DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of the species antagomir and miR124 inhibitor in the reply filed on 3/20/26 is acknowledged.
Drawings
The drawings filed on 7/18/23 and 5/10/26 are objected to because they are not fully legible (Figures 1-3, 13, 14, and 16). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 30, 32, and 33 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 30, 32, and 33 recites the limitation "the mir145 inhibitor of claim 18". There is insufficient antecedent basis for this limitation in the claim because claim 18 does not recite “mir145 inhibitor”.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 25 and 26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are directed to delivery of a composition comprising any “miR124 inhibitor” (claim 25), “miR203a inhibitor”, “miR181 inhibitor”, “miR128 inhibitor”, “miR106b inhibitor”, or any “miR34a inhibitor”.
The specification does not adequately describe the structure required for the agent to function as an inhibitor of one of the miRNAs.
The specification discloses a single species of hsa-miR-145-5p inhibitors, SEQ ID NO: 4; and two species of miR-124-3p inhibitors (hsa and mo) (SEQ ID NOs: 5 and 6). The species are not representative of the entire claimed genus, which encompasses agents of any structure that act via any pathway and act on any target that has the secondary effect of inhibiting one of the miRNAs, a genus of agents that has not been adequately described in the specification. The specification does not even disclose a single inhibitor for miR203a, miR181, miR128, miR106b, or miR34a.
Additionally, the specification does not adequately describe the genus of miRNAs included in each of the categories of miR124, miR203a, miR181, miR128, miR106b, and miR34a.
For example, the specification discloses a single inhibitor of hsa-miR-145-5p, which is a single species of miR145. The specification does not adequately describe which other miRNAs are miR145 miRNAs and the structure required for an agent to inhibit each of these members.
The specification discloses a single inhibitor of hsa-miR-124-3p and a single inhibitor of mo-miR-124-3p, which is a single species of human miR124 and a single species of rat miR124. The specification does not adequately describe which other miRNAs are miR124 miRNAs and the structure required for an agent to inhibit each of these members.
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being miRNAs of each of the recited families, as well as inhibitors of each of the species that have the structure to achieve the required function.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
To achieve the desired function, it appears that the structure is required to be a complement of a specific miRNA sequence and that if mismatches are present, they must be at specific positions for any given miRNA. For example, Krutzfeldt et al. (Nucleic Acids Research, 2007, Vol. 35, No. 9, 2885–2892) teach that miRNA antagomirs harbor optimized phosphorothioate modifications, require >19-nt length for highest efficiency and can discriminate between single nucleotide mismatches of the targeted miRNA (abstract).
Krutzfeldt et al. teach: Four mismatches, two mismatches or a single mismatch at position 19 was sufficient to prevent down regulation of miR-122 and upregulation of three different miR-122 targets (AldoA, Tmed3 and Hfe2) as measured by RT-PCR (Figure 4A). However, single nucleotide mismatches at two different positions (nt1 or nt11) did not prevent downregulation of miR-122 levels or target regulation (Figure 4B). These data demonstrate that antagomirs can exhibit high sequence specificity. However, discrimination at the single nucleotide level is position-dependent and has to be tested for each microRNA sequence that is being targeted (page 2888).
Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for miRNAs and inhibitory agents within the instantly recited genus. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed.
Response to Arguments
Applicant’s arguments are specific to miR145, which is no longer subject to the rejection due to amendment of claim 18 to a specific anti-miR145 (SEQ ID NO: 4).
Claims 18, 25-27, and 29-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of treating myocardial infarction via direct delivery to the myocardium of instant SEQ ID NO: 4, does not reasonably provide enablement for a method of treating myocardial infarction via any mode of delivery of instant SEQ ID NO: 4 (and the inhibitors of claims 25 and 26). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
The claims are directed to a method of treating myocardial infarction via any mode of delivery of anti-miR145 and any inhibitor of miR124 and any inhibitor of miR203a, 181, 128, 106b, or miR34a.
The specification demonstrates direct injection of a specific miR-145-5p miRNA antagomir (SEQ ID NO: 4) into the myocardium with a resultant significant increases in left ventricular ejection fraction and fractional shortening and improvement in cardiac function (page 21), which is not commensurate in scope with broad systemic delivery of SEQ ID NO: 4 and any inhibitor of miR124 and any inhibitor of miR203a, 181, 128, 106b, or miR34a and each of the instantly recited outcomes in a predictable manner.
Yan et al. (INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, 42: 1537-1547, 2018) teach: The present study investigated the effects of micro (mi)RNA-145 on acute myocardial infarction (AMI) and the potential underlying mechanism. A total of 6 AMI and 6 normal rat tissues were investigated for the present study. It was demonstrated that miRNA-145 expression was downregulated in the AMI rat model, compared with the control group. Downregulation of miRNA-145 increased cardiac cell apoptosis, suppressed phosphorylated (p)-RAc-γ serine/threonine-protein kinase (Akt3) and p-mechanistic target of rapamycin (mTOR) protein expression levels and suppressed autophagy in an in vitro model of AMI (Abstract).
Higashi et al. (Am J Physiol Heart Circ Physiol 309: H1813–H1826, 2015) teach: MicroRNA-145 repairs infarcted myocardium by accelerating cardiomyocyte autophagy (title). Higashi et al. teach: We investigated whether microRNA-145 (miR-145) has a cardioprotective effect in a rabbit model of myocardial infarction (MI) and in H9c2 rat cardiomyoblasts. Rabbits underwent 30 min of coronary occlusion, followed by 2 days or 2 wk of reperfusion. Control microRNA(control group; 2.5 nmol/kg, n=10) or miR-145 (miR-145 group, 2.5nmol/kg, n=10) encapsulated in liposomes was intravenously administered immediately after the start of reperfusion. H9c2 rat cardiomyoblasts were transfected with miR-145. The MI size was significantly smaller in the miR-145 group than in the control group at 2 days and 2 wk post-MI. miR-145 had improved the cardiac function and remodeling at 2 wk post-MI (page H1813).
Krutzfeldt et al. (Nucleic Acids Research, 2007, Vol. 35, No. 9, 2885–2892) teach that miRNA antagomirs harbor optimized phosphorothioate modifications, require >19-nt length for highest efficiency and can discriminate between single nucleotide mismatches of the targeted miRNA (abstract).
Krutzfeldt et al. teach: Degradation of different chemically protected miRNA/antagomir duplexes in mouse livers and localization of antagomirs in a cytosolic compartment that is distinct from processing (P)-bodies indicates a degradation mechanism independent of the RNA interference (RNAi) pathway (abstract).
Krutzfeldt et al. teach: Finally, we show that antagomirs, although incapable of silencing miRNAs in the central nervous system (CNS) when injected systemically, efficiently target miRNAs when injected locally into the mouse cortex (abstract).
Therefore, it was known in the art that miRNA inhibitors must have specific structural requirements for activity and resistance to degradation, and that broad systemic delivery is not broadly enabled.
The specification does not draw an adequate nexus between delivery of delivery of anti-miR145 SEQ ID NO: 4 and any inhibitor of miR124 and any inhibitor of miR203a, 181, 128, 106b, or miR34a via any mode of delivery with the predictable outcome of treating myocardial infarction and each of the instantly recited outcomes.
Additionally, there is no guidance in the specification as filed that teaches how to systemically deliver the instantly recited genus of naked inhibitors, each possible type of inhibitor having different delivery challenges, and predictably treat myocardial infarction in vivo.
Fujita et al. (Int. J. Mol. Sci. 2015, 16, 5254-5270) teach that two types of small RNA molecules, small interfering RNAs (siRNAs) and microRNAs (miRNAs), have a central function in RNAi technology. The success of RNAi-based therapeutic delivery may be dependent upon uncovering a delivery route, sophisticated delivery carriers, and nucleic acid modifications (page 5254). Fujita et al. teach that the success of an RNAi-based therapy in clinical trials rests on careful selection of target genes and miRNAs. Moreover, we suggest that a delivery route, sophisticated delivery carriers, chemical modification, and modified RNAi platforms are needed to enhance RNAi effects in cancer cells (pages 5262-5263).
As outlined above, it is well known that there is a high level of unpredictability in the miRNA antagomir art (a single species of the instant inhibitors of claims 25 and 26) for therapeutic in vivo applications and design. The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of treating myocardial infarction via broad systemic delivery of a broad genus of agents that act via different mechanisms and have different levels of activity and are specific to different possible target sequences encompassing in vivo effects.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of anti-miR145 SEQ ID NO: 4 and any inhibitor of miR124 and any inhibitor of miR203a, 181, 128, 106b, or miR34a of the instant genus in vivo by the broadly disclosed methodologies of the instantly claimed invention, would result in successful treatment of myocardial infarction and each of the instantly recited outcomes. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Response to Arguments
Applicant argues that the present amendment directly addresses the Examiner's concern regarding the claimed inhibitor by limiting the claims to the specific anti- miR145 of SEQ ID NO:4 expressly disclosed and exemplified in the specification.
However, instant claims 25 and 26 collectively are directed to delivery of any inhibitor of miR124 and any inhibitor of miR203a, 181, 128, 106b, or miR34a.
Applicant argues that with respect to the mode of delivery, Applicant respectfully submits that the present specification is not limited to direct myocardial injection. Rather, the specification expressly describes that the pharmaceutical composition may be formulated for various routes of administration, including parenteral administration such as intravenous, subcutaneous, intraperitoneal, and topical administration, as well as oral administration. Accordingly, the specification provides adequate guidance regarding suitable modes of delivery for the claimed anti-miR145 of SEQ ID NO:4.
Contrary to applicant’s argument, the examiner did not assert that the specification does not disclose support for other modes of administration, but rather that the specification is not enabling for broad systemic naked delivery of the instant genus of agents and the predictable outcomes as recited. This rejection is not a new matter rejection. It is agreed that the specification discloses, but does not enable the modes of delivery.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 18, 25-27, and 29-36 is/are rejected under 35 U.S.C. 103 as being unpatentable over Huangfu et al. (European Review for Medical and Pharmacological Sciences, 2020, 24, 12904-12911), in view of Wang et al. (Journal of Molecular and Cellular Cardiology 66 (2014) 94–105), Liu et al. (European Review for Medical and Pharmacological Sciences, 2019, 23, 7049-7058), and Chen et al. (Med Sci Monit, 2018; 24: 4121-4127).
Huangfu et al. teach that the expression level of miR-145-5p was substantially elevated in myocardial infarction tissues. Huangfu et al. teach that the apoptosis of myocardial cells transfected with miR-145-5p mimic is notable higher than that of myocardial cells transfected with miR-145-5p control in an acute MI model (page 1).
Huangfu et al. teaches that miR-145-5p is increased after MI and promotes cardiomyocyte apoptosis and that apoptosis contributes to myocardial injury. Therefore, it would have been obvious to inhibit miR-145-5p with the motivation and expectation of reducing apoptosis and therefore treating MI.
In view of Huangfu et al., it would have been obvious to inhibit miR-145-5p with an expectation of to treat acute myocardial infarction (instant claim 18).
It would have been obvious for the inhibitor to by miR-145-5p antagomir AGGGAUUCCUGGGAAAACUGGAC (instant SEQ ID NO: 4) because Wang et al. teach that this sequence is a miR-145-5p inhibitor that successfully inhibited miR-145-5p (page 95) (instant claim 18).
Huangfu et al. does not teach administration within one week of the onset of MI. However, it would have been obvious to deliver the miR-145-5p antagomir of SEQ ID NO: 4 within one week of onset of MI because Wang et al. teach that in vivo delivery of a miR-145 antagomir 1 day prior to and 2 and 6 days after MI decreased myofibroblast formation and increased scar size. The antagomir also reversed the suppressed expression of KLF5 protein in the scar region at day 7 after MI. Wang et al. teach that they describe a novel association between miR 145 and fibroblast differentiation toward myofibroblasts and that these observations provide a new approach to promote endogenous scar healing and contracture by stimulating the transdifferentiation of cardiac fibroblasts to myofibroblasts (abstract).
The miR-145 antagomir of Wang et al. is fully 2’-O-methyl modified and has a phosphorothioate bond and a 3’ cholesterol (AGGGAUUCCUGGGAAAACUGGAC) (page 95).
Given the successful in vivo delivery of the miR-145-5p antagomir of Wang et al., one would reasonably expect that the inhibition would reduce the detrimental miR-145 activity taught by Huangfu et al.
One would have been motivated to deliver the miR-145-5p antagomir 2 and 6 days after MI with the expectation of decreased myofibroblast formation as taught by Wang et al. (instant claim 18).
One of ordinary skill in the art would have been motivated by Huangfu et al. to inhibit miR-145 to reduce harmful cardiomyocyte apoptosis, and Wang et al. demonstrates that an antagomir to miR-145 administered during the acute post-MI period via tail vein injection actually suppresses myofibroblast formation. Huangfu et al. offers a distinct therapeutic purpose of inhibiting miR-145 and the first seven days after MI had already been established as a critical window.
Since Wang et al. teach that miR-145 expression in the ischemic heart was significantly downregulated, more than 3-fold, in the scar region at 3 days and then increased at 7 days, and that miR-145 may play an active role in post infarction remodeling, the first week of the onset of MI is an obvious timeframe to administer the inhibitor.
Huangfu et al. teach that in AMI, persistent inflammatory responses and necrosis are the two most evident features in ischemic tissues. They may be mutually enhanced in MI-induced heart damage, ultimately resulting in heart failure (page 12908). Therefore, it would have been obvious to deliver the composition in the presence of acute inflammation (instant claims 27 and 29).
It would have been obvious to include an inhibitor of miR-124 because Liu et al. teach that miR-124 promotes ischemia-reperfusion induced cardiomyocyte apoptosis by targeting sphingosine kinase 1 (title). Liu et al. teaches: For what it concerns AMI, a significantly elevated level of miR-124 in peripheral blood has been recorded in patients with AMI. In the animal model of MI, miR-124 has also been found to be overexpressed in ischemic cardiac tissue (page 7050). Therefore, miR-124 would have been an obvious target for treatment of AMI. It would have been obvious to combine the inhibitor of miR-124 with the inhibitor of miR-145-5p because both have the same intended use of treating AMI (instant claim 25).
It would have also been obvious to include an inhibitor of miR181 because Chen et al. teach that miR-181a is upregulated in myocardial infarction (page 4121). Chen et al. teach: An MMT assay showed that over-expression of miR-181a accelerated the proliferation of myocardial fibroblasts, and that upregulation of miR-181a promoted the expression of mRNA and the production of the related protein of these indices of fibrosis. These findings were reversed by using knockdown of miR-181a (page 4127). Chen et al. teach that circulating miR-181a is a biomarker of AMI (page 4127). Therefore, miR-181 would have been an obvious target for treatment of acute myocardial infarction. It would have been obvious to combine the inhibitor of miR-181 with the inhibitor of miR-145-5p because both have the same intended use of treating AMI (instant claim 26).
With regards to instant claims 30, 32, and 33, the claims recite the same method step as the method of treating myocardial infarction and therefore would necessarily flow from the method of delivering the miR145 inhibitor.
With regards to claims 31 and 34-36, the claims recite outcomes rather than method steps. The outcomes would necessarily flow from the method of delivering the miR145 inhibitor.
Response to Arguments
Applicant argues that Huangfu neither teaches nor suggests that administration of an anti- miR145 exhibits a therapeutic window-specific effect, much less that effective treatment is limited to administration within a particular period after the onset of myocardial infarction.
This newly added limitation is addressed in the amended rejection, above.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
