Prosecution Insights
Last updated: April 19, 2026
Application No. 18/267,144

METHOD FOR PROGRAMMABLE CONTROL OF RNA TRANSCRIPT LEVELS WITH AUTOREGULATED CRISPR-CAS13D

Non-Final OA §103§112
Filed
Jun 14, 2023
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC.
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
3y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allow Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +63% interview lift
Without
With
+62.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
233
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The preliminary amendment filed January 8, 2024 is acknowledged. Claims 1-3, 11-13, 15, 19, 23, 25, 30-31, 33, 38, 43, 46-47, 51, 68 and 92 are pending and under examination. It is noted that claim 43 was amended from an independent claim in the originally filed claims to a dependent claim that depends from claim 1. Drawings The drawings are objected to because the lines, shadings, numbers and letters of FIGs 1A, 1B, 1C, 1E, 2B, 3A, 3E, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5D, 5E, 5I, 6A, 6C, 7A, 7B, 7C, 7D, 7G, 8A, 8B, 10A, 10B, 10C, 10G, 10H, 11B, 11E, 12A-F, 13-16, and 17A are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, much of the text in the above FIGs is light grey or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics; the letters over shading in the micrographs are not sufficiently dark for reproduction; some of text of the formulas FIGs 13-16 is of poor resolution that it is not clear what some of the variables are. Additionally, there is a thin box outline in each of the FIGs that looks like it was used to cover-up previous figure labels. The box outline should be removed in each FIG. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the terms Zyppy®, ZymoPURE®, Opti-MEM®, CellMaskTM, Fluoroshield®, PrestoBlue®, CytationTM, NEBNext®, Direct-zol®, NuPage®, and Tween®, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency #1 - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825. The sequence disclosures are located in FIG 1B and 4B (4th sequence down) and FIG 4B (NT sequence). Based on the labeled 5’ end, the 4th sequence in FIG 1B/4B is 5’-AGCAGCAGCAGCAGCAGCAGCA. All nucleotide sequence in the sequence listing must be written starting from the 5’ end. It appears as though SEQ ID NO 184 is the sequence in FIG 1B/4B, but it is written starting from the 3’ end, which is incorrect. Based on the labeled 5’ end, the 5th sequence in FIG 4B is 5’-CGAGGGCGACTTAACCTTAGGT. It appears as though SEQ ID NO 186 is the sequence in FIG 4B, but it is written starting from the 3’ end, which is incorrect. Required response – Applicant must provide: A "Sequence Listing" part of the disclosure, as described above in item 1); as well as An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2); A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4). If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter; If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide: A replacement CRF in accordance with 1.825(b)(6); and Statement according to item 2) a) or b) above. Specific deficiency #2 – Nucleotide and/or amino acid sequences appearing in the drawings in FIG. 1B and FIG. 4B are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2, 11-13, 15, 19, 23 and 68 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 2 recites “wherein the zinc finger binding site comprises a nucleotide sequence of any one of SEQ ID NOs: 9, 11, 13…” The use of “a nucleotide sequence” with “of any one of” renders the claim indefinite. “A nucleotide sequence” is interpreted as any two or more adjacent nucleotides of the recited SEQ ID NOs. It is not clear how many or which of the nucleotides are needed to be considered a zinc finger binding site, which renders the claim indefinite. If Applicant intends for the entire sequence of the SEQ ID NO to be included as the zinc finger binding site, the following claim language is suggested: “wherein the zinc finger binding site comprises SEQ ID NOs 9, 11, 13, 15, 17, 19 or 20.” Each of claims 11-13 recites “wherein the [element] comprises an amino acid sequence of any one of SEQ ID NOs: X, X…” The use of “an amino acid sequence” with “of any one of” renders the claim indefinite. “An amino acid sequence” is interpreted as any two or more adjacent amino acids of the recited SEQ ID NOs. It is not clear how many or which of the amino acids are needed to be considered the recited element, which renders the claim indefinite. If Applicant intends for the entire sequence of the SEQ ID NO to be included as the protein elements, the following claim language is suggested: “wherein the Cas13d domain [ZnF domain or repressor domain] comprises SEQ ID NOs X, X, … or X; or comprises an amino acid sequence having at least 90% identity to SEQ ID NOs X, X, … or X.” Claim 15 recites “optionally wherein the one or more linkers have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 25-35”. The use of “an amino acid sequence” with “from the group consisting of any one of” renders the claim indefinite. “An amino acid sequence” is interpreted as any two or more adjacent amino acids of the recited SEQ ID NOs. It is not clear how many or which of the amino acids are needed to be considered the recited linker, which renders the claim indefinite. If Applicant intends for the entire sequence of the SEQ ID NO to be included as the linker, the following claim language is suggested: “wherein the one or more linkers have an amino acid sequence consisting of SEQ ID NOs 25-35; or an amino acid sequence having at least 90% identity to SEQ ID NOs 25-35.” Claim 19 recites “the nucleic acid molecule of claim 1 further comprising a first nuclear localization signal (NLS) sequence…” NLSs are described in the Specification ([0192]) and known in the art as an amino acid sequence that tags a protein for import. Thus, an NLS sequence comprises amino acids. However, the claim is directed to a nucleic acid molecule. NLSs can also be conjugated to nucleic acids for nuclear localization. Especially considered that the optional limitations require the attachment of the NLS to the Cas13d domain, it is not clear if Applicant intended the nucleic acid molecule to further comprise an NLS coding sequence and not the NLS itself. If Applicant intends for the nucleic acid to further comprise the NLS coding sequence, the following claim language is suggested: “The nuclei acid molecule of claim 1, further comprising a polynucleotide encoding a first nuclear localization signal (NLS) sequence, optionally wherein the first NLS sequence is fused to the N-terminus…” Claim 23 recites “wherein the peptide tag is selected from the group consisting of a His-tag (SEQ ID NO: 51), HA-tag (SEQ ID NO: 49)…” The use of SEQ ID NOs within parentheses next to a more generic name of tag is confusing. It is not clear if the tag is limited to the more specific sequence or if the SEQ ID NO is merely exemplary language. For instance, His tags can be comprised of four, six, eight or ten adjacent histidines. SEQ ID NO: 51 consists of six histidines. It is not clear if claim 23 is limited to a His tag that is only 6 histidines, or if the peptide tag can be any number of histidines in length. Additionally, the claim is directed to a nucleic acid molecule, not a protein. It is not clear if Applicant intended the nucleic acid molecule to further comprise a coding sequence for the peptide tag and not the tag itself. If Applicant intends for the peptides to have the specific SEQ ID NOs and for the nucleic acid to comprise the coding sequence for the peptide tag, the following claim language is suggested: “The nucleic acid molecule of claim 1, further comprising a polynucleotide encoding a peptide tag, wherein the peptide tag is selected from the group consisting of a His-tag with SEQ ID NO:51, an HA-tag with SEQ ID NO: 49….” If Applicant does not intend for the tags to be limited to the specific SEQ ID NOs, it is suggested the SEQ ID NOs be deleted from the claim. Alternatively, the claim can recite “The nucleic acid molecule of claim 1, wherein the fusion protein further comprises a peptide tag, wherein…” Claim 68 recites “The nucleic acid molecule of claim 43, comprising SEQ ID NO: 2. SEQ ID NO: 2 is an amino acid sequence. It is confusing how a nucleic acid molecule can be comprised of amino acids. Claim Rejections - 35 USC § 112(a) – New Matter The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 43, 46-47, 51, 68 and 92 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a NEW MATTER rejection. MPEP 2163.II.A.3.(b) states, “when filing an amendment an applicant should show support in the original disclosure for new or amended claims” and “[i]f the originally filed disclosure does not provide support for each claim limitation, or if an element which applicant describes as essential or critical is not claimed, a new or amended claim must be rejected under 35 U.S.C. 112a, as lacking adequate written description". According to MPEP § 2163.I.B, "While there is no in haec verba requirement, newly added claim limitations must be supported in the specification through express, implicit, or inherent disclosure" and "The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117". Claim 43 recites “The nucleic acid molecule of claim 1 comprising a nucleotide sequence encoding the Cas13d domain and a Cas13d processing sequence on a single Cas13d autoregulatory transcript. In the instantly rejected claims, the combination of a 1) nucleic acid encoding a Cas13d-ZnF-KRAB fusion protein (i.e., the nucleic acid recited in claim1) with 2) a Cas13d processing sequence, comprised on a single Cad13d transcript appears to represent new matter. No specific basis for this limitation was identified in the specification, nor did a review of the specification by the examiner find any basis for the limitation. According to the Specification, Inventors took two approaches to developing an autoregulating Cas13d protein ([0338]-0339]). The first employs a Cad13d domain fused to a zinc finger domain and a KRAB transcriptional repressor domain. The Cas13d-ZnF-KRAB can bind to the ZnF-binding sequence cloned upstream of the fusion protein coding sequence to reduce transcription of the fusion protein coding sequence ([0338]). The second approach, termed GENO throughout the Specification, employs a Cas13d pre-crRNA sequence near the Cas13d coding sequence. The Cas13d domain in the second approach does not appear to be fused to any other domain. When Cas13d binds its own transcript at the pre-crRNA sequence, Cas13d will cleave the transcript, thereby reducing expression ([0339]). There is no explicit disclosure or even a hint of suggestion in the Specification to combine the two approaches into a single autoregulatory mechanism. All disclosures of a “pre-crRNA sequence” or “Cas13d processing sequence” are in reference only to a “Cas13d” or “Cas13d protein” (e.g., see [0380]). Examiner could find no instance where there was any suggestion of using a “Cas13d processing sequence” or a “pre-crRNA” together with a Cas13d-ZnF-KRAB fusion protein. It is noted that in the originally filed claims, claim 43 was an independent claim that did not recite any fusion protein, ZnF domains, or repressor domains. None of the dependent claims from claim 43 in the originally filed claims recited additional protein domains. Claims 46-47, 51 and 68 also require the combination of the 1) nucleic acid encoding a Cas13d-ZnF-KRAB fusion protein with 2) a Cas13d processing sequence, and are rejected for new matter for the reasons recited above for claim 43. Since no basis has been identified for claims 43, 46-47, 51 and 68, the claims are rejected as incorporating new matter. Claim 92 recites “A viral vector comprising the nucleic acid molecule of claim 1, the viral vector comprising a nucleic acid sequence of any one of SEQ ID NOs: 178-179. The combination of 1) the nucleic acid encoding a Cas13d-ZnF-KRAB fusion protein with 2) SEQ ID NOs 178-179 appears to represent new matter, for similar reasons as for claim 43. According the Specification, SEQ ID NOs 178-179 are AAV vectors (i.e., viral vectors) comprising a GENO_CUG1 or GENO_non-targeting cassettes (pages 122-128). GENO is the acronym used for the second approach – incorporating a pre-crRNA sequence into the mRNA transcript of Cas13d (See e.g., [0347]). There is no disclosure in the Specification of a viral vector encoding 1) a GENO cassette and 2) a Cas13d-ZnF-KRAB fusion protein. Since no basis has been identified for claim 92, it is rejected as incorporating new matter. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 11-13, 15, 19, 30 and 38 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (Abudayyeh et al., Nature (2017), 550: 280-284 and Supplemental Material) in view of Hsu (US 20190062724 A1, published February 28, 2019). Claims 2, 12 and 13 are evidenced by Gross (Gross et al., Neuron (2013) 78: 971-985). Claims 12 and 13 are further evidenced by Bensussen (Bensussen et al., iScience (2020), 23: 101330) and Genbank (MT612432.1, Cloning vector pAAV-EF1A-DIO-Gephyrin.FingR-GFP-CCR5TC, complete sequence, published June 27, 2020). Regarding claim 1, Abudayyeh teaches a negative feedback system for Cas13a fusion protein expression (page 283, ¶2; Fig 4c). Abudayyeh teaches a fusion protein comprising a Cas13a domain fused to a zinc finger (ZF) domain fused to a KRAB(A) domain (i.e., a transcriptional repressor domain) (Fig 4c). Abudayyeh teaches a nucleic acid comprising 1) the coding sequence for the Cas13a-ZF-KRAB fusion protein and 2) a ZF binding site 5’ of and operably linked to the coding sequence of the fusion protein (Fig 4c). Abudayyeh teaches the ZF domain can bind the ZF-binding site and repress transcription of the Cas13a-ZF-KRAB(A) fusion protein (Fig 4c). Abudayyeh does not teach the negative feedback fusion protein comprises a Cas13d domain. Hsu teaches the identification and characterization of a Type VI-D (i.e., Cas13d) protein family ([0007]). Hsu teaches one such Type VI-D CRISPR effector isolated from Eubacterium siraeum, and names it Cas13d ([0520]). Hsu teaches EsCas13d processes its own CRISPR array into guides, sufficiently cleaves target ssRNA, can be rendered catalytically inactive by mutating catalytic residues in the HEPN domains, and displays bystander RNA cleavage, all similar to Cas13a ([0520]-[0523]). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the EsCas13d protein taught in Hsu in place of the Cas13a protein in the negative feedback fusion protein of Abudayyeh. It would have amounted to the simple substitution of one known Cas13 protein for another by known means to yield predictable results. The skilled artisan would have predicted that the substitution could be made because Hsu teaches that Cas13d has many of the same characteristics of Cas13a. Because the prior art recognizes the equivalence of Cas13a and Cas13d for the purpose of processing and binding a cognate crRNA and cleaving target RNA, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II. Nevertheless, the skilled artisan would have been motivated to make a Cas13d-ZF-KRAB(A) fusion protein for the purpose of controlling expression of Cas13d in a similar fashion that Abudayyeh uses to control expression of Cas13a. Regarding claim 2, Abudayyeh teaches that the negative feedback system was based on the self-targeting ZF and KRAB repressor reported in Gross et al., Neuron (2013) 78: 971-985 (page 283, ¶2; reference 16). Gross teaches a self-targeting ZF-KRAB comprising a left ZF domain from human CCR5 fused to KRAB(A) (Supp Experimental Procedures, ¶1). Gross teaches the DNA sequence of the ZF binding site is gtcatcctcatc (i.e., SEQ ID NO 21) (Supp Experimental Procedures, ¶1). Therefore, the nucleic acid comprising the Cas13d-ZF-KRAB(A) negative feedback system rendered obvious above contained a zinc finger binding sequence with SEQ ID NO: 21). Regarding claim 3, Abudayyeh teaches the negative feedback system also comprises a promoter (Methods, column 2, ¶1). Regarding claim 11, Hsu teaches the amino acid sequence of EsCas13d is SEQ ID NO 1 ([0041]), which has 99% sequence identity with SEQ ID NO 2 (see OA appendix, pages 1-2). Regarding claims 12 and 13, Abudeyyah and Gross do not disclose the amino acid sequence of the ZF-KRAB(A) fusion protein. However, Bensussen teaches using the negative feedback regulated system comprising the CCR5 ZF protein fused to KRAB(A) that was described in Gross (page 2, ¶3). Bensussen teaches the name of the viral construct used to deliver the CCR5ZF-KRAB fusion protein to cells is AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC (page 2, ¶3; Supp Table 1). Genbank teaches the nucleotide sequence of AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC (pages 2-3). Genbank teaches an open reading frame comprising the amino acid sequence of the FingR-eGFP-CCR5 ZF-KRAB(A) (pages 1-2). The amino acid sequence comprises a sequence that is 100% identical to SEQ ID NO 20 (see OA Appendix, page 3) and 100% identical to SEQ ID NO 24 (see OA Appendix, page 4). Therefore, the nucleic acid comprising the Cas13d-ZF-KRAB(A) negative feedback system rendered obvious above encoded a zinc finger domain comprising SEQ ID NO: 20 and a transcriptional repressor domain comprising SEQ ID NO 24. Regarding claim 15, “linker” is defined as “a molecule linking two other molecule or moieties” ([0189]). Abudayyeh teaches the negative feedback construct also comprised an msfGFP between the Cas13 and the ZF domains, which is encompassed by a “linker” (Fig 4c). Abudayyeh also represents the fusion protein with thin dark lines between domains (Fig 4c), which the skilled artisan would interpret as “a linker”. Regarding claim 19, Abudayyeh teaches the Cas13-ZF-KRAB fusion protein also comprises an NLS (Methods, column 2, ¶1). Regarding claim 23, “peptide tag” is defined in the Specification as “a peptide amino acid sequence that is genetically fused to a protein sequence to impart one or more functions onto the proteins… for various purposes, such as visualizations” ([0196]). Abudayyeh teaches the negative feedback construct also comprised an msfGFP between the Cas13 and the ZF domains, which is encompassed by a “peptide tag used for visualization” (Fig 4c). Regarding claim 30, Hsu teaches delivering Cas13d coding sequences to cells along with a guide crRNA array (i.e., a nucleotide sequence encoding one or more guide RNAs) (FIG 12C). Hsu teaches the crRNA guides can guide Cas13d to a target an RNA transcript (FIG. 12). Hsu teaches the cRNA array is on the same AAV molecule as the Cas13d coding sequence (FIG. 12C). It would have been obvious to one skilled in the art to additionally include a crRNA guide coding sequence on the nucleic acid encoding Cas13d-ZF-KRAB rendered obvious for claim 1. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the coding sequence for a crRNA and the obvious Cas13d-ZF-KRAB could be included on a single nucleic acid molecule because Hsu demonstrates inclusion of both with an untagged Cas13d. The skilled artisan would have been motivated to have done so for the purpose of delivering both simultaneously since Cas13d requires a crRNA for targeting the desired transcript. Regarding claim 38, Hsu teaches that Cas13d can bind crRNAs targeted to a specific RNA transcript to knockdown expression of the transcript in a cell (FIG. 8). Hsu teaches EsCas13d is capable of cleaving the targeted ssRNA (Fig 5). Hsu teaches EsCas13d also exhibits bystander RNA cleavage activity, although at a lower efficiency compared to cleavage of the targeted RNA ([0523]). It would have been obvious to one skilled in the art to have used the negative-feedback autoregulation system of Abudayyeh and Gross to have controlled catalytically active Cas13d when used in methods for transcript target knockdown. It would have amounted to regulating a Cas13d with known off-target RNA cleavage by known means to yield predictable results. The skilled artisan would have predicted that dCas13a-ZF-KRAB autoregulation system to function on a catalytically active version of Cas13 because the transcriptional regulation mechanism is independent of whether Cas13 is catalytically active or inactive. The skilled artisan would have been motivated to use the negative-feedback autoregulation system of Abudayyeh to regulate catalytically-active Cas13d to minimize the off-target bystander RNA cleavage by Cas13d as taught by Hsu. Claim 31 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (Abudayyeh et al., Nature (2017), 550: 280-284 and Supplemental Material) and Hsu (US 20190062724 A1, published February 28, 2019), and evidenced by Gross (Gross et al., Neuron (2013) 78: 971-985), as applied to claims 1-3, 11-13, 15, 19, 30 and 38 above, and further in view of Zhang (Zhang et al., Frontiers in Genetics (2020), 11: 591576, pages 1-13; published December 10, 2020). The teachings of Abudayyeh, Hsu and Gross are recited above and applied as for claims 1-3, 11-13, 15, 19, 30 and 38. Hsu also teaches that Cas13d can be used to cleave target RNAs that are associated with Huntington’s disease ([0319]). Gross teaches using the autoregulated negative feedback system for fluorescent markers allows the fluorescence to mirror the target molecule concentration in the cell (Fig 3G, legend). Abudayyeh, Hsu and Gross do not recite the sequence of a target RNA comprising CUG repeat expansions or the sequence of a guide RNA that targets CUG repeat expansions. Zhang teaches microsatellite expansion diseases, including myotonic dystrophy type 1 (DM1) and Huntington’s disease-like 2, are a group of neurological and neuromuscular disorders that are caused by the expansion of 3–10 nucleotide repeats in the residing gene (page 1, ¶1). Zhang teaches DM1 is caused by a CTG repeat expansion in the 3’ UTR region of the DMPK gene (i.e., the mRNA transcript comprises a CUG repeat expansion in the 3’ UTR) (page 1, ¶2). Zhang teaches Cas13 family of proteins incudes Cas13a, Cas13b, Cas13c and Cas13d proteins (page 2, ¶3). Zhang demonstrates dCas13a targeted to the CUG repeat region to visualize RNA foci that cause DM1 (page 2, ¶1; Fig 1). Zhang teaches use a guide crRNA that is complementary to the CUG repeat expansion region of the DKPK transcript (Fig 1B). Zhang teaches the sequence of the guide crRNA region comprises a sequence that is complementary to 5’-CUGCUGCUGCUGCUGCUGCUGC (i.e., complementary to ctgctgctgctgctgctgctgc, which is SEQ ID NO 58) (Fig 1B). Zhang teaches the coding sequence for the Cas13 domain and the crRNA guide RNA are located on the same nucleic acid molecule (Fig 1A). Regarding claims 31 and 33, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the obvious autoregulated Cas13d-ZF-KRAB to target the DM1 CUG-expanded sequence of Zhang. It would have amounted to using the obvious fusion protein that could predictably be used to visualize target transcripts to target a known disease-causing transcript. The skilled artisan would have predicted that the CUG-expansion could be targeted by Cas13d because Cas13d crRNA design follows the same overall rule – 100% complementarity to the targeted sequence – as Cas13a effectors. The skilled artisan would have been motivated to target the CUG expansion repeat with the obvious autoregulated system because Gross teaches the autoregulation of fluorescent markers provides a closer representation of target molecule concentration in the cell to provide a higher signal to noise. Allowable Subject Matter Claim 25 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Claim 25 recites “the nucleic acid molecule of claim 1, comprising SEQ ID NO: 55.” Based on the disclosure from the Specification and alignment with known sequences in the prior art referenced above, SEQ ID NO 55 encodes an NLS-RxCas13d-(GSSS)3-CCR5 ZnF-KRAB(A) fusion protein. Nearly all of SEQ ID NO 55 is pieced together from known nucleic acid sequences in the prior art. For instance, positions 3046-3609 are 100% identical to the nucleic acid sequence for CCR5 ZnF-KRAB disclosed in Genbank and used in Bensussen, which are referenced above. Positions 3000-3045 encode for the well-known linker (GSSS)3 used in fusion proteins (See e.g., US 20200063126 A1). Positions 1-3000 encode the NLS-RxCas13d portion of the claimed fusion protein. According to the Specification, Addgene Vector #109049, first disclosed in Konermann et al., (Cell (2018), 173: 665-696) was used to clone the coding sequence for NLS-RxCas13d. However, there is a single nucleotide difference at position 4 between SEQ ID NO 55 and the sequence disclosed in Addgene Vector #109049 (https://www.addgene.org/109049/, [retrieved March 10, 2026]). The single nucleotide difference results in an AGC[Wingdings font/0xE0]GGC codon change and an S[Wingdings font/0xE0]G amino acid change as illustrated below (Query: Vector #109049, Sbjct: SEQ ID NO 55). PNG media_image1.png 62 708 media_image1.png Greyscale Examiner can find no evidence in the prior art for why the skilled artisan would change a serine residue to glycine residue before the well-known PKKKRK SV40 NLS sequence fused to a protein at the N-terminus. As such a nucleic acid molecule comprising all of SEQ ID NO: 55, with no deletions, substitutions, or internal insertions is not obvious in view of the prior art. Conclusion Claim 25 is objected to. All other pending claims are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jun 14, 2023
Application Filed
Mar 11, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454686
In Vitro Cleavage of DNA Using Argonaute
2y 5m to grant Granted Oct 28, 2025
Patent 12448630
CRISPR-CAS SYSTEMS AND USES THEREOF
2y 5m to grant Granted Oct 21, 2025
Patent 12442052
ANALYSIS OF POLYNUCLEOTIDES
2y 5m to grant Granted Oct 14, 2025
Patent 12435321
CRISPR/CAS12J ENZYME AND SYSTEM
2y 5m to grant Granted Oct 07, 2025
Patent 12416011
BIOCONTAINMENT/BIOCONTROL SYSTEM AND METHODS
2y 5m to grant Granted Sep 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+62.6%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month