Prosecution Insights
Last updated: August 17, 2026
Application No. 18/269,450

COMPOSITIONS OF MODIFIED TREMS AND USES THEREOF

Non-Final OA §102§103§112§DOUBLEPATENT§OTHER§Other
Filed
Jun 23, 2023
Priority
Dec 23, 2020 — provisional 63/130,373 +6 more
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Flagship Pioneering Inc.
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
50%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
2 granted / 4 resolved
-10.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
34 currently pending
Career history
28
Total Applications
across all art units

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
30.7%
-9.3% vs TC avg
§102
10.9%
-29.1% vs TC avg
§112
34.7%
-5.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 4 resolved cases

Office Action

§102 §103 §112 §DOUBLEPATENT §OTHER §Other
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: 1) Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because the application does not contain a statement that the CRF is identical to the "Sequence Listing" part of the disclosure, as described above in item 1), as required by 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii). Required response - Applicant must provide such statement. 2) Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because the "Sequence Listing" as a separate part of the disclosure and the CRF of the “Sequence Listing” both miss mandatory disclosure information, i.e. nucleotide-specific GalNAc modification. See MPEP §2429 and §2422. A mandatory feature is required to cover every “n” or “Xaa” used in a sequence. The feature consists of numeric identifiers <220>, <221>, <222>, and <223>. The relevant information regarding nucleotide-specific ASGPR binding moiety required for compounds listed in Table 12 on page 258 of the specification is missing from the numeric identifiers <220>, <221>, <222>, and <223> of corresponding SEQ ID NOs. Required response - Applicant must provide: A substitute "Sequence Listing" part of the disclosure, as described above in item 1); together with An amendment specifically directing its entry into the application in accordance with 37 CFR 1.825(a)(2); A statement that the "Sequence Listing" includes no new matter as required by 37 CFR 1.825(a)(4); and A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(a)(3) If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. If the "Sequence Listing" part of the disclosure is submitted according to item 1) c) or d) above, Applicant must also provide: A CRF in accordance with 37 CFR 1.821(e)(1) or 1.821(e)(2) as required by 37 CFR 1.825(a)(5); and A statement according to item 2) a) or b) above. Application Status This action is written in response to applicant’s correspondence received 03/16/2026. Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are currently pending. Claim 64 is withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 65 are examined herein. The restriction requirement mailed on 01/15/2026 is still deemed proper. Election/Restrictions Applicant's election without traverse of Group I in the reply filed on 03/16/2026 is acknowledged. Claim 64 withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group II, there being no allowable generic or linking claim. The requirement is still deemed proper and is therefore made FINAL. Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 65 are examined on the merit herein. Applicant's elected Group I without traverse and elected “SEQ ID NO: 626” in the reply filed on 03/16/2023. Since the “Applicant is required to pick a single TREM compound listed in Table 12” in the Restriction/Election of Species mailed on 01/15/2026, it is interpreted that Applicant elected “Compound No. 103” comprising SEQ ID NO: 626, with a sequence of GGCUCCGUGGCGCAAUGGAUAGCGCAUUGGACUUCAAAUUCAAAGGU [GalNAc] UCCGGGUUCGAGUCCC GGCGGAGUCGCCA, which is Arg-TGA (47-U-GalNAc) according to Table 12 on page 258 of the instant specification, indicating a mandatory feature of GalNAc conjugation at the position 47-U/ or uridine 47. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application is a 371 of PCT/US2021/065159 filed on 12/23/2021; The claim for priority in PRO 63/130,381, PRO 63/130,373, PRO 63/130,387, PRO 63/130,374, PRO 63/130,377, and PRO 63/130,375, all filed on 12/23/2020, has been acknowledged. Claim Objections Claims 35, objected to because of the following informalities: The recitation “RA is hydrogen, or alkyl, alkenyl, alkynyl;” should be “RA is hydrogen, alkyl, alkenyl, or alkynyl”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 65 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, in defining “TREM”, the specification defines “A TREM can have a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9) of the structures and functions of (a)-(v)” on page 14, however, there are listing of (a’), (a’-1), (e’1), which creates ambiguity as to whether these are within the boundaries of (a)-(v). Regarding claim 3, since x and y could all be 0, the claimed ASGPR binding moiety cannot be present in any of the domains or linker regions in the claimed Formula A, creating ambiguity as to whether the ASGPR binding moiety is allowed to be absent, hence the scope is not clear. Regarding claims 23, 28, 52, the recitation of “Table 12” creates ambiguity. MPEP 2173.05(s) states: “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table ‘is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.’ Ex parteFressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).” Regarding claim 23, the referenced Table 12 is a list of compounds comprising specific SEQ ID NOs and can be described as such. Regarding claim 28, in addition to the same reasoning for rejection discussed above regarding claim 23, the claim is missing a transition phrase after “wherein the TREM”, e.g. “comprises” or “consists of”, which have distinct scopes, thereby creating ambiguity as to what is the required of said “TREM”. Regarding claim 52, in addition to the same reasoning for rejection discussed above regarding claim 23, the recitation “wherein the TREM is a compound provided in Table 12” further creates ambiguity regarding whether an ASGPR binding moiety is required or not because SEQ ID NOs 622, 650, 653 are unconjugated, SEQ ID NOs 630-632, 638-640, 647-648 also show a linker in addition to a nucleotide sequence but no ASGPR binding moiety is indicated in the SEQ ID or the sequencing listing. Therefore, they are not within the scope of claim 1, upon which claim 52 depends. Regarding claim 31, the recitation “the TREM is selected from SEQ ID NO. 622, SEQ ID NO. 650, SEQ ID NO. 653 or…” creates ambiguity regarding whether an ASGPR binding moiety is required or not because SEQ ID NOs 622, 650, 653 are “unconjugated”, which is interpreted as ASGPR binding moiety is absent, therefore, they are not within the scope of claim 1, upon which claim 31 depends. It is also unclear as to what would an ASGPR binding moiety count in the sequence identity similarity percentage with an unconjugated reference polynucleotide sequence. Table 12, wherein these SEQ ID NOs are listed, generally refers to a TREM, which requires (ii) an ASGPR binding moiety per claim 1. Regarding claim 35, it is unclear how the GalNAc is connected to L1. Nothing in the claim indicates the point of attachment. The metes and bounds of the compounds encompassed by the structure as claimed is unclear. This creates ambiguity regarding the scope of the claim. For example, if the R1 is hydrogen, in order to couple the OH residue of GalNAc to L1 the H has to be removed, but it is specifically recited as R1, thereby creating confusion as to the scope of the claimed compounds because R1 would not be present in this situation as it has to be removed in order to react with the O residue within L1. Furthermore, the letters “A”, “B”, “C” in the formula creates confusion as to what the claim requires as there is no other mention of these designators in the claim or the specification. Regarding claim 65, it fails to clearly define the statutory class of the invention by creating the confusion whether it is a process claim that broadly encompasses the composition or a product claim with intended use or desired outcome. See 2173.05(p)(II). Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 17, 43, 52 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 17, because a nucleobase can only be either naturally occurring or non-naturally occurring, it fails to further limit the scope of claim 1 that it depends from. Regarding claim 43, because under any given condition, a linker can only be either cleavable or non-cleavable as it is a binary state, it fails to further limit the scope of claim 35 that it depends from. Regarding claim 52, the recitation “[Unconjugated]” associated with some compounds in Table 12, e.g. Compound No. 99, 127, 130, indicates that claim 52 does not incorporate by reference all the limitations of the claim to which it refers. Claim 1, upon which claim 52 depends, requires (ii) an asialoglycoprotein receptor (ASGPR) binding moiety. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 17, 48, 50, 53 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Xu (Site-specific incorporation of the mucin-type N-acetylgalactosamine-alpha-O-threonine into protein in Escherichia coli. J Am Chem Soc. 2004 Dec 8;126(48):15654-5; Listed on IDS filed on 06/23/2023), as evidenced by D’Souza (Asialoglycoprotein receptor mediated hepatocyte targeting - strategies and applications. J Control Release. 2015 Apr 10;203:126-39). Based on disclosure of the Formula A in claim 1: [L1]y-[ASt Domain 1]x-[L2]x-[DH Domain]x-[L3]x-[ACH Domain]x -[VL Domain]y-[TH Domain]x-[L4]x-[ASt Domain2], since at least one embodiment of Formula A could have each x at 0, y could also be 0 as L1 and VL domains are optional/not required, the recitation of “comprising”, and that the term “TREM” is broadly defined in specification (pages 14-16), only very few preferred embodiments have functional limitations (Page 9, ¶6-8; Page 10, ¶2-3), under the broadest reasonable interpretation (BRI), the recited “TREM” encompasses the illustrated Tyr-tRNACUA structure in Figure 1 of Xu (Page 15654) because it clearly demonstrates the following elements: [ASt Domain 1]1-[L2]1-[DH Domain]1, [ACH Domain]1 -[VL Domain]1-[TH Domain]1, [ASt Domain2]1. [L2] is present because the 5’-AUGGUUCUGUAGGAAGGU…TGA3’ sequence shown below the tRNA structure illustration can be reasonably interpreted that R8R9 are represented as G only (R8 is absent, R9 is G), consistent with the consensus sequence definitions for Tyrosine tRNA TREMs on page 187, where R8=U or absent R9=N (A, C, T, or G) or absent. L1, L3, L4 are not required as y or x could be 0. Furthermore, TREM is not defined to exclude an amino acid attached at the 3’ end of the tRNA molecule as one of the “termini” of the TREM (pages 14-16). Regarding claim 1, Xu (2004) teaches a TREM that comprises a tRNA structure of Formula A and an ASGPR binding moiety, GalNAc, bound to one of the termini of the TREM on the 3’ end via a threonine amino acid bound to the ‘3 end of the depicted tRNA in Figure 1 (Page 15654). Regarding claim 17, Figure 1 of Xu (2004) teaches a partial sequence of a TREM showing naturally occurring nucleobases, A, U, G, C, T. Regarding claim 48, Xu teaches GalNAc, see Figure 1 (Page 15654). Regarding claim 50, Figure 1 of Xu (2004; Page 15654) teaches a TREM structure comprising an ASGPR carbohydrate, i.e. the GalNAc moiety, as evidenced by D’Souza (2015)’s teaching that “ASGPR … exhibits high affinity for carbohydrates specifically…, N-acetylgalactosamine …” (Page 126, Abstract, lines 3-5; full citation above), and a linker that connects GalNAc to the tRNA, the threonine amino acid. Regarding claim 53, Xu further teaches that the disclosed GalNAc-α-Threonine-Tyr-tRNACUA structure retains all claimed functions in claim 53 by showing the successful incorporation of GalNAc-α-Threonine in a polypeptide chain in Figure 1 (Page 15654), which would require all of: : (a) support protein synthesis; (b) be charged by a synthetase; (c) be bound by an elongation factor; (d) introduce an amino acid into a peptide chain; and/or (e) support elongation or support initiation. Since Xu (2004) teaches every limitation of claims 1, 17, 48, 50, 53, Xu anticipates these claims. Claims 1, 17, 35-36, 43, 48, 58-61 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Nair (Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing. J Am Chem Soc. 2014 Dec 10;136(49):16958-61), as evidenced by D’Souza (2015; see full citation above). Based on disclosure of the Formula A in claim 1: [L1]y-[ASt Domain 1]x-[L2]x-[DH Domain]x-[L3]x-[ACH Domain]x -[VL Domain]y-[TH Domain]x-[L4]x-[ASt Domain2], since at least one embodiment of Formula A could have each x at 0, y could also be 0 as L1 and VL domains are optional/not required, the recitation of “comprising”, and that the term “TREM” is broadly defined in specification (pages 14-16), only very few preferred embodiments have functional limitations described (Page 9, ¶6-8; Page 10, ¶2-3), under the broadest reasonable interpretation (BRI), the recited “TREM” encompasses any RNA sequence and an ASGPR binding moiety. Therefore, any RNA molecule, e.g. an siRNA, comprising a ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the molecule, or at one or both termini of the molecule, or within the internucleotide linkage, would read on the instant claim and be recognized as a TREM. Nair (2014) teaches “conjugation of optimized, chemically modified siRNAs to an engineered ASGPR ligand” (Page 16959, lines 1-2; Figures 1-2, Table 1). Regarding claim 1, Nair (2014) teaches both the Formula A, wherein both x and y are 0, and an ASGPR binding moiety/ligand conjugated to a nucleobase of an RNA strand via a phosphothioate (PS) linkage in Scheme 1 and Table 1 (Page 16959). Regarding claim 17, Table 1 (Page 16959) from Nair (2014) further teaches naturally occurring nucleobases. Regarding claim 35, which directs to a Formula III-b of a trivalent or triantennary GalNAc ASGPR binding moiety. Nair (2014; see full citation above) teaches an embodiment of a triantennary/trivalent GalNAc conjugated to an oligonucleotide RNA medicine matching all residue formula taught in the claim (Page 16959, Figure 1, top scheme, see below): PNG media_image1.png 393 877 media_image1.png Greyscale Each X is O; R1, 2a, 3-5, 6a-b, 7-9, A are Hs, R2b is COCH3 (Ac), m, n, o =1. L1-3 & M linkers are present. Regarding claim 36, the embodiment from Nair (2014) shown above still reads on this claim, and L1-3 & M linkers all comprise at least one alkylene, -CH2CH2-. Regarding claim 43, Nair (2014) further teaches “…unstable phosphodiester link between the oligonucleotide and GalNAc resulted in better activity than using stable PS bonds” (Page 1763, right column, first 2 lines), hence both cleavable and non-cleavable linkers are taught by Nair. Regarding claim 48, Table 1 (Page 16959) from Nair (2014) further teaches GalNAc. Regarding claim 50, Table 1 (Page 16959) from Nair (2014) further teaches GalNAc, ASGPR ligand/binding moiety comprising an ASGPR carbohydrate, i.e. the GalNAc moiety itself, as evidenced by D’Souza (2015) as discussed above, and a phosphothioate (PS) linker. Regarding claim 58, Nair further teaches “The binding affinity of ligands varies from micromolar to low-nanomolar…” (Page 16958, right column, 2nd¶, lines 7-10) which is interpreted to substantially overlap with the claimed range “between 0.01nM and 100mM”. Regarding claim 59, Table 1 (Page 16959) from Nair further teaches chemical modifications in the RNA molecules. Regarding claim 60, Nair further teaches “single dose (IV or SC)” (Page 16960, Figure 4), when discussing in vivo animal experiments. It is interpreted that the RNA medicine was given to animals in a pharmaceutical-grade composition for both intravenous (IV) route and the subcutaneous (SC) route, in compliance with federal Animal Welfare Act and the Guide (Page 31, 4th¶; Guide for the care and use of Laboratory Animals Eighth Edition; 2011; National Research Council of the National Academies). Regarding claim 61, Nair’s teaching above regarding multiple administration routes, e.g. SC or IV, for animal in vivo studies requires pharmaceutically acceptable components such as diluent or carrier solutions per requirement based on the Guide (see citation above). Since Nair teaches every limitation of claims 1, 17, 35-36, 43, 48, 58-61, Nair (2014) anticipates claims 1, 17, 35-36, 48, 58-61. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 17, 48, 50, 59-62 are rejected under 35 U.S.C. 103 as being unpatentable over Gullerova (WO2020240162, published on 12/02/2020, filed on 05/22/2020) in view of Miller (The nucleotide sequence of arginine tRNACCG from bovine liver. Nucleic Acids Res. 1983;11(7):2013-6), as evidenced by D’Souza (2015; see full citation above). Gullerova (12/02/2020) teaches that “tRNA-derived polynucleotide is conjugated to another moiety, for example an N-acetylgalactosamine (GalNAc) to aid delivery into the nucleus” (Page 7, lines 23-24), and “In an embodiment of the present invention, the polynucleotide comprises tRNA” (Page 6, line 10). Gullerova further teaches that the polynucleotide may comprise all or part of the sequence of a naturally occurring tRNA or a modified variant tRNA (Page 5, lines 11-15). Gullerova does not teach the Formula A of the claimed limitation in the instant claim 1. However, Miller (1983) teaches the sequence of a naturally occurring tRNAs, as an example, such as the Arg-tRNACCG from the bovine liver with a sequence of (Miller, page 2013, Abstract): R0 pG-A-C-C-C-A-G-U-m1G-m2G R9 R10 C-C-U-A-A-D-Gm-G-A-D- R19 R20 A-A-G-G-C-A-ψ-C-A-G- R29 R30 C-Cm-U-C-C-G-m1G-A-G-C- R39 R40 U-G-G-G-G-A-D-U-G-ψ- R49 R50 G-G-G-T-ψ-C-G-m1A-G-U- R59 R60 C-C-C-A-U-C-U-G-G-G- R69 R70 U-C-G-C-C-AOH” R75 Miller (1983) teaches that the arginine tRNA has identical structures as claimed in the Formula A of the instant claim 1, based on the fact that: 1). L1 is not required by the instant claim 1, 2). Figure 1a of Miller (1983; Page 2014) teaches: [ASt Domain 1], [DH Domain], [ACH Domain], [VL Domain], [TH Domain], [ASt Domain2] (See definition in the instant specification on Pages 7-11; Ast Domain 1 & 2 form the acceptor stem on top, DH Domain is the D-loop on the left, ACH Domain is the Anticodon Loop at the bottom, TH Domain is the TψC Loop on the right, VL Domain is the GGADU Variable Loop between the Anticodon Loop and the TψC Loop). 3). Miller teaches that the naturally occurring Arg-tRNACCG sequence above comprises all L2, L3, L4 linker regions (See definition on page 12 of the instant specification; R8-R9: GG; R29: G; R72: G), based on the consensus sequence formulas disclosed on pages 123-205 of the instant specification. Miller’s Arg-tRNACCG matches the Formula IIArg tRNAs: R8: G, U, or absent; R9: C, G, U, or absent; R29: A, G, U, or absent; R72: A, G, or absent (Page 129 of the instant specification). Hence, Miller’s example of a naturally occurring Arg-tRNA CCG has all required elements of Formula A: [ASt Domain 1]x-[L2]x-[DH Domain]x-[L3]x -[ACH Domain]x - [TH Domain]x-[L4]x-[ASt Domain2] and a [VL Domain] Regarding claim 1, Gullerova (2020), in view of Miller (1983), teaches all required Formula A components and a conjugated GalNAc, which is an ASGPR binding moiety. It would have been obvious to persons having ordinary skill in the art (PHOSITAs) to have modified the naturally occurring Arg-tRNACCG Miller isolated from bovine liver with a GalNAc conjugation to verify if a GalNAC-conjugated tRNA indeed enters the nucleus of a cell more effectively as taught by Gullerova, and would have arrived at the same product invention. Regarding claim 2, Miller teaches every element of Formula A with x=1. Regarding claim 3, Gullerova teaches GalNAc conjugation with the tRNA-derived polynucleotide/TREM, at least one embodiment is tRNA (Page 45, claim 6), the ASGPR moiety can only be present within one of the domain/components disclosed in the Formula A of claim 1 at least in some embodiments, in view of Miller’s tRNA example, Arg-tRNACCG, which has only those claimed domains and linker regions disclosed in Formula A of the instant claim 1, see sequence above. Regarding claim 17, Gullerova further teaches “The tRNA derived polynucleotide may be chemically synthesized RNA or an analogue of a naturally occurring RNA” (Page 5, lines 15-16). It is interpreted that “chemically synthesized” and “analogue” encompass non-naturally occurring nucleobase. Miller further teaches “we have isolated and determined the nucleotide sequence of an arginine tRNA from bovine liver” (Page 2013, Introduction, lines 2-3), so all nucleobases therein are naturally occurring. Regarding claim 48, Gullerova teaches conjugation to GalNAc (Page 7, lines 23-24). Regarding claim 50, Gullerova’s teaching of a tRNA-derived polynucleotide conjugated to N-acetylgalactosamine (GalNAc) inherently involves an ASGPR carbohydrate, i.e. the GalNAc moiety itself, as evidenced by D’Souza (2015) as discussed above in §102 rejection, and an ASGPR linker, the linker between the tRNA-derived polynucleotide/TREM and GalNAc. Regarding claim 59, Gullerova teaches chemical modification of the tRNA-derived polynucleotide/TREM (Page 45, claim 5). Regarding claim 60, Gullerova further teaches “a pharmaceutical composition for use as a medicament” (Page 17, line 8). Regarding claim 61, Gullerova further teaches “pharmaceutically-acceptable diluent or carrier” (Page 20, line 8). Regarding claim 62, Gullerova further teaches “The pharmaceutical composition may be specifically formulated for delivery of RNA molecules non-viral vectors such as exosomes, nanoparticles or liposomes …or lipid conjugated” (Page 21, lines 16-19), which is interpreted to encompass a lipid nanoparticle formulation comprising a TREM of claim 1. Claims 1-3, 17, 48, 50, 53, 59-62 are rejected under 35 U.S.C. 103 as being unpatentable over Ahern (WO/2019090154, published on 05/09/2019, filed on 11/02/2018; Listed on IDS filed on 03/16/2026), in view of Xiong (A story with a good ending: tRNA 3'-end maturation by CCA-adding enzymes. Curr Opin Struct Biol. 2006 Feb;16(1):12-7), in view of Gullerova (WO/2020240261A1, published on 12/02/2020, filed on 05/22/2020), further in view of Váradi (ABCC6 as a target in pseudoxanthoma elasticum. Curr Drug Targets. 2011 May;12(5):671-82) and Debacker (Delivery of Oligonucleotides to the Liver with GalNAc: From Research to Registered Therapeutic Drug. Mol Ther. Epub 2020 Jun 17; 28(8):1759-1771), as evidenced by D’Souza (2015; see full citation above). Ahern (2019) teaches an anti-codon edited-transfer RNA (ACE-tRNA) in Figure 2 comprising domains that are linked together in a equivalent fashion claimed in the Formula A: [ASt Domain 1]r-[L2]x-[DH Domain]x-[L3]x -[ACH Domain]x -[VL Domain]y- [TH Domain]x-[L4]x-[ASt Domain2], based on the fact that L1 is not required by the instant claim 1, and the teachings in the specification regarding the molecular structural basis for each domain:[ASt Domain 1], [DH Domain], [ACH Domain], [VL Domain], [TH Domain], [ASt Domain2] (Pages 7-11; Ast Domain 1 & 2 form the acceptor stem on top, DH Domain is the D-loop on the left, ACH Domain is the Anticodon Loop at the bottom, TH Domain is the TψC Loop on the right, VL Domain is the Variable Loop). Furthermore, L2, L3, L4 are defined on page 12 of the instant specification to comprise R8-R9 (L2), R29 (L3), and R72 (L4) based on consensus sequence formulas disclosed on pages 123-205. Ahern teaches at least one ACE-tRNA molecule encoded by a 73nt cDNA sequence SEQ ID NO: 105 (Page 66, Table 9; Page 53, line 13), named ArgTGAchrl. tRNA10 / nointron, included in a expression vector for screening effectiveness for overcoming a premature terminator codon (PTC) in the reporter NanoLuciferase (NanoLuc) gene in the same expression vector (Figure 4). Ahern does not teach how the functional ACE-tRNA acquire the 3’CCA tail in such a system, but does demonstrate effective functions of these encoded ACE-tRNAs in overcoming PTC mutations in the reporter gene NanoLuc and show effective ACE-tRNAs promote fullsize NanoLuc protein expression. Xiong (2006; see full citation above) teaches that "tRNAs, one of the oldest biomolecules, carry amino acids to the ribosome for protein biosynthesis. The amino acid attachment site at the 3' terminus of all mature tRNAs has a universally conserved CCA sequence. ... The maturation of the 3' terminus of tRNAs is achieved by an essential enzyme, the CCA adding enzyme (tRNA nucleotidyl-transferase), which catalyzes the post-transcriptional addition of CCA" (Page 12, lines 2-10). Hence, the ACE-tRNA cDNA taught by Ahern inherently leads to a mature tRNA with a 3’ CCA tail once it is transcribed in a cell. Regarding those embodiments listed in Table 9, “When transfected as cDNA, ACE-tRNAs rescued multiple full-length proteins via PTC suppression” (Page 53, lines 13-14) and “Potent and stable in vivo PTC suppression in mouse skeletal muscle was displayed by an ACE-tRNA Arg cDNA” (Page 53, lines 15-16), indicating the presence of the 3’-CCA tail. Therefore, a mature tRNA sequence below is encoded by ArgTGAchrl.tRNA10/nointron (SEQ ID NO: 105; Ahern) with 3’CCA tail post-transcriptionally added: L2:R8R9=GG L3:R29=G R0 GGCUCCGUGG CGCAAUGGAU AGCGCAUUGG R29 R30 ACUUCAAAUU CAAAGGUUCC GGGUUCGAGU R59 R60 CCCGGCGGAG UCG CCA R75 L4:R72=G The R0-R75 designation is based on the consensus sequences disclosed in the instant specification, page 129, regarding the Arg-tRNAs, Formula IIARG. The resultant mature ACE-tRNA RNA molecule comprises all of L2, L3, L4 linker regions as defined by the Arg-tRNA consensus sequence Formula IIARG disclosed on pages 12 and 129 of the instant specification, i.e. R8-R9 (GG) for L2, R29 (G) for L3, R72 (G) for L4, as well as all other structural domains in Formula A except the optional L1. Hence, Ahern teaches at least one RNA molecule embodiment that encompasses the claimed Formula A, encoded by the cDNA ACE-tRNA named ArgTGAchrl.tRNA10/nointron (SEQ ID NO: 105; Ahern). Xiong’s teaching also provides the option to delivery ACE-tRNA as RNA molecules with pre-modified 3’CCA tail, rather than using DNA-based expression vectors to target cells. Ahern does not teach that the ACE-tRNA molecule comprises an asialoglycoprotein receptor (ASGPR) binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the tRNA molecule, or at one or both termini of the tRNA molecule, or within the internucleotide linkage of a tRNA molecule. Because Ahern only teaches using cDNA to express ACE-tRNAs in target cells. However, Gullerova (12/02/2020) teaches “the tRNA-derived polynucleotide is conjugated to another moiety, for example an N-acetylgalactosamine (GalNAc)…”(Page 7, lines 23-24), and “In an embodiment of the present invention, the polynucleotide comprises tRNA” (Page 6, line 10). Gullerova further teaches that, in some embodiments, the tRNA-derived polynucleotide is tRNA (Page 45, claim 6). Neither Ahern nor Gullerova teaches explicit motivation for the ASGPR binding moiety conjugation in the context of applying engineered full size tRNAs to overcome premature stop codon (PTC) mutation disorders. However, Váradi (2011, see full citation above) teaches that PTC mutation in ABCC6 gene, which is predominantly expressed in liver, causes Pseudoxanthoma elasticum (PXE) via secretion from hepatocytes into systemic circulation, which causes a multisystem heritable disorder (Page 7, 2nd¶, lines 1-5). This provides strong rationale and motivation to deliver engineered tRNA therapeutics targeting PTC mutations in the liver. Váradi does not teach conjugation of an ASGPR binding moiety to an engineered tRNA for liver PTC mutation targeting. However, Debacker (2020, see full citation above) teaches that “Targeted delivery of oligonucleotides to liver hepatocytes using N-acetylgalactosamine (GalNAc) conjugates that bind to the asialoglycoprotein receptor has become a breakthrough approach in the therapeutic oligonucleotide field. This technology has led to the approval of givosiran for the treatment of acute hepatic porphyria…”. Debacker further teaches “These modifications give the conjugates enough nuclease stability to reach the liver after intravenous (i.v.) or subcutaneous injection”, an additional advantage over the complex manufacturing, delivery, pharmacokinetics, and economics-associated with DNA-based vectors. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from Ahern, Xiong, Gullerova, Váradi, and Debacker and would have modified the mature ACE-tRNA RNA molecule encoded by cDNA constructs taught by Ahern post-transcriptionally added with a 3’CCA tail with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of engineered RNA medicine, and potential benefits of subcutaneous administration described by Debacker to have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi, and would have arrived at the claimed TREM comprising a tRNA molecule according the Formula A of claim 1 and an ASGPR binding moiety. Regarding claim 1, the combined teachings from Ahern, Xiong, and Gullerova cover all structural limitations of claim 1. Gullerova further teaches “short fragments of tRNA … termed tsRNA” derived from tRNA to account for x=0 or 1 for the various domains as claimed (Page 3, line 35). Regarding claim 2, at least one embodiment of Ahern in view of Gullerova comprises at least one (x=1) of all claimed Formula A domains that are required, along with an ASGPR binding moiety. Regarding claim 3, the ASGPR binding moiety of Gullerova is present in one of the claimed domains in Formula A because at least some embodiments of Gullerova’s tRNA derived polynucleotide are naturally occurring tRNAs which comprise all or part of the sequence motifs of a naturally occurring tRNA or a modified variant tRNA (Page 5, lines 11-15). Regarding claim 17, at least some embodiments of Gullerova encompass naturally occurring tRNA, hence inherently comprising naturally occurring nucleobases. Regarding claim 48, Gullerova teaches GalNAc (Page 7, lines 23-24). Regarding claim 50, Gullerova teaches an ASGPR binding moiety, GalNAc, which is a ASGPR carbohydrate as evidenced by D’Souza (2015) as discussed above, conjugated to a tRNA derived polynucleotide, which inherently requires an ASGPR linker. Regarding claim 53, Ahern further teaches a library of ACE-tRNAs with valid PTC suppression effect based on a screening (Page 63, Table 9), which indicates that the engineered ACE-tRNAs (in bold font) demonstrated all claimed functions: (a) support protein synthesis; (b) be charged by a synthetase; (c) be bound by an elongation factor; (d) introduce an amino acid into a peptide chain; and/or (e) support elongation or support initiation. Regarding claim 59, Debacker further teaches “The key breakthrough for the use of GalNAc as a delivery moiety for oligonucleotides was to apply extensive chemical modifications at the 2’ position of the nucleotides …” (Page 1761, left column, 3rd ¶, lines 1-4; Page 1762, Figure 3). Regarding claim 60, Ahern further teaches “A composition comprising: the modified tRNA…a pharmaceutically acceptable carrier” (Page 97, claim 20), which is interpreted as a “pharmaceutical composition”. Gullerova also teaches a “Pharmaceutical composition comprising a tRNA-derived polynucleotide…” (Page 47, claim 23). Hence, Ahern in view of Gullerova teaches a pharmaceutical composition comprising a TREM. Regarding claim 61, Ahern teaches a “pharmaceutically acceptable carrier”, see above. Regarding claim 62, Ahern further teaches “wherein the carrier is a liposome” (Page 97, claim 21), which is interpreted as a type of lipid nanoparticle. Gullerova further teaches “The pharmaceutical composition may be specifically formulated for delivery of RNA molecules non-viral vectors such as exosomes, nanoparticles or liposomes …or lipid conjugated” (Page 21, lines 16-19), which is interpreted to encompass a lipid nanoparticle formulation comprising a TREM of claim 1. Claims 35, 36, 43 are rejected under 35 U.S.C. 103 as being unpatentable over Ahern (2019), in view of Xiong (2006), Gullerova (2020), Váradi (2011), and Debacker (2020) as applied to claims 1-3, 17, 48, 50, 53, 59-62 above, and further in view of Nair (2014; See full citation in §102 rejection above). The teachings of Ahern, Xiong, Gullerova, Váradi, and Debacker have been discussed above. None of Ahern, Xiong, Gullerova, Váradi, and Debacker teaches a TREM compound wherein the ASGPR binding moiety comprises a structure of Formula (III-b). Nair (2014) teaches an embodiment of a triantennary/trivalent GalNAc conjugated to an oligonucleotide RNA medicine matching all residue formula taught in the claim (Page 16959, Figure 1, top scheme, see above in §102 Rejection). Each X is O; R1, 2a, 3-5, 6a-b, 7-9, A are Hs, R2b is COCH3 (Ac), m, n, o =1. L1-3 & M linkers are present. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from Ahern, Xiong, Gullerova, Váradi, and Debacker and would have modified the mature ACE-tRNA RNA molecule encoded by cDNA constructs taught by Ahern post-transcriptionally added with a 3’CCA tail with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of engineered RNA medicine, and potential benefits of subcutaneous administration described by Debacker to have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi, and would have arrived at the claimed TREM comprising a tRNA molecule according the Formula A of claim 1 and an ASGPR binding moiety. Given the observed benefits of trivalent or triantennary GalNAc by Debacker that “The affinity of the ASGPR for a trimer of GalNAc is 1,000-fold higher than a dimer and 1,000-fold higher than a monomer” (Page 1762, right column, 2nd ¶, lines 4-5, PHOSITAs would have been motivated to try combine the triantennary GalNAc structures for conjugating the TREM to enhance the targeting efficiency and update specificity based on the increased binding affinity to ASGPRs expressed on hepatocytes. Regarding claim 35, the combined teachings of Ahern, Xiong, Gullerova, Váradi, Debacker and Nair would have led to the creation of a TREM comprising an ASGPR binding moiety in Formula (III-b). Regarding claim 36, the embodiment from Nair (2014) shown above also reads on this claim, and L1-3 & M linkers all comprise at least one alkylene, -CH2CH2-. Regarding claim 43, Nair (2014) further teaches “…unstable phosphodiester link between the oligonucleotide and GalNAc resulted in better activity than using stable PS bonds” (Page 1763, right column, first 2 lines), hence both cleavable and non-cleavable linkers are taught by Nair. Claim 23 is rejected under 35 U.S.C. 103 as being unpatentable over Ahern (2019), in view of Xiong (2006), Gullerova (2020), Váradi (2011), and Debacker (2020) as applied to claims 1-3, 17, 48, 50, 53, 59-62 above, and further in view of Blechschmidt (Undecagold cluster modified tRNA(Phe) from Escherichia coli and its activity in the protein elongation cycle. Eur J Biochem. 1994 Jan 15;219(1-2):65-71Eur J Biochem. 1994 Jan 15;219(1-2):65-71). The teachings of Ahern, Xiong, Gullerova, Váradi, and Debacker have been discussed above. Regarding claim 23, None of Ahern, Xiong, Gullerova, Váradi, and Debacker teaches a TREM compound NO. 103, with SEQ ID NO: 626, which has a GalNAc conjugated at Uridine 47 (U47) as the elected species that is 76nt long. Ahern teaches an ACE-tRNA sequence (Page 66, SEQ ID NO: 105) which is a 73nt cDNA sequence of the vector for a screening assay that encodes a tRNA sequence (Page 53, lines 13-14) and it matches 100% of the 76nt sequence at the 5’ end of SEQ ID NO: 626 after post transcriptional addition of the 3’CCA tail, as evidenced by Xiong (2006) discussed above. Therefore, based on the alignment below, Ahern teaches the nucleotide sequence of the elected TREM compound NO. 103 (SEQ ID NO: 626), but Ahern does not teach a GalNAC ASGPR binding moiety at U47. Although Gullerova teaches a conjugated GalNAc ASGPR binding moiety, Gullerova does not teach U47 position for the GalNAc conjugation. A: TREM Compound NO. 103 (tRNA-U47GalNAc), SEQ ID NO: 626 (Table 12, page 258, instant spec) [U47GalNAc] A: ggcuccgugg cgcaauggau agcgcauugg acuucaaauu caaaggu[u]cc ggguucgagu cccggcggag ucg cca |||||||||| |||||||||| |||||||||| |||||||||| ||||||| | || |||||||||| |||||||||| ||| ||| B: GGCUCCGUGG CGCAAUGGAU AGCGCAUUGG ACUUCAAAUU CAAAGGU U CC GGGUUCGAGU CCCGGCGGAG UCG CCA C: GGCTCCGTGG CGCAATGGAt AGCGCATTGG ACTtcaAATT CAAAGGt T CC GGGTTCGAGT CCCGGCGGAG TCG B: ACE-tRNA ArgTGAchrl.trnalO/nointron gene (RNA), ACE-tRNA of SEQ ID NO: 105 with CCA added C: ACE-tRNA ArgTGAchrl.trnalO/nointron gene (DNA), SEQ ID NO: 105 (Table 9, page 66, Ahern) However, Blechschmidt (1994) teaches “an undecagold cluster (Au11) of molecular mass 6200Da was attached to the 3-(3-amino-3-carboxypropy1) uridine at position 47 of tRNAPhe…” and such a large conjugate does not interfere with the essential tRNA functions such as aminoacylation, complexing with elongation factors, and other protein translation functions (Page 65, Abstract). Given that tRNA functions depend on proper secondary and tertiary structures, it is essential that large size conjugates do not interfere with the complex interactions between tRNAs and proteins and mRNAs. It would have been obvious for a person of ordinary skill in the art before the effective filing date of the claimed invention to have followed the teachings, strategies, and motivations of Ahern, Xiong, Gullerova, Váradi, and Debacker and modified the ACE-tRNA cDNA of Ahern by transcribing a mature tRNA that include a 3’-CCA tail and conjugating ASGPR binding moieties, such as a GalNAc or variants, to the nucleoside of the ACE-tRNA to form a TREM molecule. Since there are only about 75-90 nucleotides for each modified tRNA, there is a finite number of positions within the molecule to conjugate an ASGPR binding moieties based on the success of GalNAc conjugated siRNAs and antisense oligonucleotides, there is reasonable expectation of success for persons having ordinary skill in the art (PHOSITAs) to identify a predictable outcome to resolve a known issue involving targeted delivery, under an “obvious to try” rationale. In view of Blechschmidt, the likelihood of success can be even further improved with fewer attempts given the established success conjugating a large molecule to the highly conserved U47 position in a tRNA. Following all the teachings, strategies, and motivations of Ahern, Xiong, Gullerova, Váradi, Debacker, and Blechschmidt, PHOSITAs would have arrived at the same invention, a TREM compound of the SEQ ID NO: 626. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. U.S. Patent No. 12121531 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5-7, 9-14 of U.S. Patent No. 12121531 issued to Anastassiadis (hereinafter, Anastassiadis’531), in view of Gullerova (2020), Váradi (2011), and further in view of Debacker (2020). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims. The instant application is not a divisional application. Anastassiadis’531 teaches a method of delivering a tRNA-based effector molecule (TREM) to a cell or a subject, comprising administering to the cell or subject a TREM in claim 1. The specification further defines that “In one aspect, provided herein is a TREM comprising a sequence of Formula A: [L1]-[ASt Domainl]-[L2]-[DH Domain]-[L3]-[ACH Domain] -[VL Domain]-[TH Domain]-[L4]-[ASt Domain2], wherein independently, [L1] and [VL Domain], are optional; and one of [L1], [ASt Domainl], [L2]-[DH Domain], [L3], [ACH Domain], [VL Domain], [TH Domain], [L4], and [ASt Domain2] …” which is at least one embodiment of the component (i) Formula A comprised in the TREM claimed by the instant claim 1. Anastassiadis’531 further teaches TREM molecules in Table 15 (Page 229), particularly, one non-modified base molecule with a SEQ ID NO: 622. SEQ ID NO: 622 share 100% nucleotide sequence identity similarity with the applicant elected species TREM compound NO. 103 with SEQ ID NO: 626, see alignment below: A: TREM Compound NO. 103 (tRNA-U47GalNAc), SEQ ID NO: 626 (Table 12, page 258, instant spec) [U47GalNAc] A: ggcuccgugg cgcaauggau agcgcauugg acuucaaauu caaaggu[u]cc ggguucgagu cccggcggag ucgcca |||||||||| |||||||||| |||||||||| |||||||||| ||||||| | || |||||||||| |||||||||| |||||| B: ggcuccgugg cgcaauggau agcgcauugg acuucaaauu caaaggu u cc ggguucgagu cccggcggag ucgcca B: TREM of SEQ ID NO: 622 (Anastassiadis’531, Table 15 on Page 230) Anastassiadis’531 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, Gullerova (12/02/2020; see full citation in §103 rejection above) teaches “the tRNA-derived polynucleotide is conjugated to another moiety, for example an N-acetylgalactosamine (GalNAc)…”(Page 7, lines 23-24), and “In an embodiment of the present invention, the polynucleotide comprises tRNA” (Page 6, line 10). Gullerova further teaches that, in some embodiments, the tRNA-derived polynucleotide is tRNA (Page 45, claim 6). Neither Anastassiadis’531 nor Gullerova teaches explicit motivation for the ASGPR binding moiety conjugation in the context of applying engineered full size tRNAs to overcome premature stop codon (PTC) mutation disorders. However, Váradi (2011, see full citation in §103 rejection above) teaches that PTC mutation in ABCC6 gene, which is predominantly expressed in liver, causes Pseudoxanthoma elasticum (PXE) via secretion from hepatocytes into systemic circulation, which causes a multisystem heritable disorder (Page 7, 2nd¶, lines 1-5). This provides strong rationale and motivation to deliver engineered tRNA therapeutics targeting PTC mutations in the liver. Váradi does not teach conjugation of an ASGPR binding moiety to an engineered tRNA for liver PTC mutation targeting. However, Debacker (2020, see full citation in §103 rejection above) teaches that “Targeted delivery of oligonucleotides to liver hepatocytes using N-acetylgalactosamine (GalNAc) conjugates that bind to the asialoglycoprotein receptor has become a breakthrough approach in the therapeutic oligonucleotide field. This technology has led to the approval of givosiran for the treatment of acute hepatic porphyria…”. Debacker further teaches “These modifications give the conjugates enough nuclease stability to reach the liver after intravenous (i.v.) or subcutaneous injection”, an additional advantage over the complex manufacturing, delivery, pharmacokinetics, and economics-associated with DNA-based vectors. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from Anastassiadis’531, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by Anastassiadis’531 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claim 1 of Anastassiadis’531 corresponds to the instant claims 1-3, 17, 23, 28, 31, 35, 36, 43, 48, 50, 52, 53. Claims 5-7,9-12 of Anastassiadis’531 corresponds to the instant claims 17, 59. Claim 13 of Anastassiadis’531 corresponds to the instant claims 60-62. Claim 14 of Anastassiadis’531 corresponds to the instant claim 65. Application No. 17/423,700 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1, 3, 21-22, 26, 35 of copending Application No. 17/423,700 (hereinafter, App’700), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’700 teaches a method of making purified tRNA-based effector molecule (TREM) pharmaceutical composition claim 1. The specification further defines that TREM “refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 112, lines 19-20), and the disclosure about (a)-(v) (pages 112-117) encompass all features of the claimed Formula A of the instant claim 1, the optional [Linker 1 region], an [AStD, R1-R7] that comprises the 3’CCA tail, [Linker 2 region], a [DHD], a [Linker 3 region], a [ACHD], a [VLD], a [THD], a [Linker 4 region], [AStD R65-R71]. This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. App’700 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’700, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’700with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1, 3, 22 of App’700 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 21, 26 of App’700 correspond to the instant claims 60-62. Claim 35 of App’700 corresponds to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 17/615,427 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1, 3, 13-14, 16, 17, 21-23, 25, 57, 64 of copending Application No. 17/615,427 (hereinafter, App’427), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’427 teaches a method of modulating tRNA pool in a cell or a subject using tRNA-based effector molecule (TREM) pharmaceutical composition claim 1. The specification further defines that TREM “refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 52, lines 26-27), and the disclosure about (a)-(v) (pages 52-56) encompass all features of the claimed Formula A of the instant claim 1 including a plurality of linkers between domains (Page 57): an [AStD] that comprises the 3’CCA tail, [Linker 2], a [DHD], a [Linker 3], a [ACHD], a [VLD], a [THD], a [Linker 4]. This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. App’427 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’427, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’427 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1, 3, 22, 57 of App’427 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 13-14, 16, 64 of App’427 correspond to the instant claims 60-62. Claims 13-14, 16, 17, 21, 23, 25, 57, 64 of App’427 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 17/744,410 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1, 3-6, 20-23, 25 of copending Application No. 17/744,410 (hereinafter, App’410), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’410 teaches a method of modulating a production parameter (i.e. a contextually-rare, or con-rare, codon) of an RNA in a target cell or tissue of a subject using tRNA-based effector molecule (TREM) of claim 1. The specification further defines that TREM “refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 55, lines 21-22), and the disclosure about (a)-(v) (pages 55-60) encompass all features of the claimed Formula A of the instant claim 1, the optional [Linker 1 region], an [AStD, R1-R7] that comprises the 3’CCA tail, [Linker 2 region], a [DHD], a [Linker 3 region], a [ACHD], a [VLD], a [THD], a [Linker 4 region], [AStD R65-R71]. This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. App’410 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’410, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’410 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1 & 6 of App’410 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 20-23, 25 of App’410 correspond to the instant claims 60-62. Claims 1, 3-5 of App’410 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 17/928,450 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 7, 13, 18, 20, 27, 28, 35, 36, 62, 63, 66, 74 of copending Application No. 17/928,450 (hereinafter, App’450), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’450 teaches a method of modulating a tRNA pool in a subject having or a cell using tRNA-based effector molecule (TREM) of claim 7. The specification further defines that TREM “refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 24, lines 11-12), and the disclosure about (a)-(v) (pages 24-29) encompass all features of the claimed Formula A of the instant claim 1, the optional [Linker 1 region], an [AStD, R1-R7] that comprises the 3’CCA tail, [Linker 2 region], a [DHD], a [Linker 3 region], a [ACHD], a [VLD], a [THD], a [Linker 4 region], [AStD R65-R71]. This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. App’450 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’450, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’450 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 7, 13, 18, 74 of App’450 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 62, 63, 66, 74 of App’450 correspond to the instant claims 60-62. Claims 18, 20, 27, 28, 35, 36 of App’450 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 17/928,463 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1, 5, 7-8, 10-11, 18, 20, 24, 33, 37, 54, 61, 66, 67 of copending Application No. 17/928,463 (hereinafter, App’463), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’463 teaches a method of modulating a production parameter of an mRNA corresponding to, or polypeptide encoded by, an endogenous open reading frame (ORF) in a cell or subject using a tRNA-based effector molecule (TREM) composition comprising TREM of claim 1. Claim 54 further defines that TREM “comprises a sequence of Formula A:[L1]-[ASt Domain1]-[L2]-[DH Domain]-[L3]-[ACH Domain]-[VL Domain]-[TH Domain]-[L4]-[ASt Domain2], wherein: independently, [L1] and [VL Domain], are optional; one of [L1],[ASt Domainl],[L2]-[DH Domain],[L3],[ACH Domain],[VL Domain],[TH Domain],[L4], and [ASt Domain2] comprises … ; and wherein: (a) the TREM retains the ability to: support protein synthesis, be charged by a synthetase, be bound by an elongation factor, introduce an amino acid into a peptide chain, support elongation, or support initiation; (b) the TREM comprises at least …” This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’463 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’463, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’463 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1, 5, 7-8, 10-11, 18, 20, 24, 33, 37, 54, 61, 67 of App’463 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claim 66 of App’463 corresponds to the instant claims 60-62. Claims 1, 5, 7-8, 10-11 of App’463 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/205,363 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-12, 18-19, 22-26, 28-29, 35, 37-38, 40, 55-56 of copending Application No. 18/205,363 (hereinafter, App’363), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’363 teaches a method of evaluating a tRNA-based effector molecule comprising a modified nucleotide (mTREM) for the presence of the modified nucleotide. Claim 28 further defines that a mTREM is a tRNA-based effector molecule “comprising a sequence of Formula A:[L1]-[ASt Domain1]-[L2]-[DH Domain]-[L3]-[ACH Domain]-[VL Domain]-[TH Domain]- [L4]-[ASt Domain2] (Formula A), wherein independently, [L1] and [VL Domain], are optional; and one of [L1], [ASt Domaini], [L2], [DH Domain], [L3], [ACH Domain], [VL Domain], [TH Domain], [L4], and [ASt Domain2] comprises the modified nucleotide.…” This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’363 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’363, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’363 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-12, 18-19, 22-26, 28-29, 35, 37-38, 40, 55-56 of App’363 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/292,098 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-2, 24-25, 27, 29-30, 41-42, 48, 51, 54 of copending Application No. 18/292,098 (hereinafter, App’098), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’098 teaches a method of making a purified tRNA effector molecule (TREM) composition. The specification further defines that TREM on page 126, lines 5-6: “TREM refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 126, lines 5-6), and the disclosure about (a)-(v) (pages 124-133) encompass all features of the claimed Formula A of the instant claim 1, the optional an [AStD, R1-R7] that comprises the 3’CCA tail, a [DHD], a [ACHD], a [VLD], a [THD], an [AStD R65-R71], and “a plurality of linkers” (Page 132, line 12). This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’098 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’098, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’098 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-2, 24-25, 27, 29-30, 41-42, 48, 51, 54 of App’098 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 41-42, 48, 51, 54 of App’098 correspond to the instant claims 60-62. Claim 48 of App’098 corresponds to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/700,523 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-3, 10, 14, 16-17, 19, 22, 43, 64, 85, 106, 127, 152, 154, 156 of copending Application No. 18/700,523 (hereinafter, App’523), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’523 teaches a tRNA effector molecule (TREM) comprising a sequence of Formula (I):[L1]-[ASt Domain1]-[L2]-[LDH Domain]-[L3]-[LACH Domain]-[LVL Domain]-[TH Domain]-[L4]-[ASt Domain2] (I), wherein: independently, [L1] and [VL Domain], are optional; a nucleotide within [L1]-[ASt Domain1]-[L2] comprises a non-naturally occurring modification, and the nucleotide within [L1]-[ASt Domain1]-[L2] comprising the non-naturally occurring modification is selected from nucleotide positions 1-9 of a reference seqiuence. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’523 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’523, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’523 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-3, 10, 14, 16-17, 19, 22, 43, 64, 85, 106, 127, 152, 154, 156 of App’523 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claim 152 of App’523 corresponds to the instant claims 60-62. Claim 156 of App’523 corresponds to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/820,096 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-15 of copending Application No. 18/820,096 (hereinafter, App’096), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’096 teaches a method of making a purified tRNA effector molecule (TREM) composition. The specification further defines that: “TREM refers to an RNA molecule comprising a structure or property from (a)-(v) below” (Page 60, lines 1-2), and the disclosure about (a)-(v) (pages 60-72) encompass all features of the claimed Formula A of the instant claim 1, the optional [Linker 1 region], an [AStD, R1-R7] that comprises the 3’CCA tail, [Linker 2 region], a [DHD], a [Linker 3 region], a [ACHD], a [VLD], a [THD], a [Linker 4 region], [AStD R65-R71]. This disclosure is at least one embodiment of the component (i) Formula A in the TREM claimed by the instant claim 1. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’096 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’096, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’096 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-15 of App’096 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claim 14 corresponds App’096to the instant claims 60-62. Claim 15 corresponds App’096 to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/864,142 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-4, 6-7, 17-18, 25, 29-30, 33, 41-42, 50, 53, 57 of copending Application No. 18/864,142 (hereinafter, App’142), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’142 teaches a composition for use in treating a proliferative disease in a subject, the composition comprising a tRNA-based effector molecule (TREM). The claim 2 defines the TREM as a molecule comprising a sequence of Formula (I):[L1]-[ASt Domain1]-[L2]-[LDH Domain]-[L3]-[LACH Domain]-[LVL Domain]-[TH Domain]-[L4]-[ASt Domain2] (I), wherein: independently, [L1] and [VL Domain], are optional. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’142 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’142, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’142 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-4, 6-7, 17-18, 25, 29-30, 33, 41-42, 50, 53, 57 of App’142 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 1-4, 6-7, 17-18, 25, 29-30, 33, 41-42, 50, 53, 57 of App’142 correspond to the instant claims 60-62. Claims 1, 4, 41, 45 of App’142 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 18/877,922 Claim 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-55 of copending Application No. 18/877,922 (hereinafter, App’922). Although the claims at issue are not identical, they are not patentably distinct from each other. App’992 teaches a tRNA-based effector molecule (TREM) comprising an asialoglycoprotein receptor (ASGPR) binding moiety, wherein the ASGPR binding moiety is bound to a sugar moiety (e.g., a ribose moiety), nucleobase, or the internucleotide linkage (e.g., the phosphate backbone) of a nucleotide within a TREM sequence, wherein the TREM comprises:(i) a sequence of Formula A comprising:[L1]y-[ASt Domain 1]x-[L2]x-[DH Domain]x-[L3]x-[ACH Domain]x-[VL Domain]y-[TH Domain]x -[L4]x -[ASt Domain2]x, (A); and (ii) an asialoglycoprotein receptor (ASGPR) binding moiety (e.g., a GalNAc moiety, e.g., GalNAc); and wherein y is 0 or 1 and x is 1. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1, therefore, claim 1 of App’922 anticipates the instant claim 1. Claims 1, 4-18 of App’922 correspond to the instant claims 1, 2, 17, 43. Claims 19-24 of App’922 correspond to the instant claims 3. Claims 2, 3, 25 of App’922 correspond to the instant claims 35-36, 43, 48, 50-51. Claims 26-30of App’922 correspond to the instant claims 53. Claim 31 of App’922 corresponds to the instant claims 58. Claims 32-36 of App’922 correspond to the instant claim 59. Claims 37-49 of App’922 correspond to the instant claims 23, 28, 31, 52. Claim 50 of App’922 corresponds to the instant claim 60-61. Claim 51 of App’922 corresponds to the instant claim 62. Claims 53-55 of App’922 correspond to the instant claim 65. Application No. 19/474,577 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-70 of copending Application No. 19/474,577 (hereinafter, App’577), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’577 teaches a tRNA effector molecule (TREM) comprising a sequence of Formula (I): [L1]x-[ASt Domainl1]-[L2]x-[DH Domain]-[L3]x-[ACH Domain] -[VL. Domain]-[TH Domain]-[L4]x-[ASt Domain2]-[L5]x, wherein: independently, [L1] and [VL Domain], are optional; x is 0 or 1; and the TREM comprises a nucleotide substitution (e.g., a nucleotide mutation) in the TREM capable of modulating a functional parameter of the TREM. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’577 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’577, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’577 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-70 of App’577 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 62-67 of App’577 correspond to the instant claims 60-62. Claims 3-4, 66-69 of App’577 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 19/474,579 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1, 12-21, 26-27, 35, 39-42, 44-71 of copending Application No. 19/474,579 (hereinafter, App’579), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’579 teaches a method for inserting a missense mutation into an open reading frame (ORF) of a gene, wherein the missense mutation results in replacing a repeat expansion disease (RED) codon with a replacement codon, the method comprising contacting the ORF with a tRNA effector molecule (TREM) comprising a sequence of Formula (A):[Li]x-[ASt Domain 1 ]-[L2]x-[DH Domain]-[L3]x-[ACH Domain]-[VL Domain]-[TH Domain]-[L4]x-[ASt Domain2]-[L5]x (A), wherein: independently, [L1] and [VL Domain], are optional and x = 0 or 1, … This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’579 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’579, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’579 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1, 12-21, 26-27, 35, 39-42, 44-71 of App’579 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 65-68 of App’579 correspond to the instant claims 60-62. Claim 69 of App’579 corresponds to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 19/474,583 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, 64, and 65 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-57 of copending Application No. 19/474,583 (hereinafter, App’583), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’583 teaches a tRNA effector molecule (TREM) comprising a sequence of Formula (A):[L1]x-[ASt Domain 1 ]-[L2]x-[DH Domain]-[L3]x-[ACH Domain] -[VL Domain]-[TH Domain]-[L4]x-[ASt Domain2]-[L5]x (A), wherein: independently, [L1], [L5], and [VL Domain], are optional; x is 0 or 1; a nucleotide within the TREM sequence comprises a locked nucleic acid (LNA) moiety or 2',5'-linked nucleotide. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’583 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’583, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’583 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-57 of App’583 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 50-55 of App’583 correspond to the instant claims 60-62. Claims 54-57 of App’583 correspond to the instant claim 65. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Application No. 19/552,819 Claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50-53, 58-62, and 64 are rejected on the ground of provisional nonstatutory double patenting as being unpatentable over claims 1-24 of copending Application No. 19/552,819 (hereinafter, App’819), in view of Gullerova (2020), Váradi (2011), Debacker (2020), and further in view of Blechschmidt (1994). See full citations of all prior arts in §103 rejection above. Although the claims at issue are not identical, they are not patentably distinct from each other. App’819 teaches a TREM comprising a sequence of Formula A:[L1]-[ASt Domain1]-[L2]-[DH Domain]- [L3]- [ACH Domain] -[VL Domain]-[TH Domain]- [L4] -[ASt Domain2], wherein: independently, [L1] and [VL Domain], are optional; one of [L1], [ASt Domain1], [L2]-[DH Domain], [L3], [ACH Domain], [VL Domain], [TH Domain], [L4], and [ASt Domain2] comprises a nucleotide having a non-naturally occurring modification, and the non-naturally occurring modification is present on a nucleotide (e.g., a modified nucleotide) at a position corresponding to a modified position in a row of any of Table 15-22, e.g., described herein. This disclosure teaches at least some embodiments of the component (i) Formula A in the TREM claimed by the instant claim 1. App’819 does not teach the component (ii) an ASGPR binding moiety, wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or at one or both termini of the TREM, or within the internucleotide linkage of a TREM. However, the combined teachings, strategies, and motivations of Gullerova (12/02/2020), Váradi (2011), and Debacker (2020; see full citation in §103 rejection above) for modifying the known tRNA effector base sequences encompassed by the claimed Formula A in the instant claim 1 with the conjugation of an ASGPR binding moiety have been discussed above in the Double Patenting rejection based on U.S. Patent No. 12121531. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the teachings, strategies, and motivations from App’819, Gullerova, Váradi, and Debacker and have modified the TREM compounds taught by App’819 with the ASGPR binding moiety conjugation taught by Gullerova, motivated by the success of conjugating GalNAc to enhance liver targeting capability of RNA medicine and the potential benefits of subcutaneous administration described by Debacker, and would have tested therapeutic efficacy of PTC mutations in ABCC6 expressed in hepatocytes taught by Váradi to arrive at the claimed TREM compounds comprising a tRNA molecule according the Formula A and an ASGPR binding moiety in the instant claim 1. Claims 1-24 of App’819 correspond to the instant claims 1-3, 17, 23, 28, 31, 35-36, 43, 48, 50, 52-53. Claims 21-24 of App’819 correspond to the instant claims 60-62. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jun 23, 2023
Application Filed
May 13, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
50%
With Interview (+0.0%)
2y 4m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 4 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month