Prosecution Insights
Last updated: August 15, 2026
Application No. 18/269,787

NUCLEIC ACID, PHARMACEUTICAL COMPOSITION AND SIRNA CONJUGATE CONTAINING THE NUCLEIC ACID, PREPARATION METHOD THEREFOR, AND USE THEREOF

Non-Final OA §103§112§DP
Filed
Jun 27, 2023
Priority
Dec 29, 2020 — CN 202011599061.6 +1 more
Examiner
YU, DAVID TUYANG
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Suzhou Ribo Life Science Co. Ltd.
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
1y 9m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
1 granted / 1 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
4y 10m
Avg Prosecution
34 currently pending
Career history
29
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
29.9%
-10.1% vs TC avg
§102
24.4%
-15.6% vs TC avg
§112
25.2%
-14.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1 resolved cases

Office Action

§103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The action is written in response to the applicant’s correspondence received on 6/25/2026. Claims 1-21 and 24-26 are currently pending in the instant application. Priority The instant application claims foreign priority to CN202011599061.6 with an effective filing date of 12/29/2020. The Certified Copy of Foreign Priority was filed on 6/27/2023 and has been acknowledged. Election/Restriction Applicant’s election without traverse of the following species in the reply filed on 6/25/2026 is acknowledged. Applicant elects the following species: 1) siPKKAa1-M1SP1 as the siRNA recited in claim 16. 2) Formula (403) as recited in claim 21. Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i). Claims 1-21 and 24-26 are currently under examination on the merits. Specification The use of the term Goldenstar™ and NovoStart® (see page 59), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1 and 21 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, applicant recites wherein the nucleotide sequence I comprises “Z3 at a correspond site to Z1 and sequence 2 comprises a nucleotide Z4 at a corresponding site to Z2, and Z4 is the first nucleotide from the 5’ terminal of the antisense strand”. This claim is indefinite as the relevance of Z3 and Z4 is unclear. As the claim lacks any structural information regarding Z3 and Z4, one is unable to determine what limitations apply to “Z3” and “Z4” as recited in the instant claim. Regarding claim 21, applicant recites wherein the siRNA conjugate has a structure shown by Formula (403). Here it is unclear what Formula (403) refers to as it is not shown as a structure in the claim itself. Please see MPEP § 2173, wherein claims must particularly point out and distinctly claim the invention. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 4 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 4, applicant recites a broader limitation for Z3, wherein Z3 replaces Z1 in SEQ ID NO: 1 and Z3 can be any A, C, G, or U nucleotide wherein in claim 1, Z1, can only be the nucleotide U. Therefore, the dependent claim 4 recites a broader limitation of what the Z1 or Z3 nucleotide can be while the independent claim 1 has a narrower limitation. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Interpretation Though Formula (403) is not defined in the instant claims, examiner will refer to pg. 39 of the instant specification for the structure of Formula (403). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1 and 24-26 are rejected under 35 U.S.C. 103 as being unpatentable over Freier et al. (US 2017/0002359 A1, published 1/5/2017). Regarding claim 1, Freier teaches compounds, compositions, and methods for modulating expression of PKK mRNA and protein through antisense compounds (see paragraph 0004). Freier teaches where “antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotide, siRNAs, shRNAs, ssRNAs, etc. (see paragraph 0030). Freier further teaches SEQ ID NO: 136 which is a 20-mer DNA antisense oligo sequence with the sequence “ATTGGTTTTTGGAATTCAGT” (see Table 2, paragraph 0438) and where certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 19 or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 30-2226 (see paragraph 0132). Though Freier does not directly teach SEQ ID NOs: 1-4, the “base strand” “CUGAAUUCCAAAAACCAA” is consistent aside from a Z-X nucleotide. Frier teaches SEQ ID NO: 136 which is the antisense DNA strand that comprises a sequence with 100% identity to the “base strand” , however, Freier teaches where these sequences can be used in antisense compounds such as siRNA (see paragraph 0030). It would be obvious that if one took the DNA sequence presented in SEQ ID NO: 136 5’-ATTGGTTTTTGGAATTCAGT-3’ and generated the RNA sequences used in siRNAs by replacing the thymine with uracil, one would arrive at the sense strand SEQ ID NO: 1 or 5’-[A]CUGAAUUCCAAAAACCAA -(U)-3’ with an “U” nucleotide on the 3’ end of the sense strand corresponding with Z1. One would also arrive at SEQ ID NO: 2 or the antisense strand with the sequence 5’-(A)UUGGUUUUUGGAAUUCAG[U]with an additional A at the 5’ end corresponding with Z2. The limitations of SEQ ID NO: 4 are broader than that of 1, wherein Z3 can be any of A, U, G, or C and Z4 is complementary. Regarding claim 24, Freier teaches where administering the compound prevents, treats, or ameliorates a PKK associated disease, disorder or condition (see paragraph 0207). Regarding claim 25, Freier teaches compounds, compositions, and methods for reducing expression of human plasma prekallikrein (see paragraph 0002), wherein modulation can occur in a cell or tissue (see paragraph 0005). Regarding claim 26, though Freier doesn’t explicitly teach a kit, a kit is defined in the instant specification as an effective amount of at least one of the siRNA, the pharmaceutical composition, and the siRNA conjugate presented. As Freier teaches wherein antisense compounds of the present disclosure can relate to siRNAs (see paragraph 0030), where the embodiments can include a “pharmaceutically acceptable derivative” such as conjugates, and where the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions described herein (see paragraph 0350), the limitations of claim 26 are taught by Freier, that being the siRNA of claim 1 and a conjugate. It would have been obvious to one with ordinary skill of the art, to take the antisense DNA SEQ ID NO: 136 taught by Freier, and convert the antisense DNA to target RNA and arrive at SEQ ID NO: 1 and 2, to arrive at a method for inhibiting PKK expression. One would expect a reasonable chance of success as Freier discloses where antisense compounds can include siRNAs (0030) and where these compounds are used to target the same gene and disease recited in the instant application. One would be motivated to do so in order to generate an siRNA compound targeting PKK in order to treat diseases or pathological conditions caused by gene expression of plasma prekallikrein. In view of the foregoing, claims 1 and 24-26 are rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date. Claims 1-16 are rejected under 35 U.S.C. 103 as being unpatentable over Freier et al. (US 2017/0002359 A1, published 1/5/2017) in view of Fan et al. (Optimization of siRNA Design for the Activation of Gene Transcription by Targeting the TATA-Box Motif, PLOS One, Volume 9, Issue 9, published 9/24/2014), Manoharan et al. (Unique Gene-Silencing and Structural Properties of 2’-F-Modified siRNAs, Angew Chem Int Ed Engl., Volume 50, Issue 10, pgs. 2284-2288, published 3/1/2011), Martin et al. (US 20190241893 A1, published 8/8/2019), and Haraszti et al. (5’-Vinylphosphonate improves tissue accumulation and efficacy of conjugated siRNAs in vivo, Nucleic Acids Research, Volume 45, Issue 13, pgs. 7581-7592, published 6/7/2017). Regarding claim 1-4, Freier teaches compounds, compositions, and methods for modulating expression of PKK mRNA and protein through antisense compounds (see paragraph 0004). Freier teaches where “antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotide, siRNAs, shRNAs, ssRNAs, etc. (see paragraph 0030). Freier further teaches SEQ ID NO: 136 which is a 20-mer DNA antisense oligo sequence with the sequence “ATTGGTTTTTGGAATTCAGT” (see Table 2, paragraph 0438) and where certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 19 or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 30-2226 (see paragraph 0132). Though Freier does not directly teach SEQ ID NOs: 1-4, the “base strand” “CUGAAUUCCAAAAACCAA” is consistent aside from a Z-X nucleotide. Frier teaches SEQ ID NO: 136 which is the antisense DNA strand that comprises a sequence with 100% identity to the “base strand” , however, Freier teaches where these sequences can be used in antisense compounds such as siRNA (see paragraph 0030). It would be obvious that if one took the DNA sequence presented in SEQ ID NO: 136 5’-ATTGGTTTTTGGAATTCAGT-3’ and generated the RNA sequences used in siRNAs by replacing the thymine with uracil, one would arrive at the sense strand SEQ ID NO: 1 or 5’-[A]CUGAAUUCCAAAAACCAA -(U)-3’ with an “U” nucleotide on the 3’ end of the sense strand corresponding with Z1. One would also arrive at SEQ ID NO: 2 or the antisense strand with the sequence 5’-(A)UUGGUUUUUGGAAUUCAG[U]with an additional A at the 5’ end corresponding with Z2. The limitations of SEQ ID NO: 4 are broader than that of 1, wherein Z3 can be any of A, U, G, or C and Z4 is complementary. Regarding claim 2, Freier teaches where SEQ ID NO: 136 is a 20-mer, compared to the 19-mer of SEQ ID NO: 1 and 2 recited in the instant application. Therefore, Frier teaches where the siRNA has no more than a one nucleotide difference from that of Sequence I and II. Regarding claim 3, Freier taught where certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8…..at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 30-2226 (see paragraph 0132). Therefore siRNA compounds generated from SEQ ID NO: 136 would have a Sequence I and II that is basically/substantially reverse complement as defined in the claim. Regarding claim 5, Freier teaches SEQ ID NO: 136 which is a 20-mer compared to a 19-mer presented in Sequence I and II of the instant application. As the instant claim 5 recites wherein the sense strand further comprises a nucleotide sequence, that can independently have a length of 1-4 nucleotides, linked to the 5’ terminal of the nucleotide sequence I, through the teachings of antisense compounds such as siRNA disclosed in Freier and SEQ ID NO: 136, one would arrive at sequence I presented in claim with an additional U on the 5’ end for sequence I or an additional G at the 3’ end of sequence II, marking a single extension of 1 nucleotide. Regarding claim 6, it would be obvious that if one took the DNA sequence presented in SEQ ID NO: 136 5’-ATTGGTTTTTGGAATTCAGT-3’ and generated the RNA sequences used in siRNAs, one would arrive at the antisense SEQ ID NO: 1 or 5’-[A]CUGAAUUCCAAAAACCAA -(U)-3’ with an “[A]” nucleotide additionally added to the sense strand corresponding with sequence III. Regarding claim 9, Freier teaches where the antisense compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides (see claim 61 and paragraph 0132). Regarding claim 10, Freier teaches where the compound comprises at least one …3’-fluoro-HNA nucleoside (see paragraph 0167). In conjunction with the teachings of Freier wherein a modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase (see paragraph 0073), wherein an oligonucleotide means a polymer of linked nucleosides each which can be modified or unmodified, independent one from another (see paragraph 0091), and where an antisense compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides (see claim 61 and paragraph 0132), it is evident that the prophetic siRNA taught by Freier could have where each nucleoside in the sense and antisense strand is independently modified, either with a fluoro or non-fluoro group. Regarding claim 12, Freier teaches where modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases (see paragraph 0249). Freier teaches where antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified to impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to antisense compounds (see paragraph 0254). Such modifications include addition of substituent groups (including 5’ and 2’ substituent groups) and where examples of nucleosides having modified sugar moieties include without limitation…2’-OCH3, 2’-OCH2Ch3, etc. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, etc. (see paragraph 0255). Regarding claim 13, Freier teaches as used herein, “MOE” or “2’-MOE” or “2’-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2’ position of the sugar ring (see paragraph 0321). Regarding claim 14, Freier teaches “phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom (see paragraph 0098). Freier teaches where in certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate linkage (see paragraph 0161). Regarding claim 16, Freier teaches wherein a modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase (see paragraph 0073), wherein an oligonucleotide means a polymer of linked nucleosides each which can be modified or unmodified, independent one from another (see paragraph 0091), and where an antisense compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides (see claim 61 and paragraph 0132). Freier teaches where the compound comprises at least one …3’-fluoro-HNA nucleoside (see paragraph 0167). Regarding claim 7 and 8, Freier does not teach where the siRNA according to claim 1 possess a 3’ overhang on the antisense strand, wherein the resulting strand would be SEQ ID NO: 6, showing an additional (UA) on the 3’ end of the antisense sequence, as recited in claim 8. Regarding claim 11, Freier does not teach where the fluoro modified nucleotides are at the nucleotide positions of 7, 8, and 9 of the nucleotide sequence I (sense strand) and at nucleotide positions 2, 6, 14, and 16 of nucleotide sequence II (antisense strand). Regarding claim 15, Freier does not teach where the nucleotide at the 5’ terminal of the antisense strand is a 5’-phosphate nucleotide or a 5’-phosphate analogue modified nucleotide. Regarding claim 16, Freier does not teach where the siRNA issiPKKa1-M1SP1 which according to Table 1 of the instant specification, is SEQ ID NO: 3 and SEQ ID NO: 6 with a phosphate group on the 5’ terminal of the antisense strand and every strand modified, wherein fluoro modifications are found in positions 7, 8, and 9 of SEQ ID NO: 3 and 2, 6, 14, and 16 of SEQ ID NO: 6. Regarding claim 7, Fan teaches optimization of SiRNA design, wherein Fan discloses four characteristics contributed to high efficiency of TATA-box-targeting siRNAs on gene promoter activation: UA at the 3’ end of the antisense strand (see section titled “Optimized siRNAs exhibit improved potency and long-time effect on enhancing IL-2 expression in human and mouse primary CD4+ T cells). Regarding claim 11, Manoharan teaches Table 1 where siRNA B has 2’-F modifications at position 7-9 on the sense strand. Though Manoharan does not teach positions 2, 6, 14, and 16 of the antisense strand are modified by 2’-F, later art by the same author/group, titled Martin et al. teaches Fig. 10 where four 2’-F modifications at positions 7 and 9-11 of the sense strand and four 2’-F modifications at positions 2, 6, 14, and 16 of the antisense strand are present (see paragraph 0669 of Martin et al.) Regarding claim 15, Haraszti teaches where a 5’-phosphate group, or 5’-phosphate analogue such as 5’-Vinylphosphonate (i) increases siRNA accumulation in tissues, (ii) extends duration of silencing in multiple organs, and (iii) protects siRNAs from 5’-to-3’ exonucleases. Furthermore, Haraszti teaches 5’-phosphate is required for loading into RNA-induced silencing complex, the synthetic addition of a 5’-phosphate on a fully modified siRNA guide (antisense) strand is expected to be beneficial (see abstract). Regarding claim 16, the combined arts described above would teach how siRNA design and optimization would result in siPKKa1-M1SP1. It would have been obvious to one with ordinary skill in the art, before the effective filing date, to combine the teachings of Freier, Fan, Manoharan, Martin, and Haraszti to arrive at the claimed invention presented in claims 1-16, which is an optimized siRNA targeting PKK. One would expect a reasonable chance of success as Freier teaches antisense oligonucleotides which can be used as antisense compounds, including siRNA, to target PKK. This is evidenced by SEQ ID NO: 136 of Freier wherein conversion of the antisense DNA oligonucleotide to RNA would result in the sequence presented in SEQ ID NO: 1 and 2. One would be motivated to combine these arts as Fan, Manoharan, Martin, and Haraszti all teach known techniques to optimize siRNA for delivery into cells or tissues. This is evidenced in the teachings of Fan, wherein the addition of an overhang comprising UA at the 3’ end of the antisense RNA results in improved efficiency of siRNAs in the targeting of a promoter region, such as the TATA-box, wherein siRNAs can inhibit gene expression through targeting the promoters of genes (see abstract of Fan). The combined teachings of Manoharan and Martin teach where 2’-F modification has little or no negative impact on the activity of siRNAs, regardless on the number of modifications or the positions within the strand and where the 2’-F-modified siRNA was thermodynamically more stable and more nuclease-resistant than the parent siRNA, and produced no immunostimulatory response (see graphical abstract of Manoharan) and where there are examples of specific modifications of the sense strand having 2’-F modifications at positions 7-9 from the 5’ end (Table 1 of Manoharan) and where there are 2’-F modifications at positions 2, 4, 14, and 16 of the antisense strand (see paragraph 0669 of Martin). Finally, Haraszti teaches where an UA overhang, specifically an additional UA on the end of the 3’ end of the antisense or guide strand, results in increased siRNA accumulation in tissues, (ii) extends duration of silencing in multiple organs, and (iii) protects siRNAs from 5’-to-3’ exonucleases (see abstract). Therefore, the combination of these arts as a whole, pertains to the very well-known process of siRNA optimization, and would have been obvious to one with skill in the art to take the siRNA presented in Freier and optimize that antisense compound for the targeting of the PKK gene, wherein such optimization would result in siPKKa1-M1SP1 as presented in the instant application. In view of the foregoing, claims 1-16 are rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date. Claims 17-21 are rejected under 35 U.S.C. 103 as being unpatentable over Freier et al. (US 2017/0002359 A1, published 1/5/2017) in view of Fan et al. (Optimization of siRNA Design for the Activation of Gene Transcription by Targeting the TATA-Box Motif, PLOS One, Volume 9, Issue 9, published 9/24/2014), Manoharan et al. (Unique Gene-Silencing and Structural Properties of 2’-F-Modified siRNAs, Angew Chem Int Ed Engl., Volume 50, Issue 10, pgs. 2284-2288, published 3/1/2011), Martin et al. (US 20190241893 A1, published 8/8/2019), and Haraszti et al. (5’-Vinylphosphonate improves tissue accumulation and efficacy of conjugated siRNAs in vivo, Nucleic Acids Research, Volume 45, Issue 13, pgs. 7581-7592, published 6/7/2017) in further view of Zhang et al. (WO 2019128611 A1, published 4/7/2019) and Yu et al. (Lipid Nanoparticles for Hepatic Delivery of Small Interfering RNA, Biomaterials, Volume 33, Issue 25, pgs. 5924-5934, published 9/1/2013). Though Zhang et al. shares a common inventor and applicant, Suzhou Ribo Life Science, the WO 2019128611 A1 document has a 4/7/2019 publication date which exceeds the one-year grace period of the claimed priority date of 12/29/2020 of the instant application. Regarding the siRNA composition of claim 1, the teachings of Freier alone would arrive at the composition described in claim 1, as described above. The inclusion of the teaching of Fan, Manoharan, Martin, and Haraszti teach optimized embodiments of the siRNA of claim 1, also described above. Regarding claim 17, Freier teaches where certain embodiments provide compositions comprising the compound of any preceding claim (such as antisense compounds including siRNA) or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent (see paragraph 0204). Regarding claim 19, Freier teaches where “pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs, or isomers of the compounds described herein (see paragraph 0096). Regarding claims 18, and 20-21, Freier teaches the siRNA of claim 1, as described above. Regarding claim 18, Freier does not teach where the weight ratio of the siRNA to a pharmaceutically acceptable carrier is 1:(1-500). Regarding claim 20, Freier does not teach where the conjugating group comprises a pharmaceutically acceptable targeting group and a linker, wherein the linker and the targeting group are covalently or non-covalently linked in sequence. Regarding claim 21, Freier does not teach where the siRNA conjugate of claim 19 has the structure shown by formula (403). Regarding claim 18, Yu teaches the delivery of siRNAs in vivo with lipid nanoparticles, wherein LNPs were found to have exceptionally high siRNA transfection efficacy (see abstract). For the preparation of LNP encapsulated siRNA, Yu discloses the weight ratio of lipids/siRNA was kept at 10/1 (see section 2.3). Regarding claim 19-20 , Zhang teaches compositions and methods for preparing siRNA conjugates (see abstract and paragraph 0050). Zhang further teaches where conjugating molecules disclosed herein are useful for tissue specific targeting (see paragraph 0067), and where siRNAs specifically targeting HBV gene (see paragraph 0090) can be used with N-acetylgalactosamine (GalNAc), which has been used as a targeting molecule to deliver siRNA drugs to the liver (see paragraph 0092). Furthermore, Zhang teaches examples of where a functional oligonucleotide such as siRNAs can be liked with ligands (conjugates) via linkers (see paragraph 0177) and where an “oligonucleotide conjugate” represents a compound formed by covalently attached oligonucleotide and one or more conjugating moieties each with specific functions (see paragraph 0173). PNG media_image1.png 300 705 media_image1.png Greyscale Regarding claim 21, Zhang teaches formula 3 (see paragraph 0174) and shown below, which has 100% identity to formula (403) recited in the instant application. It would have been obvious to one with ordinary skill in the art, before the effective filing date, to combine the teachings above to arrive at a pharmaceutical composition which comprises the siRNA of claim 1 and a pharmaceutically acceptable carrier. Looking to the instant specification for guidance, the applicant defines a pharmaceutically acceptable carrier as a carrier that may be conventionally used in the field of siRNA administration, which includes lipid nanoparticles. One would expect a reasonable chance of success as the use of siRNA in conjunction with lipid nanoparticles is widely accepted as a method to enhance siRNA delivery and efficacy, as evidenced by Yu et al. and Zhang et al., as described above. One would be motivated to do so as it is known to one with ordinary skill in the art that free siRNA molecules suffer from unfavorable physicochemical characteristics and rapid clearance mechanisms, hampering the ability of siRNAs to reach the cytoplasm of target cells when administered intravenously. A pharmaceutically acceptable carrier, such as a lipid nanoparticle, aids in protecting the siRNA, boosting efficacy for in vivo delivery, as it is evidenced by the abstract of Evers et al. (State-of-the-Art Design and Rapid-Mixing Production Techniques of Lipid Nanoparticles for Nucleic Acid Delivery, small methods, Volume 2, Issue 9, all pages, published 9/11/2018). Though Yu discloses the carrier or lipid weight ratio to siRNA as 10:1 (see section 2.3), one would further optimize this ratio through routine experimentation to arrive at the most optimal ratio per use case. Finally, as Zhang teaches the siRNA conjugate claimed, one would be motivated to combine the siRNA composition taught by Freier, with the siRNA conjugate of Zhang, in order to effectively deliver the siRNA to a subject, in vivo. In view of the foregoing, claims 17-21 are rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-15, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-2, 13, 17, 21, 25, 28, 32-33, 35, 39, 43, 46, 49, 50, 55, 56, and 59-60 of copending Application No. 18/576,589. Although the claims at issue are not identical, they are not patentably distinct from each other because the copending application recites a double-stranded oligonucleotide with identical sequence structure and modifications present in the instant application. Furthermore, the copending application discloses in claim 28 wherein the double-stranded oligonucleotide is siRNA and where the method is for the treatment or prevention of diseases associated with a target gene, wherein the target gene is PKK (see claim 56). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DAVID YU whose telephone number is (571)272-1118. The examiner can normally be reached Monday-Friday 7:30 am -5 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /D.T.Y./Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jun 27, 2023
Application Filed
Jul 30, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
4y 10m (~1y 9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month