Prosecution Insights
Last updated: October 02, 2026
Application No. 18/274,327

COMPOSITIONS AND METHODS FOR TREATING DISEASE ASSOCIATED WITH DUX4 OVEREXPRESSION

Non-Final OA §102§103§112§DP
Filed
Jul 26, 2023
Priority
Feb 03, 2021 — provisional 63/145,255 +2 more
Examiner
TATGE, LEXUS MARC
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Research Institute At Nationwide Children's Hospital
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
1 granted / 2 resolved
-10.0% vs TC avg
Strong +100% interview lift
Without
With
+100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
55 currently pending
Career history
37
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
16.6%
-23.4% vs TC avg
§112
25.4%
-14.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim(s) 1-17, 24-30 and 38 are pending. Preliminary Amendments Applicant’s preliminary amendment filed on 01/30/2024 is acknowledged. The claims was amended to cancel (1) claims 18-23 and 31-37; and amend (2) claims 4, 5, 7, 9-17, 29-30, and 38. Election/Restrictions Applicant’s election of Group I in the reply filed on 05/18/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election (of Group 1) has been treated as an election without traverse (MPEP § 818.01(a)). Claim(s) 24-30 and 38 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group II, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/18/2026. Applicant's election with traverse of the species election in the reply filed on 05/18/2026 is acknowledged. The traversal is on the ground(s) that SEQ ID NOs: 19-27 are related sequences. Applicant states that SEQ ID NO: 19-27 are DNA sequences encoding mi405 microRNAs targeting DUX4 and have high sequence percent identity to each other along with property/activity. The traversal of SEQ ID NO: 19-27 has been found persuasive and will be rejoined. SEQ ID NO: 106 will also be rejoined as it relates to the DUX4 target sequence. The restriction for SEQ ID NOs: 5-18, 28-47, 95-105, and 107-124 is maintained. The Applicant traverses the election of a promoter. This is not found persuasive because Applicant did not provide any arguments as to how these promoters have a similar structure/function. Thus, the restriction of promoters will be maintained. Claim 6 is withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species of promoter, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 05/18/2026. Claim(s) 1-5, and 7-17 are under consideration. Priority Acknowledgement is made that this application is a 371 of PCT/US22/15011 filed 02/03/2022 and claims priority based on provisional application filed as 63/145,255 on 02/03/2021. All claims are given the priority date of 02/03/2021. Information Disclosure Statement Receipt of the information disclosure statement(s) on 09/18/2023 (two of them) and 01/29/2026 are acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action. Drawings The drawings were received on 03/02/2026. These drawings are accepted. Specification Abstract Objection Applicant is reminded of the proper content of an abstract of the disclosure. A patent abstract is a concise statement of the technical disclosure of the patent and should include that which is new in the art to which the invention pertains. The abstract should not refer to purported merits or speculative applications of the invention and should not compare the invention with the prior art. If the patent is of a basic nature, the entire technical disclosure may be new in the art, and the abstract should be directed to the entire disclosure. If the patent is in the nature of an improvement in an old apparatus, process, product, or composition, the abstract should include the technical disclosure of the improvement. The abstract should also mention by way of example any preferred modifications or alternatives. Where applicable, the abstract should include the following: (1) if a machine or apparatus, its organization and operation; (2) if an article, its method of making; (3) if a chemical compound, its identity and use; (4) if a mixture, its ingredients; (5) if a process, the steps. Extensive mechanical and design details of an apparatus should not be included in the abstract. The abstract should be in narrative form and generally limited to a single paragraph within the range of 50 to 150 words in length. See MPEP § 608.01(b) for guidelines for the preparation of patent abstracts. The abstract is over 150 words. The use of the term(s): Lipofectamine [00188], [00193], [00194], [00199] GenBank [0096] KnockOut [00187] miRVANA [0049] [0063] [00189] [00191] [00193] TaqMan [0046] [0049] [0056] [0065] [00191] [00192] [00213] [002233] [00244] Evagreen [00192] Quantasoft [00192] Tween [00119] [00194] [00195] [00196] which is/are a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See [00184] Claim Rejections - 35 USC § 112(a) – Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim(s) 15-17 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for A method of treating a subject having facioscapulohumeral muscular dystrophy comprising administering to the subject by intramuscular injection a recombinant adeno-associated virus comprising a polynucleotide encoding the nucleic acid of claim 1, wherein the recombinant adeno-associated virus lacks rep and cap genes, does not reasonably provide enablement for any/all muscular dystrophies, any/all cancers, a nucleic acid administered naked, or any form of administration. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. Enablement is considered in view of the Wands factors (MPEP 2164.01(A)). These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Nature of the invention: Claim 15 is drawn to A method of treating a subject having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of the nucleic acid of claim 1. The nature of the invention is complex in that any/all forms of administration of an effective amount of any of the nucleic acids of claim 1 must result in treating any/all forms of muscular dystrophy or any/all cancers. Claim 16 is drawn to The method of claim 15, wherein the muscular dystrophy is facioscapulohumeral muscular dystrophy. The nature of the invention is complex in that any/all forms of administration of an effective amount of any of the nucleic acids of claim 1 must result in treating facioscapulohumeral muscular dystrophy. Claim 17 is drawn to The method of claim 15, wherein the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head/neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus. The nature of the invention is complex in that any/all forms of administration of an effective amount of any of the nucleic acids of claim 1 must result in treating all of the cancers listed above. Breadth of the claims: The broadest reasonable interpretation of claim 15 is that it encompasses a method of treating any/all muscular dystrophies or any/all types/forms of cancer by administering via any/all means of administering to the subject an effective amount of any one of the nucleic acids of claim 1. The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims. Guidance of the specification: Regarding any/all muscular dystrophies (MD), the specification discloses in some aspects the MD is facioscapulohumeral muscular dystrophy (FSHD) (see paragraph [0025]-[0026]; [00116]). Regarding any/all types/forms of cancer, the specification discloses in some aspects the cancer is a cancer associated with expression or overexpression of DUX4, or the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head/neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus (see paragraph [0025]-[0026]; [00116]). Regarding any/all means of administering, the specification discloses uses of a nucleic acid, an adeno-associated virus, a nanoparticle, extracellular vesicle, or exosome, or a composition (see paragraph [0026]), wherein the medicament is formulated for intramuscular injection, subcutaneous injection, oral administration, subcutaneous, intradermal, or transdermal transport, injection into the blood stream, or for aerosol administration, (see paragraph [0027]). Existence of working examples: There are 9 working and 3 prophetic examples provided in the specification. Example 1: Explains materials and methods, as well as study design. Applicant discusses cloning techniques, cell culture with HEK293s, cell culture with FSHD human myoblasts, dual luciferase assay, RNA extraction, qRT-PCR, gene expression assays, ddPCR, northern blots, western blots, apoptosis assays, flow cytometry, delivery of the AAV vector to Mice, histology, and in situ immunofluorescence. Example 2: Applicant discusses the mir-675 construct targeting DUX4, inhibiting DUX4 expression with reduced efficiency. Specifically, the scAAV6.mir-675 expressing H1.mir-675 construct showed muscle toxicity. Example 3: Applicant discusses inhibition of DUX4 protein levels in vitro using mir-675 constructs. Example 4 and 5: Applicant discloses inhibition efficiency of mi405 but not other miDUX4 constructs was increased by changing the 5’ and 3’ ending flanking sequences (example 4). Applicant discloses that by changing that 5’ and 3’ end flanking the mi405 stem-loop, that this change affected the silencing efficiency and expression of the miRNA (example 5). Prophetic Example 6: Applicant envisions using DUX4 miRNA to decrease DUX4-activated biomarker expression in a mouse model of FSHD. The injections were intramuscularly or intravenously. Prophetic Example 7: Applicant envisions DUX4 miRNA decreases endogenous DUX4 expression in the muscle in a mouse model of FSHD. The injections were intramuscularly or intravenously. Prophetic Example 8: Applicant envisions DUX4 miRNA decreasing endogenous DUX4 expression in muscles of patents suffering from FSHD via injecting DUX4miRNA intramuscularly or intravenously. Example 9: Applicant envisions small molecule upregulation of mir-675 reducing DUX4 and DUX4-responsive biomarkers in FSHD patient myotubes. Applicant discloses testing beta-estradiol, a combination of beta-estradiol and medroxyprogesterone acetate (MPA), and melatonin in HEK293 cells and human myotubes to test the molecules’ ability to upregulate mir-675-5p. Applicant envisions that treatment with these small molecules can be used to treat diseases associated with the expression or overexpression of DUX4 such as FSHD or cancer. Example 10: Applicant envisions that mir-675 enhances skeletal muscle regeneration and differentiation because mir-675 can target Smad transcription factors, which are critical for the bone morphogenetic protein pathway and DNA replication initiation. Example 11: Applicant discloses coinjecting U6.mi405(f)(g)(h) using scAAV6 at equivalent doses to wildtype mice in the tibialis anterior (intramuscular). Example 12: Applicant discloses treating FSHD affected muscle cell lines with pyrazinamide or soragenib Predictability and state of the art: Chulanova et al (Delivery of genetic medicines for muscular dystrophies, Cell Reports Medicine, Volume 6, Issue 101885, pages 1-15, published January 21st, 2025) teaches the difference in muscular dystrophy, the promise of AAVs, and muscle delivery. "Muscular dystrophies are a group of heterogenic disorders characterized by progressive muscle weakness, the most common of them being Duchenne muscular dystrophy (DMD). Muscular dystrophies are caused by mutations in over 50 distinct genes, and many of them are caused by different genetic mechanisms. Currently, none of these diseases have a cure. However, in recent years, significant progress has been made to correct the underlying genetic cause. The clinical development of adeno-associated viral vector-based therapies has simultaneously produced excitement and disappointment in the research community due to the moderate effect, making it clear that new methods of muscle delivery have to be created.", (summary). "As of today, there are several therapeutic approaches: gene replacement, gene silencing, and gene editing. Due to the heterogeneous nature of MDs, the therapeutic approach must be tailored to the specific type of mutation. The underlying mutation causing the disease could be loss-of-function mutations, epigenetic de-repression causing unwanted protein activity, and repeat expansion also leading to insufficient protein expression.", (page 1, column 1, para 3). Table 1 teaches that different muscular dystrophies are caused by different genetic mutations i.e., Duchenne and Becker implicant DMD, Limb-girdle implicates 39 genes, facioscapulohumeral type 1 implicates DUX4 (FSHD type 2, 5% of the FSHD type 1 population implicates 3 more genes), Myotonic implicates DMPK CNBP, Congenital implicates 35 genes, X-linked myotubular myopathy implicants MTM1, Emery-Dreifuss implicates 10 genes, and Oculopharyngeal implicates PABPN1. Vogelstein et al (Cancer Genome Landscapes, Science, Vol 339, Issue 6127, pages 1546-1558, published March 29th, 2013) teaches cancer heterogeneity. “For most cancer types, this landscape consists of a small number of “mountains” (genes altered in a high percentage of tumors) and a much larger number of “hills” (genes altered infrequently). To date, these studies have revealed ~140 genes that, when altered by intragenic mutations, can promote or “drive” tumorigenesis. A typical tumor contains two to eight of these “driver gene” mutations; the remaining mutations are passengers that confer no selective growth advantage. Driver genes can be classified into 12 signaling pathways that regulate three core cellular processes: cell fate, cell survival, and genome maintenance.”, (abstract). “In common solid tumors such as those derived from the colon, breast, brain, or pancreas, an average of 33 to 66 genes display subtle somatic mutations that would be expected to alter their protein products (Fig. 1A). About 95% of these mutations are single-base substitutions (such as C>G), whereas the remainder are deletions or insertions of one or a few bases (such as CTT>CT) (table S1B). Of the base substitutions, 90.7% result in missense changes, 7.6% result in nonsense changes, and 1.7% result in alterations of splice sites or untranslated regions immediately adjacent to the start and stop codons (table S1B).”, (page 1546, col 1, para 3). “Certain tumor types display many more or many fewer mutations than average (Fig. 1B). Notable among these outliers are melanomas and lung tumors, which contain ~200 nonsynonymous mutations per tumor (table S1C).”, (page 1546, col 2, para 1). El Sayed et al (MicroRNA Therapeutics in Cancer: Current Advances and Challenges, Cancers (Basel), Volume 13, Issue 11, Pages 1-28 Published May 28th, 2021) teaches cancer-based microRNA therapeutics and the challenges that come with it. Under challenges in clinical translation “So far, only 10 miRNA-based drugs have reached clinical trials with none of them entering Phase III and half of them were halted.”, (page 18, para 3). “Regulus Therapeutics developed another miR-122 inhibitor, RG-101, an N-acetyl-d-galactosamine-conjugated antagomiR which showed considerable efficacy in patients with HCV. However, some serious adverse events of severe hyperbilirubinemia led the FDA to suspend the trial. MRX34, a first-in-class cancer therapy developed by miRNA Therapeutics was delivered as a mimic of miR-34 encapsulated into a liposome-formulated nanoparticle (NOV40). MRX34 displayed a strong activity in melanoma, hepatocellular carcinoma, NSCLC, and renal carcinoma (NCT01829971). Unfortunately, miRNA Therapeutics halted the phase I due to multiple immune-related severe adverse events. Unfortunately, miRNA Therapeutics halted the phase I due to multiple immune-related severe adverse events. These successive failures indicate that miRNA-based therapies are still awaiting their Eureka moment.”, (page 19, para 1). “Interestingly, Zhang et al. [152] recently analyzed the reasons for the delayed development of miRNA-based therapies compared to siRNA-based therapies. Combining clinical trial information [164], Drugs@FDA database, target prediction softwares and gene ontology enrichment tools allowed them to conclude that the serious immune-related adverse events that led to the discontinuation of MRX34 were due to a “too many targets for miRNA effect” (TMTME) on several genes involved in cytokine and interleukin signaling in the immune system [152].”, (page 20, para 2). “Delivery systems and administration routes, dosage concerns and off-target effects remain major challenges to be overcome for the development of miRNA-based therapies for cancer and other diseases. Despite a great number of preclinical studies in mouse models of cancer, only a very small number of miRNA candidates have reached clinical development so far. Performing rigorous pharmacokinetics (absorption, distribution, metabolism, and excretion or ADME) studies in animals will provide a basis for anticipating how miRNA mimics/antimiRs will behave in humans.”, (page 19, para 2). “The mechanism by which nanoparticles enter solid tumors appears more complex than previously thought and probably involves active trans-endothelial pathways [159]. The EPR-dependent drug delivery is compromised by high tumor interstitial fluid pressure and poor blood flow inside human tumors. Despite nanoparticle stabilization and surface manipulations, perfect tumor targeting is not yet achieved [160] Liver and spleen remain the first accumulation sites for nanoparticles due in part to their fenestrated endothelium. Thus, these organs are major barriers to clinical translation of nanomaterials administered intravenously [161].”, (page 19, para 2 to page 20, para 1). Amount of experimentation necessary: The quantity needed to carry out the scope of the invention is large. (1) One would need to test all of the nucleic acids presented in claim 1 in model systems that represent each individual muscular dystrophy (since each are caused by differing mutations) and in model systems representative of the broad genus of “cancer”. (2) One would need to identify the candidates from (1) and administer such nucleic acids to an applicable subject (e.g., mouse) via various routes of administration e.g., intravenous, subcutaneous, orally, nasally etc. Lastly, (3) One would need to see if through the broad administration of the claimed nucleic acids would they yield a therapeutic improvement in subjects having any of the muscular dystrophies or any cancer in art accepted disease models. This type of experimentation is not routine in the art and would require a large amount of inventive effort. Further considering that any positive results (e.g., successful treatment of any/all forms of MD and/or any/all forms/types of cancer via any/all routes of administering) would amount to a significant advancement in the state of the art, additional experimentation required is considered undue. In view of the breadth of the claims and the lack of guidance provided by the specification as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention. Therefore, claims 15-17 are not considered to be totally enabled, but are scoped to A method of treating a subject having facioscapulohumeral muscular dystrophy comprising administering to the subject by intramuscular injection a recombinant adeno-associated virus comprising a polynucleotide encoding the nucleic acid of claim 1, wherein the recombinant adeno-associated virus lacks rep and cap genes, by the instant disclosure. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-4 and 7-16 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by ‘851 (US 9,469,851 B2; published October 18th, 2016). Regarding claim(s) 1 and 7-9, ‘851 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.” (see column 4, lines 32-35). Wherein SEQ ID NO: 1 of ‘851 is 96.6% identical to instant SEQ ID NO: 20 (SEQ ID NO: 20 of the instant application contains 87 base pairs, whereas SEQ ID NO: 1 of ‘851 contains 85 base pairs, with one base pair mismatch for 84/87 matches), see alignment below. PNG media_image1.png 109 652 media_image1.png Greyscale PNG media_image2.png 140 516 media_image2.png Greyscale Regarding claim(s) 2-4, ‘851 discloses in Figure 5 a U6 promoter for mi405 AAV.miDUX4, see figure below. Regarding claim(s) 10 and 11, ‘851 discloses, “The rAAV genomes of the invention lack AAV rep and cap DNA. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. As noted in the Background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.”, (see column 5, lines 15-23). Regarding claim 12, ‘851 discloses, “Expression of the DUX4 target sequence in the presence of the DUX4 miRNAs was assayed. A lipofectamine 2000 transfection was done in 293 cells in a 96-well, white-walled assay plate. 140,000 cells were transfected with 20 ng of a Renilla-firefly plasmid containing the DUX4 target sequence (FIG. 3A) and 180 ng of various DUX4 miRNA-encoding vectors, including U6T6-driven miDux4.405 or miDux4.1156 vectors from Example 1. A luciferase assay was performed 24 hours later.”, (see column 13, lines 14-22). Regarding claim 13, ‘851 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.”, (column 4, lines 32-35). Moreover, “In another embodiment, the invention contemplates compositions comprising rAAV of the present invention. Compositions of the invention comprise rAAV in a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants.”, (see column 6, lines 49-53). Regarding claim 14, ‘851 discloses inhibiting expression of the DUX4 gene in a cell comprising contacting the cell with a rAAV encoding SEQ ID NO: 1 (column 4, lines 36-42 and see Fig. 4B). Regarding claim(s) 15 and 16, ‘851 discloses, “The present invention relates to RNA interference-based methods for inhibiting the expression of the DUX4 gene, a double homeobox gene on human chromosome 4q35. Recombinant adeno-associated viruses of the invention deliver DNAs encoding microRNAs that knock down the expression of DUX4. The methods have application in the treatment of muscular dystrophies such as facioscapulohumeral muscular dystrophy.”, (see column 1, field of the invention). More specifically, claim 4 discloses, “A method of treating a facioscapulohumeral muscular dystrophy patient comprising administering to the patient by intramuscular injection a recombinant adeno-associated virus comprising nucleotide sequence of SEQ ID NO: 1 encoding a DUX4 miRNA or the nucleotide sequence of SEQ ID NO: 2 encoding a DUX4 miRNA, wherein the recombinant adeno-associated virus lacks rep and cap genes.”. Accordingly, claim(s) 1-4 and 7-16 are rejected as being anticipated by ‘851. Claim(s) 1-4 and 7-16 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by ‘649 (US 10,301,649 B2; published May 28th, 2019). Regarding claim(s) 1 and 7-9, ‘649 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.” (see column 4, lines 33-36). Wherein SEQ ID NO: 1 of ‘649 is 96.6% identical to instant SEQ ID NO: 20 (SEQ ID NO: 20 of the instant application contains 87 base pairs, whereas SEQ ID NO: 1 of ‘649 contains 85 base pairs, with one base pair mismatch for 84/87 matches), see alignment below. PNG media_image1.png 109 652 media_image1.png Greyscale PNG media_image2.png 140 516 media_image2.png Greyscale Regarding claim(s) 2-4, ‘649 discloses in Figure 5 a U6 promoter for mi405 AAV.miDUX4, see figure below. Regarding claim(s) 10 and 11, ‘649 discloses, “The rAAV genomes of the invention lack AAV rep and cap DNA. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. As noted in the Background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.”, (see column 5, lines 16-23). Regarding claim 12, ‘649 discloses, “Expression of the DUX4 target sequence in the presence of the DUX4 miRNAs was assayed. A lipofectamine 2000 transfection was done in 293 cells in a 96-well, white-walled assay plate. 140,000 cells were transfected with 20 ng of a Renilla-firefly plasmid containing the DUX4 target sequence (FIG. 3A) and 180 ng of various DUX4 miRNA-encoding vectors, including U6T6-driven miDux4.405 or miDux4.1156 vectors from Example 1. A luciferase assay was performed 24 hours later.”, (see column 13, lines 18-27). Regarding claim 13, ‘649 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.”, (column 4, lines 32-35). Moreover, “In another embodiment, the invention contemplates compositions comprising rAAV of the present invention. Compositions of the invention comprise rAAV in a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants.”, (see column 6, lines 49-53). Regarding claim 14, ‘649 discloses inhibiting expression of the DUX4 gene in a cell comprising contacting the cell with a rAAV encoding SEQ ID NO: 1 (column 4, lines 37-43 and see Fig. 4B). Regarding claim(s) 15 and 16, ‘649 discloses, “The present invention relates to RNA interference-based methods for inhibiting the expression of the DUX4 gene, a double homeobox gene on human chromosome 4q35. Recombinant adeno-associated viruses of the invention deliver DNAs encoding microRNAs that knock down the expression of DUX4. The methods have application in the treatment of muscular dystrophies such as facioscapulohumeral muscular dystrophy.”, (see abstract). Accordingly, claim(s) 1-4 and 7-16 are rejected as being anticipated by ‘649. Claim(s) 1-4 and 7-16 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by ‘201 (US 2024/0318201 A1, published September 26th, 2024; filing date of July 25th, 2011). The applied reference has a common Inventor and Applicant with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1 and 7-9, ‘201 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.” (para [0015]). Wherein SEQ ID NO: 1 of ‘201 is 96.6% identical to instant SEQ ID NO: 20 (SEQ ID NO: 20 of the instant application contains 87 base pairs, whereas SEQ ID NO: 1 of ‘201 contains 85 base pairs, with one base pair mismatch for 84/87 matches), see alignment below. PNG media_image1.png 109 652 media_image1.png Greyscale Regarding claim(s) 2-4, ‘201 discloses in Figure 5 a U6 promoter for mi405 AAV.miDUX4, see figure below. PNG media_image2.png 140 516 media_image2.png Greyscale Regarding claim(s) 10 and 11, ‘201 discloses, “The rAAV genomes of the invention lack AAV rep and cap DNA. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. As noted in the Background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.”, (see paragraph [0020]). Regarding claim 12, ‘201 discloses, “Expression of the DUX4 target sequence in the presence of the DUX4 miRNAs was assayed. A lipofectamine 2000 transfection was done in 293 cells in a 96-well, white-walled assay plate. 140,000 cells were transfected with 20 ng of a Renilla-firefly plasmid containing the DUX4 target sequence (FIG. 3A) and 180 ng of various DUX4 miRNA-encoding vectors, including U6T6-driven miDux4.405 or miDux4.1156 vectors from Example 1. A luciferase assay was performed 24 hours later.”, (see paragraph [0055]). Regarding claim 13, ‘201 discloses, “In another aspect, the invention provides a composition comprising a rAAV encoding a DUX4 miRNA (for example, a rAAV comprising the DNA set out in SEQ ID NO: 1 or 2) wherein the rAAV lacks rep and cap genes.”, (see paragraph [0015]). Moreover, “In another embodiment, the invention contemplates compositions comprising rAAV of the present invention. Compositions of the invention comprise rAAV in a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants.”, (see paragraph [0027]). Regarding claim 14, ‘201 discloses inhibiting expression of the DUX4 gene in a cell comprising contacting the cell with a rAAV encoding SEQ ID NO: 1 (para [0016] and see Fig. 4B). Regarding claim(s) 15 and 16, ‘201 discloses, “The present invention relates to RNA interference-based methods for inhibiting the expression of the DUX4 gene, a double homeobox gene on human chromosome 4q35. Recombinant adeno-associated viruses of the invention deliver DNAs encoding microRNAs that knock down the expression of DUX4. The methods have application in the treatment of muscular dystrophies such as facioscapulohumeral muscular dystrophy.”, (see abstract). Accordingly, claim(s) 1-4 and 7-16 are rejected as being anticipated by ‘201. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over ‘851 (US 9,469,851 B2; published October 18th, 2016) as applied to claim 1-4 and 7-16 above, and further in view of Boudreau et al (Rapid Cloning and Validation of MicroRNA Shuttle Vectors: A Practical Guide; RNA Interference Techniques, Neuromethods, volume 58, pages 19-37, published April 2nd, 2011) as evidence by NEB (EcoRI restriction enzyme endonuclease, New England Biolabs, pages 1-5, Accessed June 10th, 2026) in view of Roelz et al (Of mice and men: human RNA polymerase III promoter U6 is more efficient than its murine homologue for shRNA expression from a lentiviral vector in both human and murine progenitor cells, Exp Hematol, Volume 38, Issue 9, pages 792-797, published September 2010). Regarding claim 5, ‘851 teaches, “The two PCR products were ligated overnight to a U6T6 vector (via XhoI and XbaI) that contains a mouse U6 promoter and an RNA polymerase III termination signal (six thymidine nucleotides). MiRNAs are cloned into XhoI and XbaI restriction sites located between the 3′ end of the U6 promoter and termination signal (SpeI site on the 3′ end of the DNA template for each miRNA has complementary cohesive ends with the XbaI site). The ligation product was transformed into chemically competent E-coli cells with a 42° C. heat shock and incubated at 37° C. shaking for 1 hour before being plated on kanamycin selection plates. The colonies were allowed to grow overnight at 37°. The following day they were mini-prepped and sequenced for accuracy.”, (col 12, lines 61-67 to col 13, 1-7). 851 does not teach a mouse U6 promoter sequence, a XhoI cloning site sequence, or SpeI cloning site sequence. Boudreau et al teaches designing and cloning miRNA shuttles. More specifically, page 26 diagrams the steps to produce the cloning shuttles and pages 25-31 provides details. More specifically, Boudreau et al teaches the terminal stem on page 27 where the first 1-12 nucleotides contain the XhoI cloning sites, (5’ CTCGAG 3’) followed by mir-30a-derived stem sequences located at nucleotide positions 7–12 (5’ TGAGCG 3’) are included in every mir-30a shuttle. Therefore, the first 1-12 nucleotides of the stem sequence are CTCGAGTGAGCG. Boudreau et al continues to teach nucleotides 76-86 of the terminal stem on page 27. Wherein the T nucleotide at position 76 is on the antisense strand. Positions 76-83 are (5’ TGCCTACT 3’) are mir-30a-derived stem sequences in which the 3¢ terminal ACT nucleotides are the first half of a SpeI restriction site. Also, the AGT nucleotides located at positions 84–86 are added to generate a 3¢ terminal SpeI site (5’ ACTAGT 3’). Therefore, position 76-86 of the stem sequence are TGCCTACTAGT. Boudreau et al teaches “In this example, we use the RNA polymerase III-dependent mouse U6 promoter to transcribe miRNA shuttles. Downstream of the U6 promoter is a pol III termination signal (TTTTTT). The XhoI–SpeI digested product from step 7 is cloned between the U6 promoter and the termination signal using XhoI–XbaI restriction sites. SpeI and XbaI digested ends are compatible. An obvious question is, “why not include XbaI instead of SpeI at the 3’ end of the miRNA template?” Theoretically, and in practice, XbaI–XbaI ligation produces functional miRNAs. However, we have found that SpeI–XbaI ligation produces a more robust miRNA shuttle expression and gene silencing compared to identical miRNAs cloned using only XbaI.”, (see page 30, para 3). Further, “Positive plasmids can be identified by EcoRI restriction enzyme digestion, followed by agarose gel electrophoresis (1.5% TBE or TAE gel) and UV imaging of ethidium bromide-stained DNA. Empty U6T6 has three EcoRI sites; one is lost upon XhoI–XbaI digestion (Fig. 4, step 8)”, (see page 31, para 1 and Figure 4). Boudreau et al does not teach the exact sequence of the EcoRI site, however, this is evidence by NEB. NEB teaches that EcoRI sequence is GAATTC on page 1. 851 and Boudreau et al do not explicitly teach the sequence of mouse U6. PNG media_image3.png 398 1034 media_image3.png Greyscale Roelz et al teaches in Figure 1 the sequence of mouse U6, see figure 1A below. Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of 851 with Boudreau et al as evidence by NEB and in further view of Roelz et al to yield the predictable nucleic acid product by obtaining the terminal stem product (taught by 851 and Boudreau et al) that is to be ligated between a mouse U6 promoter (as taught by Roelz et al) and a pol III termination signal with an EcoRI site for plasmid validation. 851 teaches SEQ ID NO:1. Nucleotides 1-12 of SEQ ID NO: 1 are CTCGAGTGAGCG and nucleotides 76-86 of SEQ ID NO: 1 are TGCCTACTAGT, as taught by both 851 and Boudreau et al. See underlined nucleotides below. ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt Both 851 and Boudreau teach a T6 (i.e., TTTTTT) pol III termination signal sequence and that product (i.e., the microRNA) is cloned between the U6 promoter and the termination signal. The result sequence of the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt…tttttt. Boudreau et al teaches an EcoRI enzyme sites in three locations, sequence of EcoRI evidence by NEB (i.e., GAATTC). One site is before the U6 promoter, one site is between the cut sites and will be remove upon cloning of the product into the vector, and one is outside of the cassette to allow for positive plasmid identification right next to the T6 sequence (see figure 4 of Boudreau et al). The result sequence for the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt… gaattc…tttttt. Lastly, Roelz et al teaches the sequence of the mouse u6 promoter, the resulting sequence for the combination of the teachings of 851, Boudreau et al as evidenced by NEB in further view of Roelz et al, is as follows below and is aligned to instant SEQ ID NO: 71 with a percent identity of 91.33%: PNG media_image4.png 670 1072 media_image4.png Greyscale Accordingly, claim 5 is unpatentable in view of 851 in view of Boudreau et al as evidenced by NEB in further view of Roelz et al. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over ‘649 (US 10,301,649 B2; published May 28th, 2019) as applied to claim 1-4 and 7-16 above, and further in view of Boudreau et al (Rapid Cloning and Validation of MicroRNA Shuttle Vectors: A Practical Guide; RNA Interference Techniques, Neuromethods, volume 58, pages 19-37, published April 2nd, 2011) as evidence by NEB (EcoRI restriction enzyme endonuclease, New England Biolabs, pages 1-5, Accessed June 10th, 2026) in view of Roelz et al (Of mice and men: human RNA polymerase III promoter U6 is more efficient than its murine homologue for shRNA expression from a lentiviral vector in both human and murine progenitor cells, Exp Hematol, Volume 38, Issue 9, pages 792-797, published September 2010). Regarding claim 5, ‘649 teaches, “The two PCR products were ligated overnight to a U6T6 vector (via XhoI and XbaI) that contains a mouse U6 promoter and an RNA polymerase III termination signal (six thymidine nucleotides). MiRNAs are cloned into XhoI and XbaI restriction sites located between the 3′ end of the U6 promoter and termination signal (SpeI site on the 3′ end of the DNA template for each miRNA has complementary cohesive ends with the XbaI site). The ligation product was transformed into chemically competent E-coli cells with a 42° C. heat shock and incubated at 37° C. shaking for 1 hour before being plated on kanamycin selection plates. The colonies were allowed to grow overnight at 37°. The following day they were mini-prepped and sequenced for accuracy.”, (col 12, lines 65-67 to col 13, 1-11). 649 does not teach a mouse U6 promoter sequence, a XhoI cloning site sequence, or SpeI cloning site sequence. Boudreau et al teaches designing and cloning miRNA shuttles. More specifically, page 26 diagrams the steps to produce the cloning shuttles and pages 25-31 provides details. More specifically, Boudreau et al teaches the terminal stem on page 27 where the first 1-12 nucleotides contain the XhoI cloning sites, (5’ CTCGAG 3’) followed by mir-30a-derived stem sequences located at nucleotide positions 7–12 (5’ TGAGCG 3’) are included in every mir-30a shuttle. Therefore, the first 1-12 nucleotides of the stem sequence are CTCGAGTGAGCG. Boudreau et al continues to teach nucleotides 76-86 of the terminal stem on page 27. Wherein the T nucleotide at position 76 is on the antisense strand. Positions 76-83 are (5’ TGCCTACT 3’) are mir-30a-derived stem sequences in which the 3¢ terminal ACT nucleotides are the first half of a SpeI restriction site. Also, the AGT nucleotides located at positions 84–86 are added to generate a 3’ terminal SpeI site (5’ ACTAGT 3’). Therefore, position 76-86 of the stem sequence are TGCCTACTAGT. Boudreau et al teaches “In this example, we use the RNA polymerase III-dependent mouse U6 promoter to tran scribe miRNA shuttles. Downstream of the U6 promoter is a pol III termination signal (TTTTTT). The XhoI–SpeI digested product from step 7 is cloned between the U6 promoter and the termination signal using XhoI–XbaI restriction sites. SpeI and XbaI digested ends are compatible. An obvious question is, “why not include XbaI instead of SpeI at the 3¢ end of the miRNA template?” Theoretically, and in practice, XbaI–XbaI ligation produces functional miRNAs. However, we have found that SpeI–XbaI ligation produces a more robust miRNA shuttle expression and gene silencing compared to identical miRNAs cloned using only XbaI.”, (see page 30, para 3). Further, “Positive plasmids can be identified by EcoRI restriction enzyme digestion, followed by agarose gel electrophoresis (1.5% TBE or TAE gel) and UV imaging of ethidium bromide-stained DNA. Empty U6T6 has three EcoRI sites; one is lost upon XhoI–XbaI digestion (Fig. 4, step 8)”, (see page 31, para 1 and Figure 4). Boudreau et al does not teach the exact sequence of the EcoRI site, however, this is evidence by NEB. NEB teaches that EcoRI sequence is GAATTC on page 1. 649 and Boudreau et al do not explicitly teach the sequence of mouse U6. Roelz et al teaches in Figure 1 the sequence of mouse U6, see figure 1A below. PNG media_image3.png 398 1034 media_image3.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of 649 with Boudreau et al as evidence by NEB and in further view of Roelz et al to yield the predictable nucleic acid product by obtaining the terminal stem product (taught by 649 and Boudreau et al) that is to be ligated between a mouse U6 promoter (as taught by Roelz et al) and a pol III termination signal with an EcoRI site for plasmid validation. 649 teaches SEQ ID NO:1. Nucleotides 1-12 of SEQ ID NO: 1 are CTCGAGTGAGCG and nucleotides 76-86 of SEQ ID NO: 1 are TGCCTACTAGT, as taught by both 649 and Boudreau et al. See underlined nucleotides below. ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt Both 649 and Boudreau teach a T6 (i.e., TTTTTT) pol III termination signal sequence and that product (i.e., the microRNA) is cloned between the U6 promoter and the termination signal. The result sequence of the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt…tttttt. Boudreau et al teaches an EcoRI enzyme sites in three locations, sequence of EcoRI evidence by NEB (i.e., GAATTC). One site is before the U6 promoter, one site is between the cut sites and will be remove upon cloning of the product into the vector, and one is outside of the cassette to allow for positive plasmid identification right next to the T6 sequence (see figure 4 of Boudreau et al). The result sequence for the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt… gaattc…tttttt. Lastly, Roelz et al teaches the sequence of the mouse u6 promoter, the resulting sequence for the combination of the teachings of 649, Boudreau et al as evidenced by NEB in further view of Roelz et al, is as follows below and is aligned to instant SEQ ID NO: 71 with a percent identity of 91.33%: PNG media_image4.png 670 1072 media_image4.png Greyscale Accordingly, claim 5 is unpatentable in view of 649 in view of Boudreau et al as evidenced by NEB in further view of Roelz et al. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over ‘201 (US 2024/0318201 A1, published September 26th, 2024; filing date of July 25th, 2011) as applied to claim 1-4 and 7-16 above, and further in view of Boudreau et al (Rapid Cloning and Validation of MicroRNA Shuttle Vectors: A Practical Guide; RNA Interference Techniques, Neuromethods, volume 58, pages 19-37, published April 2nd, 2011) as evidence by NEB (EcoRI restriction enzyme endonuclease, New England Biolabs, pages 1-5, Accessed June 10th, 2026) in view of Roelz et al (Of mice and men: human RNA polymerase III promoter U6 is more efficient than its murine homologue for shRNA expression from a lentiviral vector in both human and murine progenitor cells, Exp Hematol, Volume 38, Issue 9, pages 792-797, published September 2010). Regarding claim 5, ‘201 teaches, “The two PCR products were ligated overnight to a U6T6 vector (via XhoI and XbaI) that contains a mouse U6 promoter and an RNA polymerase III termination signal (six thymidine nucleotides). MiRNAs are cloned into XhoI and XbaI restriction sites located between the 3′ end of the U6 promoter and termination signal (SpeI site on the 3′ end of the DNA template for each miRNA has complementary cohesive ends with the XbaI site). The ligation product was transformed into chemically competent E-coli cells with a 42° C. heat shock and incubated at 37° C. shaking for 1 hour before being plated on kanamycin selection plates. The colonies were allowed to grow overnight at 37°. The following day they were mini-prepped and sequenced for accuracy.”, (para [0053]). 201 does not teach a mouse U6 promoter sequence, a XhoI cloning site sequence, or SpeI cloning site sequence. Boudreau et al teaches designing and cloning miRNA shuttles. More specifically, page 26 diagrams the steps to produce the cloning shuttles and pages 25-31 provides details. More specifically, Boudreau et al teaches the terminal stem on page 27 where the first 1-12 nucleotides contain the XhoI cloning sites, (5’ CTCGAG 3’) followed by mir-30a-derived stem sequences located at nucleotide positions 7–12 (5’ TGAGCG 3’) are included in every mir-30a shuttle. Therefore, the first 1-12 nucleotides of the stem sequence are CTCGAGTGAGCG. Boudreau et al continues to teach nucleotides 76-86 of the terminal stem on page 27. Wherein the T nucleotide at position 76 is on the antisense strand. Positions 76-83 are (5’ TGCCTACT 3’) are mir-30a-derived stem sequences in which the 3¢ terminal ACT nucleotides are the first half of a SpeI restriction site. Also, the AGT nucleotides located at positions 84–86 are added to generate a 3’ terminal SpeI site (5’ ACTAGT 3’). Therefore, position 76-86 of the stem sequence are TGCCTACTAGT. Boudreau et al teaches “In this example, we use the RNA polymerase III-dependent mouse U6 promoter to tran scribe miRNA shuttles. Downstream of the U6 promoter is a pol III termination signal (TTTTTT). The XhoI–SpeI digested product from step 7 is cloned between the U6 promoter and the termination signal using XhoI–XbaI restriction sites. SpeI and XbaI digested ends are compatible. An obvious question is, “why not include XbaI instead of SpeI at the 3¢ end of the miRNA template?” Theoretically, and in practice, XbaI–XbaI ligation produces functional miRNAs. However, we have found that SpeI–XbaI ligation produces a more robust miRNA shuttle expression and gene silencing compared to identical miRNAs cloned using only XbaI.”, (see page 30, para 3). Further, “Positive plasmids can be identified by EcoRI restriction enzyme digestion, followed by agarose gel electrophoresis (1.5% TBE or TAE gel) and UV imaging of ethidium bromide-stained DNA. Empty U6T6 has three EcoRI sites; one is lost upon XhoI–XbaI digestion (Fig. 4, step 8)”, (see page 31, para 1 and Figure 4). Boudreau et al does not teach the exact sequence of the EcoRI site, however, this is evidence by NEB. NEB teaches that EcoRI sequence is GAATTC on page 1. 201 and Boudreau et al do not explicitly teach the sequence of mouse U6. Roelz et al teaches in Figure 1 the sequence of mouse U6, see figure 1A below. PNG media_image3.png 398 1034 media_image3.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of 201 with Boudreau et al as evidence by NEB and in further view of Roelz et al to yield the predictable nucleic acid product by obtaining the terminal stem product (taught by 201 and Boudreau et al) that is to be ligated between a mouse U6 promoter (as taught by Roelz et al) and a pol III termination signal with an EcoRI site for plasmid validation. 201 teaches SEQ ID NO:1. Nucleotides 1-12 of SEQ ID NO: 1 are CTCGAGTGAGCG and nucleotides 76-86 of SEQ ID NO: 1 are TGCCTACTAGT, as taught by both 201 and Boudreau et al. See underlined nucleotides below. ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt Both 201 and Boudreau teach a T6 (i.e., TTTTTT) pol III termination signal sequence and that product (i.e., the microRNA) is cloned between the U6 promoter and the termination signal. The result sequence of the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt…tttttt. Boudreau et al teaches an EcoRI enzyme sites in three locations, sequence of EcoRI evidence by NEB (i.e., GAATTC). One site is before the U6 promoter, one site is between the cut sites and will be remove upon cloning of the product into the vector, and one is outside of the cassette to allow for positive plasmid identification right next to the T6 sequence (see figure 4 of Boudreau et al). The result sequence for the combination is as follows below: mU6…ctcgagtgagcgatccaggattcagatctggtttctgaaagccacagatgggaaaccagatctgaatcctggactgcctactagt… gaattc…tttttt. Lastly, Roelz et al teaches the sequence of the mouse u6 promoter, the resulting sequence for the combination of the teachings of 201, Boudreau et al as evidenced by NEB in further view of Roelz et al, is as follows below and is aligned to instant SEQ ID NO: 71 with a percent identity of 91.33%: PNG media_image4.png 670 1072 media_image4.png Greyscale Accordingly, claim 5 is unpatentable in view of 201 in view of Boudreau et al as evidenced by NEB in further view of Roelz et al. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim(s) 1-4, 15 and 16 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 17, 19 of copending Application No. 18/471,708 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Regarding instant claims 1, 15 and 16, claim 19 of ‘708 recites, “The method of “reducing DUX4-induced muscle degeneration or increasing muscle strength in a subject overexpressing DUX4 comprising administering to the subject an effective amount of a DNA comprising (a) a polynucleotide encoding miDUX4.405 miRNA comprising the nucleotide sequence of SEQ ID NO: 1; or (b) a polynucleotide encoding miDUX4.1156 miRNA comprising the nucleotide sequence of SEQ ID NO: 2, wherein the subject suffers from a muscular dystrophy” wherein the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD).” Wherein SEQ ID NO: 1 is 96.6% identical to instant SEQ ID NO: 20, see alignment below. PNG media_image5.png 154 642 media_image5.png Greyscale Regarding instant claim(s) 1-4, claim 17 of ‘708 recites, “The method of “reducing DUX4-induced muscle degeneration or increasing muscle strength in a subject overexpressing DUX4 comprising administering to the subject an effective amount of a DNA comprising (a) a polynucleotide encoding miDUX4.405 miRNA comprising the nucleotide sequence of SEQ ID NO: 1; or (b) a polynucleotide encoding miDUX4.1156 miRNA comprising the nucleotide sequence of SEQ ID NO: 2, wherein expression of the miRNA is under control of a promoter or a tissue-specific control element”, wherein the promoter is a CMV or U6 promoter.” Accordingly, claim 19 of the ‘708 application anticipates claim(s) 1, 15, and 16; and claim 17 anticipates claims 1-4. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1, 7-9, and 14-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1 and 3-5 of U.S. Patent No. 9,469,851 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Regarding instant claim 1, ‘851 claim 5 recites, The nucleotide sequence of SEQ ID NO: 1 encoding miDUX4.405 or the nucleotide sequence of SEQ ID NO: 2 encoding miDUX4.1156. PNG media_image1.png 109 652 media_image1.png Greyscale Wherein SEQ ID NO: 1 is 96.6% identical to instant SEQ ID NO: 20 of claim 1. Regarding instant claim(s) 7-9, ‘851 claim 1 recites, A recombinant adeno-associated virus comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 encoding a DUX4 miRNA, wherein the recombinant adeno-associated virus lacks rep and cap genes. Regarding instant claim 14, ‘851 claim 3 recites, A method of inhibiting expression of the DUX4 gene in a cell, the method comprising contacting the cell with the recombinant adeno-associated virus of claim 1 or the composition of claim 2. Regarding instant claim(s) 15 and 16, ‘851 claim 4 recites, A method of treating a facioscapulohumeral muscular dystrophy patient comprising administering to the patient by intramuscular injection a recombinant adeno-associated virus comprising nucleotide sequence of SEQ ID NO: 1 encoding a DUX4 miRNA or the nucleotide sequence of SEQ ID NO: 2 encoding a DUX4 miRNA, wherein the recombinant adeno-associated virus lacks rep and cap genes. Accordingly, claim 5 of the ‘851 patent anticipates instant claim 1; claim 1 of the ‘851 patent anticipates instant claim(s) 7-9; claim 3 of the ‘851 patent anticipates instant claim 14; and claim 4 of the ‘851 patent anticipates instant claim(s) 15 and 16. Claim(s) 1 and 7-9 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1 and 2 of U.S. Patent No. 10,301,649 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Regarding instant claim(s) 7-9, claim 1 of the ‘649 patent recites, “A recombinant adeno-associated virus comprising: a) the DUX4 miRNA-encoding DNA comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or b) a DNA encoding a DUX4 miRNA comprising an miRNA antisense guide strand, wherein the miRNA antisense guide strand consists of the nucleotide sequence of SEQ ID NO: 8482, SEQ ID NO: 8372, SEQ ID NO: 8371, SEQ ID NO: 8370, SEQ ID NO: 8367, SEQ ID NO: 8366, SEQ ID NO: 8365, SEQ ID NO: 8219, SEQ ID NO: 8218, SEQ ID NO: 8152, SEQ ID NO: 8147, SEQ ID NO: 8145, SEQ ID NO: 7397, SEQ ID NO: 7396, SEQ ID NO: 7395, SEQ ID NO: 7108, SEQ ID NO: 7107, SEQ ID NO: 7106, SEQ ID NO: 6633, SEQ ID NO: 6631, SEQ ID NO: 6622, SEQ ID NO: 6619, SEQ ID NO: 6609, SEQ ID NO: 6608, SEQ ID NO: 6568, SEQ ID NO: 6561 or SEQ ID NO: 6560, wherein the recombinant adeno-associated virus lacks rep and cap genes Wherein SEQ ID NO: 1 of the ‘649 patent is 96.6% identical to instant SEQ ID NO: 20, see sequence alignment below. PNG media_image6.png 174 616 media_image6.png Greyscale Regarding instant claim 1, claim 2 of ‘649 recites, “A DNA encoding a DUX4 miRNA comprising an miRNA antisense guide strand, wherein the miRNA antisense guide strand consists of the nucleotide sequence of SEQ ID NO: 8482, SEQ ID NO: 8372, SEQ ID NO: 8371, SEQ ID NO: 8370, SEQ ID NO: 8367, SEQ ID NO: 8366, SEQ ID NO: 8365, SEQ ID NO: 8219, SEQ ID NO: 8218, SEQ ID NO: 8152, SEQ ID NO: 8147, SEQ ID NO: 8145, SEQ ID NO: 7397, SEQ ID NO: 7396, SEQ ID NO: 7395, SEQ ID NO: 7108, SEQ ID NO: 7107, SEQ ID NO: 7106, SEQ ID NO: 6633, SEQ ID NO: 6631, SEQ ID NO: 6622, SEQ ID NO: 6619, SEQ ID NO: 6609, SEQ ID NO: 6608, SEQ ID NO: 6568, SEQ ID NO: 6561 or SEQ ID NO: 6560.” PNG media_image7.png 104 392 media_image7.png Greyscale Wherein SEQ ID NO: 8147 of the ‘649 patent is identical to a sequence that can hybridize SEQ ID NO: 106. Accordingly, claim 1 of the ‘649 patent anticipates instant claim(s) 7-9, and claim 2 of the ‘649 patent anticipates instant claim 1. Conclusion No claims allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /L.M.T./Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jul 26, 2023
Application Filed
Jun 16, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
99%
With Interview (+100.0%)
3y 5m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month