Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Priority
This Application is a national phase application filed under 35 U.S.C. § 371 claiming priority to International Application No. PCT/SG2022/050031, filed on January 24, 2022, which claims priority to foreign Application No. SG10202101092X, filed on February 2, 2021 that is hereby acknowledged by the Examiner.
Status of the Claims
The amendment dated 08/02/2023 is acknowledged. Claims 1-4,6,9-10,12-14 and 16-25 and under examination.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 12/03/2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement(s) is/are being considered by the Examiner.
Claim Objections
Claims 1-2, 9, 14, 18 and 20-23 are objected to for the following informalities:
Claims 1-2, 9, 18, 20-23 recite “signalling”. The term should be spelled “signaling” to be consistent in matters of form.
Claim 14 requires a period at the end of the sentence.
Claim 14 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Claim 22 recites “any one of the previous claims”. The claim should recite “any one of the preceding claims”.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1 and 25 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Regarding claim 1, the phrase "for example" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Regarding claim 25, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-4, 6, 9-10, 12-13 and 16-25 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shao et al. “Shao” (WO2020/009660 A1, publication date January 9, 2020, IDS of record filed 12/03/2024).
The claims are directed to A method of detecting target polynucleotides in a sample, comprising the steps of: (a) providing a sample comprising polynucleotides; (b) providing a composition comprising at least one DNA polymerase enzyme, at least one enhancer, and at least one DNA polymerase inhibitor, wherein; i) the enhancer is a polynucleotide comprising a sequence that is complementary to a target
polynucleotide sequence; ii) the DNA polymerase inhibitor is a polynucleotide comprising a conserved region and a variable region, wherein the conserved region is recognized and bound by the DNA polymerase enzyme, and the variable region is complementary to a portion of the enhancer; iii) complementary sequences of the variable region of the inhibitor and enhancer form a duplexed inhibitory DNA complex which inhibits DNA polymerase activity; iv) the composition comprises an amount of inhibitory complex that has been determined to have the fastest response and/or highest signal-to-noise ratio, for example by using first derivative of a titration curve of inhibitory complex v polymerase activity and/or by using first derivative of a titration curve of ratios of enhancer:inhibitor; (c) contacting the sample comprising nucleic acid with the composition of (b), wherein target polynucleotide binding to:
(i) the enhancer sequence region of the duplex in (b) displaces the inhibitor, thereby releasing and activating the DNA polymerase; (d) providing a signaling nanostructure that is reactive to active DNA polymerase enzyme from step (c); (e) contacting the signaling nanostructure with active DNA polymerase enzyme from step (c); (f) detecting signal development, wherein a change in the intensity of signal indicates the presence of target nucleic acid in the sample when using composition (b ).
Regarding claims 1, 18 and 21, Shao discloses “methods and devices for specific detection of nucleic acids using an integrated circuit of two independent enzyme-DNA nanostructures - an easily adjustable recognition element and a sensitive universal signaling element - to decouple target recognition and visual signal amplification. The recognition element comprises a DNA polymerase enzyme, a DNA polymerase enzyme-specific DNA aptamer and an inverter oligonucleotide. In the presence of a target nucleic acid, the inverter oligonucleotide binds to the target nucleic acid and releases the DNA polymerase enzyme from inhibition by the DNA aptamer. The activated DNA polymerase enzyme is then contacted with a signaling nanostructure comprising a self-priming portion responsive to the DNA polymerase enzyme, in the presence of labelled dNTPs and signal development reagents, wherein the activated DNA polymerase enzyme would add the labelled dNTPs to the self-priming portion, followed by the binding of the signal development reagents to the labelled dNTPs” (Abstract). Shao discloses steps a thru f (instant claim 1, see Figures 1, 3, 6, 7 and claims 1-32 of Shao). Shao also discloses a device comprising the above composition b) at a first location, signaling nanostructure attached at a second location, and an intermediate stage for mixing of said detection nanostructures with sample nucleic acid to release active enzyme to said second location, as well as a nucleic acid detection kit thereof (instant claims 1, 18 and 21, claims 27-32 of Shao).
Regarding claim 2, Shao discloses i) a self-priming portion responsive to the DNA polymerase enzyme and ii) a self-priming exonuclease dumbbell nanostructure responsive to DNA polymerase enzyme exonuclease activity (see claim 1, steps (e)-(g) of Shao).
Regarding claim 3, Shao discloses the step of: (g) diagnosing the patient with the disease when presence of target nucleic acid in the sample is detected (see claim2 of Shao).
Regarding claim 4, wherein the DNA polymerase inhibitor conserved sequence region comprises the nucleic acid sequence set forth in SEQ ID NO: 14; 5'-CAATGTACAGTATTG-3 (see claim 3, SEQ ID NO: 153 of Shao).
Regarding claim 6, Shao discloses wherein the enhancer is at least one nucleotide longer than the inhibitor duplex region; and/or wherein the enhancer is about 35 to 45 nucleotides in length; and/or wherein about half of the length of the enhancer oligonucleotide forms the inhibitor-enhancer duplex and about half forms an overhang segment (see claims 4-6 of Shao).
Regarding claim 9, Shao discloses wherein the signaling nanostructure in d) comprises: i) a self-priming portion comprising the nucleic acid sequence set forth in SEQ ID NO: 5: 5' - CGGCGTACGTAGAGCGTTGAGCAGGATGCCAACAGTCGATCAGGACGAGTGCTAACG CATTGTCGATAGCTCAGCTGTCTGAGCTATCGACAATGCGTT-3'; or ii) a self-priming exonuclease dumbbell nanostructure comprising the nucleic acid sequence set forth in SEQ ID NO: 6: 5'-GTGCGTACATAGATCGTTATCTGTCTAACGATCTATGTACGCACTCACTCAGCTAACGCATTGTCGATAGCTCAGCTGTCTGAGCTATCGACAATGCGTT-3' (see Table 1, claim 10, self-priming template of SEQ ID NO: 5 of Shao).
Regarding claims 10 and 12-13, Shao discloses wherein the dNTP label is biotin; and/or wherein the signal development reagents comprise a fusion protein comprising avidin or a derivative thereof and an enzyme, selected from a group comprising but not limited to HRP, betalactamase, amylase, beta-galactosidase, and respective substrates selected from a group comprising but not limited to DAB, TMB. ABTS, ADHP, nitrocefin, luminol, starch and iodine, wherein signals can be measured and quantified as but not limited to color, fluorescence, luminescence or electrochemical changes; wherein the
target is at least one nucleic acid associated with a non-human or human disease, genetic variants, forensic, strain identification, environmental and/or food contamination; and wherein the target is at least one pathogen polynucleotide (see claims 11-14 of Shao).
Regarding claims 16 and 17, Shao discloses the method is performed in a multi-well format, a microfluidic device or lateral flow device; and wherein the steps are performed in the range from 16 °C to 40 °C, or at room temperature (see claims 20-21 of Shao).
Regarding claim 19, Shao discloses a multi-well plate, a microfluidic device and a lateral flow device (see claim 25 of Shao).
Regarding claim 20, Shao discloses the microfluidic device comprises (i) an inlet at a first location, (ii) a detection chamber, and (iii) valves between said first and second locations to control flow of sample and reagents (see Figures 6-7 of Shao).
Regarding claims 22-25, Shao discloses said composition and said signaling nanostructure are as defined according to any one of the previous claims, configured int a device (i) – (iii), wherein at least one of the inhibitor polynucleotides and/or enhancer polynucleotides is structurally and/or chemically modified from its natural nucleic acid; and wherein said structural and/or chemical modification is selected from the group comprising the addition of tags, such as fluorescent tags, radioactive tags, biotin, a 5' tail, the addition of phosphorothioate (PS) bonds, 2'-O-Methyl modifications and/or phosphoramidite C3 Spacers during synthesis (see claims 28-31 of Shao).
Therefore, the cited prior art anticipates the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 4, 6, 9-10, 12-13, 16-22 and 24-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 9-13, 19-20, 23-29 of U.S. Patent No. 12404542 “’542”. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims are coextensive in scope and species with one another.
The claims of the present invention are directed to a method of detecting target polynucleotides in a sample, comprising the steps of: (a) providing a sample comprising polynucleotides;
(b) providing a composition comprising at least one DNA polymerase enzyme, at least one
enhancer, and at least one DNA polymerase inhibitor, wherein;
i) the enhancer is a polynucleotide comprising a sequence that is complementary to a target
polynucleotide sequence;
ii) the DNA polymerase inhibitor is a polynucleotide comprising a conserved region and a
variable region, wherein the conserved region is recognized and bound by the DNA
polymerase enzyme, and the variable region is complementary to a portion of the enhancer;
iii) complementary sequences of the variable region of the inhibitor and enhancer form a
duplexed inhibitory DNA complex which inhibits DNA polymerase activity;
iv) the composition comprises an amount of inhibitory complex that has been determined to
have the fastest response and/or highest signal-to-noise ratio, for example by using first
derivative of a titration curve of inhibitory complex v polymerase activity and/or by using
first derivative of a titration curve of ratios of enhancer: inhibitor;
(c) contacting the sample comprising nucleic acid with the composition of (b), wherein target
polynucleotide binding to:
(i) the enhancer sequence region of the duplex in (b) displaces the inhibitor, thereby
releasing and activating the DNA polymerase;
(d) providing a signaling nanostructure that is reactive to active DNA polymerase enzyme
from step (c);
(e) contacting the signaling nanostructure with active DNA polymerase enzyme from step (c);
(f) detecting signal development, wherein a change in the intensity of signal indicates the
presence of target nucleic acid in the sample when using composition (b ).
The patented claims are directed to:
1. A method of detecting target nucleic acids in a sample, comprising the steps of:
(a) providing a sample comprising nucleic acid;
(b) providing a composition comprising at least one DNA polymerase enzyme and at least one recognition nanostructure, wherein the recognition nanostructure comprises a DNA polymerase enzyme-specific DNA aptamer having a conserved sequence region and a variable sequence region, wherein the variable sequence region comprises an overhang segment which is at least 10 nucleotides complementary to a target nucleic acid in the sample; or
(c) providing a composition comprising at least one DNA polymerase enzyme and at least one recognition nanostructure, wherein the recognition nanostructure comprises a DNA polymerase enzyme-specific DNA aptamer and an inverter oligonucleotide, wherein the aptamer has a conserved sequence region and a variable sequence region, wherein the variable sequence region comprises an overhang segment which is at least 10 nucleotides complementary to, and forms a duplex with, a portion of the inverter oligonucleotide, wherein the inverter oligonucleotide is at least one nucleotide longer than the aptamer-inverter duplex and has more than 10 nucleotides complementary to a target nucleic acid in the sample;
(d) contacting the sample comprising nucleic acid with the composition of (b) or (c), wherein target nucleic acid binding to:
(i) the variable sequence region of the aptamer in (b) promotes the formation of a stable aptamer-DNA polymerase enzyme complex, thereby inhibiting DNA polymerase enzyme activity; or
(ii) the inverter oligonucleotide in (c) destabilizes the recognition nanostructure, thereby releasing the DNA polymerase enzyme from inhibition by the DNA aptamer;
(e) providing a signaling nanostructure that is reactive to active DNA polymerase enzyme from step (d), wherein the signaling nanostructure comprises a self-priming portion responsive to the DNA polymerase enzyme;
(f) contacting the signaling nanostructure with active DNA polymerase enzyme from step (d) in the presence of labelled oligonucleotides (dNTPs) and signal development reagents, wherein the activated DNA polymerase enzyme adds labelled oligonucleotides to the signaling nanostructure and the signal development reagents bind to the labelled oligonucleotides incorporated into the self-primed portion;
(g) detecting signal development, wherein the intensity of signal indicates;
(i) absence of target nucleic acid in the sample when using composition (b); or
(ii) the presence of target nucleic acid in the sample when using composition (c) (instant claim 1).
2. The method according to claim 1, wherein the DNA aptamer conserved sequence region comprises the nucleic acid sequence set forth in 5′-CAATGTACAGTATTG-3′ (SEQ ID NO: 153) (instant claim 4).
3. The method according to claim 1, wherein the inverter oligonucleotide is at least one nucleotide longer than the aptamer duplex region (instant claim 6).
4. The method according to claim 3, wherein the inverter oligonucleotide is about 35 to 45, preferably about 40, nucleotides in length (instant claim 6).
5. The method according to claim 1, wherein about half of the length of the inverter oligonucleotide forms the aptamer-inverter duplex and about half forms an overhang segment (instant claim 6).
9. The method according to claim 1, wherein the self-priming portion of the signaling nanostructure comprises the nucleic acid sequence set forth in SEQ ID NO: 5 (instant claim 9, note: SEQ ID NO:5 of patent ‘542 encompasses SEQ ID NO: 5 of instant claim 9).
10. The method according to claim 1, wherein the dNTP label is biotin (instant claim 10).
11. The method according to claim 1, wherein the signal development reagents comprise a fusion protein comprising avidin or a derivative thereof and an enzyme, selected from a group comprising but not limited to HRP, beta-lactamase, amylase, beta-galactosidase, and respective substrates selected from a group comprising but not limited to DAB, TMB, ABTS, nitrocefin, luminol, starch and iodine, wherein signals can be measured and quantified as but not limited to colour, fluorescence, luminescence or electrochemical changes (instant claim 10).
12. The method according to claim 1, wherein the target is at least one nucleic acid associated with a non-human or human disease, genetic variants, forensic, strain identification, environmental and/or food contamination (instant claim 12).
13. The method according to claim 1, wherein the target is at least one pathogen nucleic acid (instant claim 13).
19. The method according to claim 17 or 18, wherein the detection and signaling nanostructures are attached to a microfluidic device or lateral flow device (instant claim 16).
20. The method according to claim 1, wherein the steps d) to g), preferably steps a) to g), are performed at a temperature in the range from 16° C. to 40° C., preferably at ambient temperature (instant claim 17).
23. A device comprising:
(i) the composition of (b) or (c) of claim 1 comprising at least one DNA polymerase enzyme and at least one recognition nanostructure at a 1st location;
(ii) signaling nanostructures comprising a self-priming portion responsive to active DNA polymerase enzyme attached at a 2nd location; and
(iii) an intermediate stage for mixing of said detection nanostructures with sample nucleic acid to release active enzyme to said 2nd location (instant claim 18).
24. The device of claim 23, selected from a group comprising a microfluidic device and a lateral flow device (instant claim 19).
25. The device of claim 23, wherein the device is a microfluidic device comprising:
(i) a common signaling cartridge configured to receive one or more assay cassettes, wherein the cartridge comprises a base with membranes embedded to immobilize signaling nanostructures, and a common outlet which makes fluid connection with said 2nd location in each of the one or more assay cassettes;
(ii) one or more assay cassettes each comprising, at a 1st location, an inlet and at least one DNA polymerase enzyme and at least one recognition nanostructure; an intermediate stage microchannel in fluid connection between the 1st and 2nd locations, for mixing of said detection nanostructures with sample nucleic acid to release active enzyme to said 2nd location;
wherein, when the device is assembled and in use, there is fluidic flow from the sample inlet to the common outlet, actuated by a withdrawal septum (instant claim 20).
26. A nucleic acid detection kit comprising;
(a) a composition comprising at least one DNA polymerase enzyme and at least one recognition nanostructure, wherein the recognition nanostructure comprises a DNA polymerase enzyme-specific DNA aptamer having a conserved sequence region and a variable sequence region, wherein the variable sequence region comprises an overhang segment which is at least 10 nucleotides complementary to a target nucleic acid; and/or
(b) a composition comprising at least one DNA polymerase enzyme and at least one recognition nanostructure, wherein the recognition nanostructure comprises a DNA polymerase enzyme-specific DNA aptamer and an inverter oligonucleotide, wherein the aptamer has a conserved sequence region and a variable sequence region, wherein the variable sequence region comprises an overhang segment which is at least 10 nucleotides complementary to, and forms a duplex with, a portion of the inverter oligonucleotide, wherein the inverter oligonucleotide is at least one nucleotide longer than the aptamer-inverter duplex and has more than 10 nucleotides complementary to a target nucleic acid; and
(c) a signaling nanostructure that is reactive to active DNA polymerase enzyme, wherein the signaling nanostructure comprises a self-priming portion responsive to the DNA polymerase enzyme;
and optionally
(d) labelled nucleotides (dNTPs) and signal development reagents, wherein active DNA polymerase enzyme adds labelled nucleotides to the signaling nanostructure and the signal development reagents bind to the labelled nucleotides incorporated into the self-primed portion (instant claim 21).
27. The nucleic acid detection kit of claim 26, configured into a device according to claim 24 (instant claim 22).
28. The nucleic acid detection kit of claim 26, wherein at least one of the aptamer and/or inverter oligonucleotides is structurally and/or chemically modified from its natural nucleic acid (instant claim 24).
29. The nucleic acid detection kit of claim 28, wherein said structural and/or chemical modification is selected from the group comprising the addition of tags, such as fluorescent tags, radioactive tags, biotin, a 5′ tail, the addition of phosphorothioate (PS) bonds, 2′-O-Methyl modifications and/or phosphoramidite C3 Spacers during synthesis (instant claim 25).
There is no patentable difference between the claimed composition/methods and the patented composition/methods in that the U.S. Patent No. 12404542 discloses a method of detecting target polynucleotides in a sample comprising the steps of the instantly claimed invention. Moreover, The MPEP states “where the claimed and prior art products are identical or substantially identical in structure or composition, or are produced by identical or substantially identical processes, a prima facie case of either anticipation or obviousness has been established. In re Best, 562 F.2d 1252, 1255, 195 USPQ 430, 433 (CCPA 1977).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Barry Chestnut whose telephone number is (571)270-3546. The examiner can normally be reached on M-Th 8:00 to 4:00.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached on 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BARRY A CHESTNUT/Primary Examiner, Art Unit 1672