Prosecution Insights
Last updated: October 01, 2026
Application No. 18/269,021

COMPOSITIONS AND METHODS FOR CONTROLLING PSYLLIDS

Non-Final OA §102§103§112§DOUBLEPATENT
Filed
Jun 22, 2023
Priority
Dec 23, 2020 — provisional 63/130,152 +1 more
Examiner
ORDAZ, CHRISTIAN JOSE
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Arizona Board of Regents on Behalf of the University of Arizona
OA Round
3 (Non-Final)
61%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allowance Rate
11 granted / 18 resolved
+1.1% vs TC avg
Strong +92% interview lift
Without
With
+91.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
25 currently pending
Career history
54
Total Applications
across all art units

Statute-Specific Performance

§101
8.6%
-31.4% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
16.8%
-23.2% vs TC avg
§112
37.1%
-2.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 18 resolved cases

Office Action

§102 §103 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 1, 9, 11, 14, 16, 22, and 29-31, are pending. Claims 2-8, 10, 12-13, 15, 17-21, 23-28, and 32-39, are cancelled. Claims 29-31, are withdrawn. Claims 1, 9, 11, 14, 16, and 22, are examined in the instant application. Upon further consideration claim 14 is rejoined and examined on its merits. All previous rejections not set forth below have been withdrawn. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Response to Amendments 2. Objections withdrawn from action: The specification objections is withdrawn. Status of Rejections from action: The rejection for Claims 1, 9, 11, 14, 16 and 22, under Double Patent is added. The rejection for Claims 1, 9, 11, 14, 16, and 22 under 112(a) Enablement is added. The rejection for Claims 1, 11, 14 and 16, under 102 is added. The rejection for Claim 22, under 103 is added. The rejection for Claims 1, 9, 11, 16, and 22 under 103 is withdrawn. Priority This application is claiming the priority benefit of provisional App# 63/130,152 filed 12/23/2020. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 9, 11, 14, 16 and 22, are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Application No. 18/681276 (hereafter ‘276). Although the claims at issue are not identical, they are not patentably distinct from each other because the synthetic RNA of ‘276 comprises SEQ ID NO:22, which has 100% sequence identity to SEQ ID NO:42 of the instant application. With regard to claims 1, 9 and 11, claim 7 of ‘276 is directed to a synthetic RNA comprising two components: a piRNA sequence and a target sequence, wherein the target sequence comprises at least 20 contiguous nucleotides of SEQ ID NO:22. SEQ ID NO:22 of ‘276 has 100% sequence identity to Applicant’s SEQ ID NO:42. The target sequence (SEQ ID NO:22) can be dsRNA (see p. 67, last paragraph of ‘276). The two components of claim 7 of ‘276 containing dsRNA of SEQ ID NO:22, renders obvious the single component containing dsRNA of SEQ ID NO:42 of the instant application. The two-component genus of ‘276 renders obvious the single component species of the instant application. With regard to claim 14, ‘276 does not teach a transgenic plant host but states that the synthetic RNA can be sprayed onto a plant and references multiple transgenic plant hosts comprising dsRNA (p. 52, last paragraph; pp. 79-80), rendering obvious the incorporation of the synthetic RNA into a plant host to produce a transgenic plant. With regard to claims 16 and 22, ‘276 discloses T7 promoters flanking the dsRNA for dsRNA synthesis (p. 59, first full paragraph). T7 promoter is a convergent promoter. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 9, 11, 14, 16, and 22, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. An “analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.” MPEP 2164.01. “A conclusion of lack of enablement means that. . . the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention [i.e. commensurate scope] without undue experimentation.” In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); MPEP 2164.01. In In re Wands, 858 F.2d 731,8 USPQ2d 1400 (Fed. Cir. 1988), several factors implicated in determination of whether a disclosure satisfies the enablement requirement and whether any necessary experimentation is “undue” are identified. These factors include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731,737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). No single factor is independently determinative of enablement; rather “[i]t is improper to conclude that a disclosure is not enabling based on an analysis of only one of the above factors while ignoring one or more of the others.” MPEP 2164.01. Likewise, all factors may not be relevant to the enablement analysis of any individual claim. (A) The breadth of the claims; The breadth of the claims encompass any dsRNA comprising at least 19 consecutive nucleotides of SEQ ID NO: 42 and any antisense region comprising a second sequence complementary entirely to the sense region having an unknown function. (B) The nature of the invention; The nature of the claimed invention is directed a double stranded RNA (dsRNA) that reduces the expression of a delta-24 sterol reductase. (C) The state of the prior art; The state of the art does not identify any sequence with at least 19 consecutive nucleotides to SEQ ID NO: 42 has a useful function. (D) The level of one of ordinary skill; The level of one ordinary skill in the art is high. (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based The claimed invention lacks adequate enabling experimentation for the following reasons. Claims 1, 11, 16, and 22, are directed to a dsRNA with at least 19 consecutive nucleotides. Applicants broadly claims a genus of all possible dsRNA sequences with at least 19 consecutive nucleotides having sequence identity to SEQ ID NO: 42, which can have sequence identity to other genes comprising 19 consecutive nucleotides in all possible organisms. 35 USC 112(a) states that one skilled in the art must be able to make and use the claimed invention While one skilled in the art can generate a population of sequences having at least 19 consecutive nucleotides of SEQ ID NO: 42, there is no evidence that one skilled in the art can use any such 19-mer. Applicant has no working example of a dsRNA having at least 19 consecutive nucleotides encoded by SEQ ID NO:42 having a useful function. In fact, Applicant has no working example of any dsRNA fragment of SEQ ID NO:42 having a useful function, including SEQ ID NO:98. The state of the art teaches non-specific binding of dsRNA to unintended targets. Applicant provides no guidance as to how operable embodiments can be identified or how inoperable embodiments can be readily eliminated without resorting to random trial and error requiring undue experimentation. Due to the low nucleotide sequence identity (19 consecutive nucleotides) it is not adequately taught which 19 nucleotides are required to prevent off-target effects. For example, Kang et al. (Small interfering RNA (siRNA)-based therapeutic applications against viruses: principles, potential, and challenges. Journal of biomedical science vol. 30,1 88. 16 Oct. 2023 (previously disclosed)) teaches that dsRNA’s are “21–23 nucleotide siRNAs with perfectly paired bases” (See page 2 left column second paragraph). Kang also teaches to prevent off-target effects “A BLAST search for cross-reactive 21-bp siRNA sequences can ensure siRNA target specificity” (See page 9 top left column second paragraph). Kang et al. teach that even partial homology can lead to unintended effects (See page 8 bottom left column second paragraph). There is no evidence that any 19 consecutive nucleotides of SEQ ID NO:42 is target specific for the delta-24 sterol reductase gene. Kovalic et al. (US 20070044171 A1(A)) teaches SEQ ID NO: 18135 obtained from a plant that has 100% sequence identity to 22 consecutive nucleotides to Applicant’s SEQ ID NO: 42 (see alignment). However, the sequence of Kovalic et al. has no known delta-24 sterol reductase activity. Thus, a dsRNA of 22 consecutive nucleotides of SEQ ID NO:18135 would bind and down-regulate a different plant gene. Therefore, it is highly unpredictable to determine which 19-mer of SEQ ID NO:42 would be sufficiently specific to target the delta-24 sterol reductase gene without non-specific binding to unintended targets without undue experimentation. Lastly, no function is recited for the claimed dsRNA. The claims are open to any resulting function the Applicant has not taught how one skilled in the art to identify a dsRNA with at least 19 consecutive nucleotides when the claim does not clarify what function to look out for or how to use the dsRNA. The specification provides zero examples of how one skilled in the art would use said dsRNA structure or provided enabling guidance. Therefore, it would be impossible for one in the art to readily identify or use said dsRNA structure without a function. Thus, for these reasons, one skilled in the art cannot make and use a sequence having at least 19 consecutive nucleotides having sequence identity to SEQ ID NO: 42 as commensurate in scope with the claims without undue experimentation. Given these difficulties, notwithstanding a relatively high level of ordinary skill of those in the art, the amount of experimentation would likely be extensive and undue. There is insufficient written description and guidance. An unnecessary amount of undue experimentation would be needed to produce dsRNA’s having at least 19 consecutive nucleotides having an unknown function to identify the desired function without enabling a representative number of variant species. Weighing all the Wands factors based on the totality of the record as discussed above, the Office determines that it would require undue experimentation for a person of ordinary skill in the art to make and use the invention as claimed. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1, 11, 14 and 16, are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Kovalic et al. (US 20070044171 A1(A)). In regard to claims 1 and 11, Kovalic et al. discloses SEQ ID NO: 18135 (claim 1) having 100% sequence identity to Applicants SEQ ID NO: 42 (see alignment), and interfering RNA, specifically dsRNA, of SEQ ID NO:18135 of 15 to 300 nucleotides in length [0090]. Kovalic et al. discloses that the dsRNA can be used on “genomic DNA from a polymorphic locus of SEQ ID NO: 1 through SEQ ID NO: 105,582 can be used in a recombinant construct for suppression of a cognate gene by RNAi suppression.” (pg. 2 para. [0010]). In regard to claim 14, Kovalic et al. teaches producing a transgenic plant comprising said sequence (claim 3). In regard to claim 16, Kovalic et al. discloses utilizing a promoter (claim 3 and para. [0057]). GenCore version 6.5.3 Copyright (c) 1993 - 2026 Biocceleration Ltd. OM nucleic - nucleic search, using oligo model Run on: May 20, 2026, 22:33:31 ; Search time 317 Seconds (without alignments) 163168.008 Million cell updates/sec Title: US-18-269-021-42 Perfect score: 1506 Sequence: 1 atgctttctgaggccaccct..........accgtggtgtccgagattga 1506 Scoring table: OLIGO_NUC Gapop 0.0 , Gapext 0.0 Searched: 71052184 unique seqs, 17172728613 residues Word size : 1 Total number of hits satisfying chosen parameters: 142103474 Minimum DB seq length: 1 Maximum DB seq length: 40000 Post-processing: Listing first 500 summaries Database : pubpna:* % Result Query Filing No. Score Match Length ID Date Dups Description ------------------------------------------------------------------------------------------------------------- 1 1506 100.0 1506 US-18-269-021-42 2023-06-22 1 COMPOSITIONS AND METHODS FOR CONTROLLING PSYLLIDS US-18-681-276-22 2024-02-05 SYNTHETIC RNAS AND USES THEREOF (en) 2 272 18.1 272 US-18-269-021-98 2023-06-22 0 COMPOSITIONS AND METHODS FOR CONTROLLING PSYLLIDS 3 28 1.9 8469 US-18-269-021-54 2023-06-22 1 COMPOSITIONS AND METHODS FOR CONTROLLING PSYLLIDS US-18-681-276-39 2024-02-05 SYNTHETIC RNAS AND USES THEREOF (en) 4 22 1.5 304 US-09-684-016-441287 2000-10-10 5 Annotated Plant Genes US-10-626-717-10434 2003-07-25 NUCLEIC ACID MOLECULES AND OTHER MOLECULES ASSOCIATED WITH PLANTS US-11-503-243A-441287 2006-08-14 Annotated Plant Genes US-11-980-671A-441287 2007-10-31 Annotated Plant Genes US-12-385-445-441287 2009-04-08 Annotated Plant Genes US-12-754-299-10434 2010-04-05 NUCLEIC ACID MOLECULES AND OTHER MOLECULES ASSOCIATED WITH PLANTS 5 22 1.5 384 US-14-106-988-26076 2013-12-16 8 MODIFIED POLYNUCLEOTIDES ENCODING APOPTOSIS INDUCING FACTOR 1 US-14-107-029-26076 2013-12-16 MODIFIED POLYNUCLEOTIDES ENCODING CASPASE 6 US-14-107-053-26076 2013-12-16 MODIFIED POLYNUCLEOTIDES ENCODING GRANULYSIN US-14-107-079-26076 2013-12-16 MODIFIED POLYNUCLEOTIDES ENCODING SEPTIN-4 US-14-107-105-26076 2013-12-16 MODIFIED POLYNUCLEOTIDES ENCODING SIAH E3 UBIQUITIN PROTEIN LIGASE 1 US-15-015-684-26076 2016-02-04 MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEP US-15-425-813-26076 2017-02-06 MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEP US-16-707-998-26076 2019-12-09 MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEP US-18-592-122-26076 2024-02-29 MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEP 6 22 1.5 711 US-16-098-844-76504 2018-11-02 1 mRNA Encoding Therapeutic Proteins US-17-359-902-76504 2021-06-28 RNA Encoding A Therapeutic Protein 7 22 1.5 711 US-18-929-823-76504 2024-10-29 0 RNA ENCODING A THERAPEUTIC PROTEIN (en) 8 22 1.5 904 US-10-703-032-18135 2003-11-06 4 Nucleic Acid Molecules And Other Molecules Associated With Plants US-11-785-162-18135 2007-04-16 Nucleic Acid Molecules And Other Molecules Associated With Plants US-13-507-812-18135 2012-07-31 Nucleic Acid Molecules And Other Molecules Associated With Plants US-14-182-694-18135 2014-02-18 Nucleic Acid Molecules And Other Molecules Associated With Plants US-15-047-375-18135 2016-02-18 Nucleic Acid Molecules And Other Molecules Associated With Plants RESULT 8 US-10-703-032-18135 (NOTE: this sequence has 4 duplicates in the database searched) Sequence 18135, US/10703032 Publication No. US20070044171A1 GENERAL INFORMATION APPLICANT: Kovalic, David K. APPLICANT: Andersen, Scott E. APPLICANT: Byrum, Joseph R. APPLICANT: Conner, Timothy W. APPLICANT: Cao, Yongwei APPLICANT: Masucci, James D. APPLICANT: Zhou, Yihua TITLE OF INVENTION: Nucleic Acid Molecules And Other Molecules Associated With TITLE OF INVENTION: Plants FILE REFERENCE: 38-21(53374)B CURRENT APPLICATION NUMBER: US/10/703,032 CURRENT FILING DATE: 2003-11-06 PRIOR APPLICATION NUMBER: 10/020,338 PRIOR FILING DATE: 2001-12-12 NUMBER OF SEQ ID NOS: 211164 SEQ ID NO 18135 LENGTH: 904 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: OTHER INFORMATION: Clone ID: PAT_TA_18135 Query Match 1.5%; Score 22; Length 904; Best Local Similarity 100.0%; Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1019 TCGGCTGGCTGATGCCCCCCAA 1040 |||||||||||||||||||||| Db 70 TCGGCTGGCTGATGCCCCCCAA 91 For these reason the prior art anticipates the claimed invention. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 22, are rejected under 35 U.S.C. 103 as being unpatentable over Kovalic et al. (US 20070044171 A1(A)) in view of Crane et al. (US 20190292543 A1(B)). In regard to claim 22, and the teachings of Kovalic et al. taught above. In regard to claim 22, Kovalic et al. does not teach convergent promoters. In regard to claim 22, Crane et al. teaches convergent “promoters that are oriented on either terminus of the operably linked polynucleotide encoding the silencing element such that each promoter drives transcription of the silencing element in opposite directions, yielding two transcripts. In such embodiments, the convergent promoters allow for the transcription of the sense and anti-sense strand and thus allow for the formation of a dsRNA” (para. [0101]). Therefore, prior to the effective filing date of the instant invention it would have been prima facie obvious to one of ordinary skill in the art to substitute the generic promoter of Kovalic et al. (2019) with the convergent promoters of Crane to produce a dsRNA flanked by the convergent promoters because Crane et al. specifically teaches that the convergent promoters “allow for the transcription of the sense and anti-sense strand and thus allow for the formation of a dsRNA” (para. [0101]). Accordingly, one skilled in the art would have been motivated to produce the claimed invention to target the gene of Kovalic with a reasonable expectation of success. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, Applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.J.O./Examiner, Art Unit 1663 /PHUONG T BUI/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jun 22, 2023
Application Filed
May 09, 2025
Non-Final Rejection mailed — §102, §103, §112
Aug 11, 2025
Response Filed
Oct 30, 2025
Non-Final Rejection mailed — §102, §103, §112
Feb 27, 2026
Response Filed
Jun 08, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12745741
REDUCING NITRATE REDUCTASE ACTIVITY IN TABACCO AND METHODS FOR ITS USE
3y 3m to grant Granted Sep 29, 2026
Patent 12721295
TRANSCRIPTION FACTOR
2y 9m to grant Granted Sep 01, 2026
Patent 12630837
AXMI477 TOXIN GENE VARIANTS AND METHODS FOR ITS USE
3y 9m to grant Granted May 19, 2026
Patent 12588644
ROOT-KNOT NEMATODE RESISTANCE CONFERRING GENE
3y 3m to grant Granted Mar 31, 2026
Patent 12565662
PLANT PATHOGEN EFFECTOR AND DISEASE RESISTANCE GENE IDENTIFICATION, COMPOSITIONS, AND METHODS OF USE
2y 4m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
61%
Grant Probability
99%
With Interview (+91.7%)
2y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 18 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month