transcriptional repressor domain comprising SEQ ID NO 24. Regarding claim 15, “linker” is defined as “a molecule linking two other molecule or moieties” ([0189]). Abudayyeh teaches the negative feedback construct also comprised an msfGFP between the Cas13 and the ZF domains, which is encompassed by a “linker” (Fig 4c). Abudayyeh also represents the fusion protein with thin dark lines between domains (Fig 4c), which the skilled artisan would interpret as “a linker”. Regarding claim 19, Abudayyeh teaches the Cas13-ZF-KRAB fusion protein also comprises an NLS (Methods, column 2, ¶1). Regarding claim 30, Hsu teaches delivering Cas13d coding sequences to cells along with a guide crRNA array (i.e., a nucleotide sequence encoding one or more guide RNAs) (FIG 12C). Hsu teaches the crRNA guides can guide Cas13d to a target an RNA transcript (FIG. 12). Hsu teaches the cRNA array is on the same AAV molecule as the Cas13d coding sequence (FIG. 12C). It would have been obvious to one skilled in the art to additionally include a crRNA guide coding sequence on the nucleic acid encoding Cas13d-ZF-KRAB rendered obvious for claim 1. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the coding sequence for a crRNA and the obvious Cas13d-ZF-KRAB could be included on a single nucleic acid molecule because Hsu demonstrates inclusion of both with an untagged Cas13d. The skilled artisan would have been motivated to have done so for the purpose of delivering both simultaneously since Cas13d requires a crRNA for targeting the desired transcript. Regarding claim 38, Hsu teaches that Cas13d can bind crRNAs targeted to a specific RNA transcript to knockdown expression of the transcript in a cell (FIG. 8). Hsu teaches EsCas13d is capable of cleaving the targeted ssRNA (Fig 5). Hsu teaches EsCas13d also exhibits bystander RNA cleavage activity, although at a lower efficiency compared to cleavage of the targeted RNA ([0523]). It would have been obvious to one skilled in the art to have used the negative-feedback autoregulation system of Abudayyeh and Gross to have controlled catalytically active Cas13d when used in methods for transcript target knockdown. It would have amounted to regulating a Cas13d with known off-target RNA cleavage by known means to yield predictable results. The skilled artisan would have predicted that dCas13a-ZF-KRAB autoregulation system to function on a catalytically active version of Cas13 because the transcriptional regulation mechanism is independent of whether Cas13 is catalytically active or inactive. The skilled artisan would have been motivated to use the negative-feedback autoregulation system of Abudayyeh to regulate catalytically-active Cas13d to minimize the off-target bystander RNA cleavage by Cas13d as taught by Hsu. Claims 31 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (Abudayyeh et al., Nature (2017), 550: 280-284 and Supplemental Material; of record) and Hsu (US 20190062724 A1, published February 28, 2019; of record), and evidenced by Gross (Gross et al., Neuron (2013) 78: 971-985; of record), as applied to claims 1-3, 11-13, 15, 19, 30 and 38 above, and further in view of Zhang (Zhang et al., Frontiers in Genetics (2020), 11: 591576, pages 1-13; published December 10, 2020; of record). This is a maintained rejection. The teachings of Abudayyeh, Hsu and Gross are recited above and applied as for claims 1-3, 11-13, 15, 19, 30 and 38. Hsu also teaches that Cas13d can be used to cleave target RNAs that are associated with Huntington’s disease ([0319]). Gross teaches using the autoregulated negative feedback system for fluorescent markers allows the fluorescence to mirror the target molecule concentration in the cell (Fig 3G, legend). Abudayyeh, Hsu and Gross do not recite the sequence of a target RNA comprising CUG repeat expansions or the sequence of a guide RNA that targets CUG repeat expansions. Zhang teaches microsatellite expansion diseases, including myotonic dystrophy type 1 (DM1) and Huntington’s disease-like 2, are a group of neurological and neuromuscular disorders that are caused by the expansion of 3–10 nucleotide repeats in the residing gene (page 1, ¶1). Zhang teaches DM1 is caused by a CTG repeat expansion in the 3’ UTR region of the DMPK gene (i.e., the mRNA transcript comprises a CUG repeat expansion in the 3’ UTR) (page 1, ¶2). Zhang teaches Cas13 family of proteins incudes Cas13a, Cas13b, Cas13c and Cas13d proteins (page 2, ¶3). Zhang demonstrates dCas13a targeted to the CUG repeat region to visualize RNA foci that cause DM1 (page 2, ¶1; Fig 1). Zhang teaches use a guide crRNA that is complementary to the CUG repeat expansion region of the DKPK transcript (Fig 1B). Zhang teaches the sequence of the guide crRNA region comprises a sequence that is complementary to 5’-CUGCUGCUGCUGCUGCUGCUGC (i.e., complementary to ctgctgctgctgctgctgctgc, which is SEQ ID NO 58) (Fig 1B). Zhang teaches the coding sequence for the Cas13 domain and the crRNA guide RNA are located on the same nucleic acid molecule (Fig 1A). Regarding claims 31 and 33, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the obvious autoregulated Cas13d-ZF-KRAB to target the DM1 CUG-expanded sequence of Zhang. It would have amounted to using the obvious fusion protein that could predictably be used to visualize target transcripts to target a known disease-causing transcript. The skilled artisan would have predicted that the CUG-expansion could be targeted by Cas13d because Cas13d crRNA design follows the same overall rule – 100% complementarity to the targeted sequence – as Cas13a effectors. The skilled artisan would have been motivated to target the CUG expansion repeat with the obvious autoregulated system because Gross teaches the autoregulation of fluorescent markers provides a closer representation of target molecule concentration in the cell to provide a higher signal to noise. Claim 23 is rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (Abudayyeh et al., Nature (2017), 550: 280-284 and Supplemental Material; of record) and Hsu (US 20190062724 A1, published February 28, 2019; of record), and evidenced by Gross (Gross et al., Neuron (2013) 78: 971-985; of record), as applied to claims 1-3, 11-13, 15, 19, 30 and 38 above, and further in view of Zhang2 (US 20190359971 A1) and Cheng (US 20210388351 A1, priority to at least September 27, 2019). This is a new rejection, necessitated by amendment. The teachings of Abudayyeh, Hsu and Gross are recited above and applied as for claims 1-3, 11-13, 15, 19, 30 and 38. Hsu also teaches that Cas13d fused to a His-tag for recombinant protein production ([0026]). Abudayyeh, Hsu and Gross do not teach peptide tags attached to Cas13 while in vivo. Zhang2 teaches the discovery of Cas13 family of proteins ([0008]-[0009]). Zhang2 teaches Cas13a used in a negative feedback system fused to a ZnF and a KRAB domain ([0996]). Zhang2 teaches that Cas13 proteins can also be fused to epitope tags such as His-tags, V5 tags, Myc tags and FLAG tags ([0048]). Zhang2 teaches HA and FLAG epitopes can be used as “linkers” between domains in a fusion protein ([0316]). Cheng teaches catalytically inactive CasRx (i.e., a Cas13 endonuclease) fusion proteins (Abstract). Cheng teaches examples of Cas13 proteins include Cas13d ribonucleases ([0063]). Cheng teaches the sequence of the HA-tag is YPYDVPDYA (page 10, SEQ ID NO 19), which is 100% identical to SEQ ID NO 49 of the examined application. Cheng teaches CasRx fused at the C-terminus with the HA tag (page 10, SEQ ID NO 13). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have further included a detectable epitope tag such as Cheng’s HA-tag with SEQ ID NO 49 to the Cas13d-ZF-KRAB(A) rendered obvious for claim 1. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that an HA tag could be additionally included because both Zhang2 and Cheng teach the epitopes attached other Cas13 proteins. The skilled artisan would have been motivated to have included the tag so that protein expression could easily be monitored by immunoblot. Response to Arguments - §103 Applicant argues that the obviousness rejection cannot be based on the mere fact that the components at issue are function or mechanical equivalents. Applicant argues that Examiner does not provide evidence to support the argument that the substitution [of Cas13d for Cas13a] would yield predictable results (Remarks, ¶ spanning pages 14-15). Applicant argues that it would not have been a simple substitution because Hsu does not disclose that they are equivalent and Abudayyeh teaches that members of the Cas13 families have differing levels of efficacy (page 15, ¶2-4). Applicant argues that the exemplary domain disclosed in the Specification has SEQ ID NO 5, which only has 17% identity of L. wadei Cas13a of Abudayyeh, and therefore the skilled artisan would have understood that Cas13 proteins originating from different families could have very different properties (Remarks, ¶ spanning pages 15-16). These arguments have been fully considered but are not persuasive for the following reasons. First, it is evident from Hsu that Cas13d ribonucleases have the same function (i.e., guide RNA-directed, RNA-targeting), and can be engineered for the same purposes as the previously characterized Cas13a proteins such as targeted RNA knockdown (Fig 8) and target RNA detection based on collateral cleavage (Fig 15). Thus, the skilled artisan would have understood that any application using Cas13a, such as autoregulation, could also be performed using Cas13d. Thus, the art as a whole understood that Cas13a and Cas13d are functional equivalents. Examiner did not base the substitution rationale on the mere fact that Cas13a and Cas13d were equivalents. Instead, Examiner cites to Hsu who demonstrates the equivalence of Cas13a and Cas13d in FIG. 10, and thus demonstrates that “the equivalency is recognized in the prior art”. MPEP 2144.06.II. Second, because Hsu demonstrates that Cas13d has the same functions as Cas13a with similar efficiencies at three different RNA targets (FIG 5), it would have been completely predictable that Cas13d fused to a ZnF and KRAB would have similar efficiencies as a Cas13a-ZnF-KRAB domain. There is no disclosure in Hsu that would suggest that Cas13d could not functionally substitute for Cas13a since all Hsu’s assays show the same functions with similar efficiencies of the two Cas13 family members. Third, Applicant’s argument citing to Cas13d with SEQ ID NO 5 is unpersuasive because the features upon which applicant relies (i.e., a Cas13d with 100% identity to SEQ ID NO 5) is not a required element of any claim. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Claim 11 recites SEQ ID NO 5 along with six additional SEQ ID NOs and also allows merely 90% identity to the SEQ ID NOs. It is noted that Applicant only discloses autoregulation with a single Cas13d species, RfxCas13d ([0330]). If Applicant believes that a lack of percent identity to Cas13a renders a substitution unpredictable, Applicant is encouraged to explain or provide evidence how the other claimed Cas13d species (i.e., SEQ ID NOs 1, 3, 4, 6 or 7) or Cas13d with less than 100% identity to SEQ ID NO 5 are predicted to be used in the claimed invention. Allowable Subject Matter Claim 25 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Claim 25 recites “the nucleic acid molecule of claim 1, comprising SEQ ID NO: 55.” Based on the disclosure from the Specification and alignment with known sequences in the prior art referenced above, SEQ ID NO 55 encodes an NLS-RxCas13d-(GSSS)3-CCR5 ZnF-KRAB(A) fusion protein. Nearly all of SEQ ID NO 55 is pieced together from known nucleic acid sequences in the prior art. For instance, positions 3046-3609 are 100% identical to the nucleic acid sequence for CCR5 ZnF-KRAB disclosed in Genbank and used in Bensussen, which are referenced above. Positions 3000-3045 encode for the well-known linker (GSSS)3 used in fusion proteins (See e.g., US 20200063126 A1). Positions 1-3000 encode the NLS-RxCas13d portion of the claimed fusion protein. According to the Specification, Addgene Vector #109049, first disclosed in Konermann et al., (Cell (2018), 173: 665-696) was used to clone the coding sequence for NLS-RxCas13d. However, there is a single nucleotide difference at position 4 between SEQ ID NO 55 and the sequence disclosed in Addgene Vector #109049 (https://www.addgene.org/109049/, [retrieved March 10, 2026]). The single nucleotide difference results in an AGC[Wingdings font/0xE0]GGC codon change and an S[Wingdings font/0xE0]G amino acid change as illustrated below (Query: Vector #109049, Sbjct: SEQ ID NO 55). PNG media_image1.png 62 708 media_image1.png Greyscale Examiner can find no evidence in the prior art for why the skilled artisan would change a serine residue to glycine residue before the well-known PKKKRK SV40 NLS sequence fused to a protein at the N-terminus. As such a nucleic acid molecule comprising all of SEQ ID NO: 55, with no deletions, substitutions, or internal insertions is not obvious in view of the prior art. Conclusion Claim 25 is objected to. Claims 1-3, 11-13, 15, 19, 23, 30-31, 33, 38, 43 and 92 are rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jun 14, 2023
Application Filed
Mar 17, 2026
Non-Final Rejection mailed — §103, §112
Jun 17, 2026
Response Filed
Jul 02, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723277
LINKED TARGET CAPTURE
4y 9m to grant Granted Sep 01, 2026
Patent 12698477
METHODS OF PRECONDITIONING VASCULAR CELLS FOR TRANSDUCTION, METHODS OF TRANSDUCTION AND METHODS OF PRESERVING TRANSDUCED CELLS
4y 8m to grant Granted Aug 04, 2026
Patent 12698504
Methods for Making and Using Genomically Recoded Cells
3y 2m to grant Granted Aug 04, 2026
Patent 12686865
COMPOSITIONS AND METHODS OF NUCLEIC ACID-TARGETING NUCLEIC ACIDS
4y 11m to grant Granted Jul 21, 2026
Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+65.0%)
3y 9m (~6m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 203 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month