DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Group I (claims 1-4) in the reply filed on February 24, 2026 is acknowledged. The traversal is on the ground that, if allowed, the Requirement for Restriction should be reconsidered. This is not found persuasive because searching for the polynucleotide of claims 1-4 would require different searches in different classes for other groups. However, in the interest of compact prosecution, claims 5-8 will be rejoined with elected claims 1-4 and examined.
Claims 9-11 are previously canceled and claims 12-21 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on February 26, 2026.
The requirement is still deemed proper and is therefore made FINAL.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. However, no certified translation has been submitted.
Information Disclosure Statement
The Information Disclosure Statements filed June 22, 2023; March 20, 2024; and April 23, 2025 have been considered.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Sequence Identifiers are required for the sequences at paragraphs [00186], [00223], [00230], [00232], and [00236].
Claim Objections
Claims 1, 3, and 7 are objected to because of the following informalities:
At claim 1, line 10, “and” should be inserted after “conditions;”.
At claim 3, line 2, “corresponding” should be deleted and “to” should be changed to “at.”
At claim 3, line 52, “and” should be inserted after the Pmdh-48 sequence.
At claim 7, line 1, it is suggested that “isolated” be inserted before “recombinant.”
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
At claim 1, lines 9-10, the phrase “high stringent hybridization conditions” is unclear because the term “high” is a relative term and the conditions are not set forth in the claims.
At claim 1, line 10, the phrase “very high stringent hybridization conditions” is unclear because the term “very high” is a relative term and the conditions are not set forth in the claims.
Claims 2-8 depend from claim 1 and are therefore included in these rejections.
At claim 1, line 17, the phrase “enhanced promoter activity” is unclear because the claim does not set forth the level of increased promoter activity.
Claims 3-8 depend from claim 1 and are therefore included in this rejection.
Allowable Subject Matter
Sequences listed as SEQ ID NOS: 3-51 appear to be free of the prior art. Thus, the mutant sequences, which are from position 105 to 126 of SEQ ID NO: 1, also appear to be free of the prior art.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Yukawa et al. (U.S. Patent Application Publication No. 2008/0171371, published July 17, 2008) discloses a promoter region from Coryneform bacteria having the sequence of instant SEQ ID NO: 1. However, claim 1 requires that the nucleotide sequence at position 105 to 126 is NOT TTCTCTTTTAAGCGGGATAGCA, which sequence is present in the promoter sequence disclosed by Yukawa.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NANCY J LEITH whose telephone number is (313)446-4874. The examiner can normally be reached Monday - Thursday 8:00 AM - 6:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, NEIL HAMMELL can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
NANCY J. LEITH
Primary Examiner
Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights