DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of the species antagomir and miR124 inhibitor in the reply filed on 3/20/26 is acknowledged.
Claim 22 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 3/20/26.
Drawings
The drawings filed on 7/18/23 are objected to because they are not fully legible (Figures 1-3, 13, 14, and 16). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Improper Markush Rejection
Claim 23 is rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claim is directed to a multitude of inhibitory compounds that have different structures and act via different mechanisms. One cannot be substituted for another with expectation of identical activity. It is noted that withdrawn claim 23 recites additional inhibitors that would be included in this rejection.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
In order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific type of inhibitor is dependent upon the specific structure. There is no expectation that any one of the inhibitors as claimed can be substituted for any of the other with a completely different structure that acts via a different mechanism with the expectation of the same activity.
As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).”
In the instant case, art against any one inhibitor would not be evidence against any of the remaining members that have different structures and do not have identical activity.
Claim Objections
Claim 26 is objected to because of the following informalities: Claim 26 recites miR128 inhibitor twice. Appropriate correction is required.
Claim 28 is objected to under 37 CFR 1.75 as being a substantial duplicate of claim 19. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 18, 19, 21, and 23-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are directed to delivery of a composition comprising any “miR145 inhibitor”, as well as any “miR124 inhibitor” (claim 25), any “miR203a inhibitor”, any “miR181 inhibitor”, any “miR128 inhibitor”, any “miR106b inhibitor”, or any “miR34a inhibitor”.
The specification does not adequately describe the structure required for the agent to function as an inhibitor of one of the miRNAs.
The specification discloses a single species of hsa-miR-145-5p inhibitors, SEQ ID NO: 4; and two species of miR-124-3p inhibitors (hsa and mo) (SEQ ID NOs: 5 and 6). The species are not representative of the entire claimed genus, which encompasses agents of any structure that act via any pathway and act on any target that has the secondary effect of inhibiting one of the miRNAs, a genus of agents that has not been adequately described in the specification. The specification does not disclose a single inhibitor for miR203a, miR181, miR128, miR106b, or miR34a.
Additionally, the specification does not adequately describe the genus of miRNAs included in each of the categories of miR145, miR124, miR203a, miR181, miR128, miR106b, and miR34a.
For example, the specification discloses a single inhibitor of hsa-miR-145-5p, which is a single species of miR145. The specification does not adequately describe which other miRNAs are miR145 miRNAs and the structure required for an agent to inhibit each of these members.
The claims encompass a method of introducing any type of miR145 family inhibitor to inhibit the expression of any miR145 sequence, as well as encompass any miR145 homolog or allele from any species known or yet to be discovered of miR145, as well spliced variants or fragment that retains miR145-like activity. The same is true for each of the recited miRNAs.
The specification discloses a single inhibitor of hsa-miR-124-3p and a single inhibitor of mo-miR-124-3p, which is a single species of human miR124 and a single species of rat miR124. The specification does not adequately describe which other miRNAs are miR124 miRNAs and the structure required for an agent to inhibit each of these members.
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being miRNAs of each of the recited families, as well as inhibitors of each of the species that have the required function.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
To achieve the desired function, it appears that the structure is required to be a complement of a specific miRNA sequence and that if mismatches are present, they must be at specific positions for any given miRNA. For example, Krutzfeldt et al. (Nucleic Acids Research, 2007, Vol. 35, No. 9, 2885–2892) teach that miRNA antagomirs harbor optimized phosphorothioate modifications, require >19-nt length for highest efficiency and can discriminate between single nucleotide mismatches of the targeted miRNA (abstract).
Krutzfeldt et al. teach: Four mismatches, two mismatches or a single mismatch at position 19 was sufficient to prevent down regulation of miR-122 and upregulation of three different miR-122 targets (AldoA, Tmed3 and Hfe2) as measured by RT-PCR (Figure 4A). However, single nucleotide mismatches at two different positions (nt1 or nt11) did not prevent downregulation of miR-122 levels or target regulation (Figure 4B). These data demonstrate that antagomirs can exhibit high sequence specificity. However, discrimination at the single nucleotide level is position-dependent and has to be tested for each microRNA sequence that is being targeted (page 2888).
Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for miRNAs and inhibitory agents within the instant enormous genus. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed.
Claims 18, 19, 21, and 23-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of treating myocardial infarction via direct delivery to the myocardium of instant SEQ ID NO: 4, does not reasonably provide enablement for a method of treating myocardial infarction via any mode of delivery of any inhibitor of any miR145. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
The claims are directed to a method of treating myocardial infarction via any mode of delivery of any inhibitor of any miR145.
The specification demonstrates direct injection of a specific miR-145-5p miRNA antagomir into the myocardium with a resultant significant increases in left ventricular ejection fraction and fractional shortening and improvement in cardiac function (page 21), which is not commensurate in scope with broad systemic delivery of any inhibitor of any miR145 (not necessarily miR-145-5p) and the predictable outcome of treatment of myocardial infarction. The same is true for the miRNA inhibitors of claims 25 and 26.
Yan et al. (INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, 42: 1537-1547, 2018) teach: The present study investigated the effects of micro (mi)RNA-145 on acute myocardial infarction (AMI) and the potential underlying mechanism. A total of 6 AMI and 6 normal rat tissues were investigated for the present study. It was demonstrated that miRNA-145 expression was downregulated in the AMI rat model, compared with the control group. downregulation of miRNA-145 increased cardiac cell apoptosis, suppressed phosphorylated (p)-RAc-γ serine/threonine-protein kinase (Akt3) and p-mechanistic target of rapamycin (mTOR) protein expression levels and suppressed autophagy in an in vitro model of AMI (Abstract).
Higashi et al. (Am J Physiol Heart Circ Physiol 309: H1813–H1826, 2015) teach: MicroRNA-145 repairs infarcted myocardium by accelerating cardiomyocyte autophagy (title). Higashi et al. teach: We investigated whether microRNA-145 (miR-145) has a cardioprotective effect in a rabbit model of myocardial infarction (MI) and in H9c2 rat cardiomyoblasts. Rabbits underwent 30 min of coronary occlusion, followed by 2 days or 2 wk of reperfusion. Control microRNA(control group; 2.5 nmol/kg, n=10) or miR-145 (miR-145 group, 2.5nmol/kg, n=10) encapsulated in liposomes was intravenously administered immediately after the start of reperfusion. H9c2 rat cardiomyoblasts were transfected with miR-145. The MI size was significantly smaller in the miR-145 group than in the control group at 2 days and 2 wk post-MI. miR-145 had improved the cardiac function and remodeling at 2 wk post-MI (page H1813).
In view of Yan et al. and Higashi et al., one would not predictably expect for inhibition of any miR-145 sequence to result in treatment of any myocardial infarction.
Huangfu et al. (European Review for Medical and Pharmacological Sciences, 2020, 24, 12904-12911) teach that overexpression of miR-145-3p protects against rat myocardial infarction by targeting PDCD4. However, miR-145-5p induces apoptosis after ischemia-reperfusion by targeting dual specificity phosphatase 6 (page 12908). Huangfu et al. is evidence that inhibition of different species of miR145 would have different effects.
Krutzfeldt et al. (Nucleic Acids Research, 2007, Vol. 35, No. 9, 2885–2892) teach that miRNA antagomirs harbor optimized phosphorothioate modifications, require >19-nt length for highest efficiency and can discriminate between single nucleotide mismatches of the targeted miRNA (abstract).
Krutzfeldt et al. teach: Degradation of different chemically protected miRNA/antagomir duplexes in mouse livers and localization of antagomirs in a cytosolic compartment that is distinct from processing (P)-bodies indicates a degradation mechanism independent of the RNA interference (RNAi) pathway (abstract).
Krutzfeldt et al. teach: Finally, we show that antagomirs, although incapable of silencing miRNAs in the central nervous system (CNS) when injected systemically, efficiently target miRNAs when injected locally into the mouse cortex (abstract).
Therefore, it was known in the art that miRNA inhibitors must have specific structural requirements for activity and resistance to degradation, and that broad systemic delivery is not broadly enabled.
The specification does not draw an adequate nexus between delivery of any possible inhibitor of any miR145 via any mode of delivery with the predictable outcome of treating myocardial infarction.
Additionally, there is no guidance in the specification as filed that teaches how to systemically deliver the instantly recited genus of inhibitors, each possible type of inhibitor having different delivery challenges, and predictably treat myocardial infarction in vivo.
Fujita et al. (Int. J. Mol. Sci. 2015, 16, 5254-5270) teach that two types of small RNA molecules, small interfering RNAs (siRNAs) and microRNAs (miRNAs), have a central function in RNAi technology. The success of RNAi-based therapeutic delivery may be dependent upon uncovering a delivery route, sophisticated delivery carriers, and nucleic acid modifications (page 5254). Fujita et al. teach that the success of an RNAi-based therapy in clinical trials rests on careful selection of target genes and miRNAs. Moreover, we suggest that a delivery route, sophisticated delivery carriers, chemical modification, and modified RNAi platforms are needed to enhance RNAi effects in cancer cells (pages 5262-5263).
As outlined above, it is well known that there is a high level of unpredictability in the miRNA antagomir art (a single species of the instant inhibitors) for therapeutic in vivo applications and design. The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of treating myocardial infarction via broad systemic delivery of a broad genus of agents that act via different mechanisms and have different levels of activity and are specific to different possible target sequences encompassing in vivo effects.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any miR145 inhibitor of the instant genus in vivo by the broadly disclosed methodologies of the instantly claimed invention, would result in successful treatment of myocardial infarction. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 18, 19, 21, and 23-36 is/are rejected under 35 U.S.C. 103 as being unpatentable over Huangfu et al. (European Review for Medical and Pharmacological Sciences, 2020, 24, 12904-12911), in view of Lv et al. (Life Sciences, 2019, 239, 117008, pages 1-8), Liu et al. (European Review for Medical and Pharmacological Sciences, 2019, 23, 7049-7058), and Chen et al. (Med Sci Monit, 2018; 24: 4121-4127).
Huangfu et al. teach that the expression level of miR-145-5p was substantially elevated in myocardial infarction tissues. Huangfu et al. teach that the apoptosis of myocardial cells transfected with miR-145-5p mimic is notable higher than that of myocardial cells transfected with miR-145-5p control in an acute MI model (page 1).
In view of Huangfu et al., it would have been obvious to inhibit miR-145-5p with an expectation of to treat acute myocardial infarction (instant claims 18, 19, 21, and 28).
It would have been obvious for the inhibitor to by miR-145-5p antagomir AGGGAUUCCUGGGAAAACUGGAC (instant SEQ ID NO: 4) because Lv et al. teach that this sequence is a miR-145-5p inhibitor that successfully inhibited miR-145-5p (page 2) (instant claims 23 and 24).
Huangfu et al. teach that in AMI, persistent inflammatory responses and necrosis are the two most evident features in ischemic tissues. They may be mutually enhanced in MI-induced heart damage, ultimately resulting in heart failure (page 12908). Therefore, it would have been obvious to deliver the composition in the presence of acute inflammation (instant claims 27 and 29).
It would have been obvious to include an inhibitor of miR-124 because Liu et al. teach that miR-124 promotes ischemia-reperfusion induced cardiomyocyte apoptosis by targeting sphingosine kinase 1 (title). Liu et al. teaches: For what it concerns AMI, a significantly elevated level of miR-124 in peripheral blood has been recorded in patients with AMI. In the animal model of MI, miR-124 has also been found to be overexpressed in ischemic cardiac tissue (page 7050). Therefore, miR-124 would have been an obvious target for treatment of AMI. It would have been obvious to combine the inhibitor of miR-124 with the inhibitor of miR-145-5p because both have the same intended use of treating AMI (instant claim 25).
It would have also been obvious to include an inhibitor of miR181 because Chen et al. teach that miR-181a is upregulated in myocardial infarction (page 4121). Chen et al. teach: An MMT assay showed that over-expression of miR-181a accelerated the proliferation of myocardial fibroblasts, and that upregulation of miR-181a promoted the expression of mRNA and the production of the related protein of these indices of fibrosis. These findings were reversed by using knockdown of miR-181a (page 4127). Chen et al. teach that circulating miR-181a is a biomarker of AMI (page 4127). Therefore, miR-181 would have been an obvious target for treatment of acute myocardial infarction. It would have been obvious to combine the inhibitor of miR-181 with the inhibitor of miR-145-5p because both have the same intended use of treating AMI (instant claim 26).
With regards to instant claims 30, 32, and 33, the claims recite the same method step as the method of treating myocardial infarction and therefore would necessarily flow from the method of delivering the miR145 inhibitor.
With regards to claims 31 and 34-36, the claims recite outcomes rather than method steps. The outcomes would necessarily flow from the method of delivering the miR145 inhibitor.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636