Prosecution Insights
Last updated: September 17, 2026
Application No. 18/275,900

Chemically Modified Small Activating RNA

Non-Final OA §101§112§DP
Filed
Aug 04, 2023
Priority
Feb 07, 2021 — CN 202110175652.9 +2 more
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ractigen Therapeutics
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
31 granted / 62 resolved
-10.0% vs TC avg
Strong +61% interview lift
Without
With
+61.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
44 currently pending
Career history
112
Total Applications
across all art units

Statute-Specific Performance

§101
8.6%
-31.4% vs TC avg
§103
27.8%
-12.2% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
30.1%
-9.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 62 resolved cases

Office Action

§101 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Notice of Non-Compliant Amendment to the Claims As noted in the prior action, claim 40 was identified with the status “Cancelled” in the amendments to the claims filed August 5, 2024. 37 CFR 1.121(c)(4) states that “Identifying the status of a claim in the claim listing as “cancelled” will constitute an instruction to cancel the claim.” Accordingly, claim 40 was cancelled as of August 5, 2024. The amendments to the claims filed July 15, 2026 improperly reinstate cancelled claim 40. 37 CFR 1.126 requires that the original numbering of the claims be preserved throughout prosecution. When new claims are presented, they must be numbered consecutively beginning with the number next following the highest numbered claims previously presented (whether entered or not). In the interest of compact prosecution, and so as to remedy the improper reinstatement of cancelled claim 40, the claims are considered hereinafter as follows: 40. (Cancelled) 41. (Currently Amended) The combined pharmaceutical composition according to claim 50[[40]], wherein the small molecule drug is Mitomycin C or Valrubicin. 50. (New) A pharmaceutical composition of combined agents, comprising the small activating RNA according to claim 1, and a small molecule drug. Application Status Applicant’s response, and amendments to the claims filed July 15, 2026 are acknowledged. Claims 1, and 27-28 were amended, and claims 25-26 were cancelled. In view of the above, claim 41 is amended, and claim 50 is introduced. Claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 48-50 are pending. Restriction/Election Applicant’s election of Group I (claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and new claim 50) in the response filed July 15, 2026 is acknowledged. Because Applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 48-49 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 are under consideration hereinafter. Priority Applicant’s priority claims to Application Nos. CN202110175652.9, PCT/CN2021/075958, and PCT/CN2022/074635 are acknowledged. Certified copies of the priority documents have been received. The effective filing date of claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 under examination is February 7, 2021. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is defective. USPTO records indicate that the size of the sequence listing is 8040 bytes, rather than “8040 kb” as indicated in the specification filed August 21, 2023. See item 1) a) or 1) b) above. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Drawings The drawings are objected to because of the following informalities: The view numbers are preceded by the term “Figure.” 37 C.F.R. 1.84(u)(1) states that “view numbers must be preceded by the abbreviation "FIG." Appropriate correction is required. Specification The specification is objected to because of the following informalities: The use of terms which are trade names or a marks used in commerce, has been noted in this application, e.g., “RNeasy,” and “Lipofectamine.” The terms should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Appropriate correction is required. Claim Objections Claims 1-2, 11, and 28 are objected to because of the following informalities: Claim 1, option (10), and claim 27, option (10) recite “six deoxynucleotides at positions 2, 3, 4, 5, 6, and 7, respectively counting from the 5’ end, respectively.” This phrase is redundant, and should preferably be amended to recite “six deoxynucleotides at positions 2, 3, 4, 5, 6, and 7, respectively counting from the 5’ end Claim 2 recites options using both letters and numbers. It would be preferable to use only letters or only numbers to recite the options. Claim 11 is clearly directed to modifications to the antisense oligonucleotide strand, but recites “modification with vinylphosphonate at 5’-end nucleotide(s) of the sense oligonucleotide strand.” Because it is clear that the claim is directed to modifications to the antisense oligonucleotide strand, the claim should be amended to recite “modification with vinylphosphonate at 5’-end nucleotide(s) of the antisense oligonucleotide strand.” Claim 28 recites “wherein the chemical modification of the sense oligonucleotide strand is that… and the chemical modification of the antisense oligonucleotide strand is that….” It would be preferable to amend the claim to recite “wherein the chemical modification of the sense oligonucleotide strand is Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites that the “two nucleotides at the 5’ end and at the 3’ end of the sense oligonucleotide strand are chemically modified nucleotides,” and then, recites “and wherein chemical modification of the sense oligonucleotide strand is selected from the group consisting of the following four patterns.” Options (3) and (4) in the grouping do not recite any chemically modified 3’ end nucleotides. This is confusing, because the phrase “chemical modification… is selected from the group consisting of…” would not be interpreted as “open” to the addition of further chemically modified nucleotides, e.g., the previously recited chemically modified 3’ end nucleotides. Because it does not appear that options (3) and (4) are compatible with the previously recited requirements of the claim, it is not clear what chemical modification is required of the sense oligonucleotide strand. Claims 2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 are rejected for depending from claim 1 and failing to remedy the indefiniteness. Regarding claim 27, specifically, the claim explicitly requires selection from one of the four options. Claim 27, therefore, is also confusing for the reasons described above, because options (3) and (4), which would not be interpreted as “open” to the addition of further chemically modified nucleotides, do not appear compatible with the previously recited requirements of the claim 1, i.e., “two nucleotides… at the 3’ end of the sense oligonucleotide strand are chemically modified nucleotides.” In the interest of compact prosecution, claim 1 will be interpreted hereinafter as encompassing a sense oligonucleotide strand wherein I) two nucleotides at the 5’ end and at the 3’ end are chemically modified nucleotides, or wherein II) chemical modification is selected from one of the four patterns, wherein the patterns are not “open” to the addition of further chemical modification. Further chemical modifications of the sense oligonucleotide strand, e.g., those recited in claim 6 which are not encompassed by options (1)-(4), will be interpreted as applying to sense oligonucleotide strand (I) above, which is interpreted as “open” to additional modification. Recitation of chemical modifications which are encompassed by one or more of options (1)-(4), e.g., “the last two phosphodiester bonds at the 3’ end of the sense oligonucleotide strand are both modified with phosphorothioate (PS)” in claim 6, will be interpreted as applying to sense oligonucleotide strand (I) above, and, reading on one or more of options (1)-(4), e.g., options (3)-(4) with respect to the quoted limitation in claim 6 above. Claim 27 will be interpreted as requiring a sense oligonucleotide strand wherein chemical modification is selected from one of the four patterns. Claims 1 and 27 recite that “the chemical modification of the antisense oligonucleotide strand is selected from the group consisting of the following ten patterns,” wherein options (5) and (7) recite “five 2’F modifications in total, at positions 1, 5, 12, 16, and 20, respectively counting from the 5’ end… and the first nucleotide from its 5’ end of which lacking 2’F modification,” and “eight 2’F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5’ end… and the first nucleotide from its 5’ end of which lacking 2’F modification.” The structural requirements of options (5) and (7) are confusing, because they first recite that a 2’F modification is required at position 1 from the 5’ end, i.e., at the “first nucleotide from its 5’ end,” and then later recite that the first nucleotide from its 5’ end “lack[s] 2’F modification.” In addition, there would no longer be five or eight 2’F modifications in total as options (5) and (7), respectively, first recite. Option (8) recites “five 2’F modifications in total, at positions 1, 5, 12, 16, and 20, respectively, counting from the 5’ end… and 2’F modification at position 17 counting from the 5’ end. Option (8) is similarly confusing, because the option first recites “five 2’F modifications in total,” and then later recites an additional 2’F modification at position 17, which is not included in the first grouping of positions requiring a 2’F modification. Should the 2’F modification at position 17 be present, there would no longer be five 2’F modifications in total. Claims 2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 are rejected for depending from claim 1 and failing to remedy the indefiniteness. Regarding claim 28, specifically, the claim also recites “eight 2’F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5’ end… and the first nucleotide from its 5’ end of which lacking 2’F modification.” This claim is also rejected for the same reasons described above. In the interest of compact prosecution, options (5) and (7) will be interpreted hereinafter as requiring four or five 2’F modifications, or seven or eight 2’F modifications, respectively, at positions 5, 12, 16, 20, and optionally position 1, or positions 3, 4, 5, 12, 16, 17, and 20, and optionally position 1, respectively. Option (8) will be interpreted hereinafter as requiring five or six 2’F modifications, at positions 1, 5, 12, 16, and 20, and optionally position 17. Claim 1, option (9), and claim 27 option (9) recite “the three deoxynucleotides at positions 2, 3, and 4.” No such deoxynucleotides are explicitly or inherently required of the previously recited chemically modified small activating RNA, which would be interpreted as an RNA, composed of ribonucleotides. The phrase “the three deoxynucleotides at positions 2, 3, and 4” lacks sufficient antecedent basis in the claims, accordingly. Claims 2, 6, 8, 10-13, 15-21, 23-24, 27-31, 33-34, 36-37, 41-42, and 50 are rejected for depending from claim 1 and failing to remedy the indefiniteness. In the interest of compact prosecution, option (9) will be interpreted hereinafter as referring to an antisense oligonucleotide strand comprising three deoxynucleotides at positions 2, 3, and 4. Claim 2 recites “wherein the chemical modification comprises: a) chemical modification of nucleotide ribose(s); b) chemical modification of inter-nucleotide phosphodiester bond(s); (3) chemical modification of nucleotide base(s); (4) inclusion of locked nucleic acid(s); or (5) modification with vinylphosphonate at 5’-end nucleotide(s).” First it is not clear to which chemical modification in claim 1 the phrase “the chemical modification” corresponds, i.e., the “chemical modification of the sense oligonucleotide strand,” or the “chemical modification of the antisense oligonucleotide strand.” The claim is made further confusing, because the phrases “chemical modification… is selected from the group consisting of…” would not be interpreted as “open” to the addition of further chemically modified nucleotides, and several of the options in claim 2, i.e., options (3), (4), and (5), do not correspond to any of the patterns from which the chemical modification of the sense oligonucleotide strand and antisense oligonucleotide strand may be selected, or appear incompatible with the previously recited patterns (e.g., option (5) of claim 2, and options (1)-(4), and (1)-(8) of claim 1, which require different modifications at 5’ end; or option (b) of claim 2, and options (1)-(2), and (1)-(3), and (9)-(10) which do not encompass chemical modification of inter-nucleotide phosphodiester bond(s)). It is not clear how the limitations of claim 2 apply to the previously recited chemical modifications recited in claim 1, and therefore, the structure of the small activating RNA encompassed by claim 2 is not clear. In the interest of compact prosecution, the options presented in claim 2 will be interpreted as applying to the sense oligonucleotide strand (I) described above (i.e., “wherein the two nucleotides at the 5’ end and at the 3’ end… are chemically modified nucleotides”), or the antisense oligonucleotide strand comprising at least one chemically modified nucleotide, which are interpreted as “open” to additional modification. Recitation of chemical modifications which are encompassed by one or more of options (1)-(4), or options (1)-(10), will be interpreted as applying to the sense and antisense oligonucleotide strands above, and, reading on one or more of options (1)-(4), or (1)-(10). Claim 13 recites the “most central 1-5 nucleotides.” The term “most” is a relative term which renders the claim indefinite. The term “most” is not defined by the claim, and the specification does not provide a standard for ascertaining the requisite degree of “most” which would allow the skilled artisan to determine which of the small activating RNA nucleotides would be considered “most” central. In the interest of compact prosecution, the claim will be interpreted hereinafter as “central 1-5 nucleotides.” Claim 16 recites “wherein the antisense oligonucleotide strand does not comprise a modification in which a ribonucleotide can be replaced by a deoxyribonucleotide (DNA).” The skilled artisan would know that an oligonucleotide comprising virtually any known nucleotide (RNA, DNA, or chemically modified versions thereof) could be synthesized. It is not clear what modifications are excluded by the claim, because it is not clear what modifications could/could not be replaced by a deoxyribonucleotide based on either the prior art, or the specification, which is silent as to modifications which could/could not be replaced by a deoxyribonucleotide. In the interest of compact prosecution, the claim will be interpreted hereinafter as requiring an antisense oligonucleotide strand which does not comprise a deoxyribonucleotide. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 30, 34, 36-37, and 42 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 30 recites that the “small activating RNA specifically targets the promoter region of the p21 gene.” Claim 29 recites that “the target gene comprises human p21WAF1/CIP1 gene (P21 gene),” and claim 1 recites that “the sense oligonucleotide strand or the antisense oligonucleotide strand is at least 75% homologous or complementary to the promoter sequence of a target gene.” The specification describes that targeting a small activating RNA to a target gene promoter is achieved by homology or complementarity thereto (pg. 26, lines 4-24; pg. 27, lines 26-29; pg. 28, lines 18-20; pg. 30, lines 1-7). Thus, the small activating RNA of claim 29 already specifically targets the promoter region of the p21 gene. Claim 30 fails to further limit the subject matter of the claim upon which it depends. Claims 34, 36-37, and 42 recite a “nucleic acid molecule comprising a fragment encoding the small activating RNA according to claim 1.” The claim substitutes the small activating RNA according to claim 1, which comprises various chemical modifications, for a nucleic acid molecule comprising a fragment encoding the small activating RNA (i.e., DNA or RNA nucleotides). Such a nucleic acid molecule would no longer comprise the chemical modifications, and, in the case of DNA-based nucleic acid molecules, the RNA nucleotides of the small activating RNA recited in claim 1. Thus, claims 34, 36-37, and 42 fail to include all the limitations of the claim upon which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-31, 34, 36-37, 41-42, and 48-50 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A3.(a).(i) states the following: “The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus.” “Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).” Species Encompassed Claims 1-2, 6, 8, 10-13, 15-21, 23-24, 27-30, 34, 36-37, 41-42, and 48-50 encompass a chemically modified small activating RNA, which is interpreted as a “nucleic acid molecule that can facilitate gene expression” (pg. 29, lines 14-15), and comprises a sense and antisense oligonucleotide strand, wherein the sense and antisense strand are at least 75% homologous (understood to be interchangeable with “identical” based on the specification, pg. 28, lines 18-20), or complementary to the promoter sequence of a target gene (pg. 28, lines 21-27). In view of the indefiniteness described above, the claims are interpreted as encompassing a sense oligonucleotide strand wherein I) two nucleotides at the 5’ end and at the 3’ end are chemically modified nucleotides, or wherein II) chemical modification is selected from one of the four patterns, wherein the patterns are not “open” to the addition of further chemical modification, and an antisense strand comprising I) at least one chemically modified nucleotide, or wherein II) chemical modification is selected from one of the ten patterns, wherein the patterns are not “open” to the addition of further chemical modification. Further chemical modifications of the sense and antisense oligonucleotide strand are interpreted as applying to sense or antisense oligonucleotide strands (I) above, which are interpreted as “open” to additional modification. Recitation of chemical modifications which are encompassed by one or more of options (1)-(4) or (1)-(10) are interpreted as applying to sense or antisense oligonucleotide strand (I) above, and, reading on one or more of options (1)-(4) or (1)-(10). The claims encompass a vast genus of small activating RNA, comprising virtually any sense and antisense strand sequence of any length, targeting any promoter sequence of a target gene, including human p21 (see claims 29-30) and comprising nearly unlimited chemical modifications and patterns, e.g., 2’F, LNA, vinylphosphonate, 2’OMe, PS, boranophosphate, and deoxynucleotides, conjugates (see claim 20), and mismatches and overhangs (see claims 21, 24). The specification has not sufficiently described the species of small activating RNA which have the function of “facilitat[ing] gene expression” for the reasons that follow. Species Described in the Specification The specification describes 35 small activating RNAs targeting a specific region of the human p21 gene promoter sequence. The small activating RNAs comprise one of the following sense strand sequences, SEQ ID NO: 5, 14-17, or 24, in a specific combination with one of the following antisense strand sequences, SEQ ID NOs: 6-13, 18-19, or 25. See Table 2, pg. 34-36. Notably, all sense strand sequences have the same nucleobase sequence, antisense strand sequences corresponding to SEQ ID NOs: 6-12, and 25 have the same nucleobase sequence, whereas antisense strand sequences corresponding to SEQ ID NOs: 13, and 18-19 comprise one or two “T” instead of “U.” The groups of sense and antisense strand sequences differ in their combination of 2’OMe, 2’F, and phosphorothioate composition. Based on Figs. 7 and 11-12, each of the small activating RNAs facilitates gene expression of p21. The specification does not describe all combinations of the aforementioned SEQ ID NOs; for example, the specification does not describe the combination of SEQ ID NO: 17 with any of SEQ ID NOs: 6-13, or 25, or the combination of SEQ ID NOs: 18-19, with any of SEQ ID NOs: 5, 14-16, or 24. It is not evident that any sense strand sequence is compatible with any antisense strand sequence in Table 2. The specification also does not describe any small activating RNAs targeting different regions of the human p21 gene promoter sequence, or any other gene promoter sequences. The specification does not describe any small activating RNAs with other sense or antisense strand nucleobase sequences, and therefore, does not describe any small activating RNAs with different numbers of or positions of mismatches or overhangs. The specification does not describe any small activating RNAs with other chemical modifications or chemical modification patterns, e.g., small activating RNAs comprising LNA, vinylphosphonate, boranophosphate, etc. The specification also does not provide any guidance to determine which of the vast combinations of sense and antisense strand sequences and chemical modifications applied thereto would facilitate gene expression when targeting the unlimited promoter sequences encompassed by the claim. Taken together, the specification describes a very small number of highly similar species, out of the vast space of RNAs comprising a sense and antisense strand and chemical modifications applied thereto, which may have the function of “facilitating gene expression.” Guidance in the Prior Art The closest prior art to the instant claims is Kang (Kang et al., 2012, Cancer Research, 72(19); 5069-5079 and Supplemental Information), Li (Li et al., WO 2019/196887 A1, published 17 October 2019, and English translation in Appendix I), and Wang (Wang et al., 2013, Journal of Cancer Research and Therapeutics, Vol. 9, Issue 1, pg. 54-59). Kang describes small activating RNAs (“dsP21-322-2’F” and “dsP21-322-2’F-FITC”) which target the human p21 gene promoter sequence and activate p21 expression (“dsP21-322 induces p21 expression in human bladder cancer cells,” pg. 5071). The small activating RNAs comprise a sense strand substantially identical to the nucleobase sequence of instant SEQ ID NOs: 5, 14-17, and 24 and an antisense strand substantially identical to the nucleobase sequence of instant SEQ ID NOs: 6-12, and 25, wherein the differences are bolded in Fig. A below. See Table S1, a portion of which is copied below in Fig. A. As shown in Fig. A, the antisense strand comprises eight 2’F modifications, at positions 1, 3, 4, 5, 12, 16, and 17 relative to the 5’ end of the strand. Kang does not describe any chemical modifications to the sense strand of the small activating RNA, or any linkage modifications. FIGURE A. CCAACUCAUUCUCCAAGUAdTdT CCAACUCAUUCUCCAAGUC SEQ ID NOs: 5, 14-17, and 24 UACUUGGAGAAUGAGUUGGdTdT-HypC6-FITC UACUUGGAGAAUGAGUUGGCA SEQ ID NOs: 6-12, and 25 PNG media_image1.png 221 775 media_image1.png Greyscale Kang, while teaching that the 2’F modifications “significantly increased duplex stability” compared to unmodified small activating RNA (pg. 5073, left col.), without negatively impacting small activating RNA activity (pg. 5071, right col.), does not provide any guidance to determine which of the many possible chemical modifications to the sense and antisense strand of the p21 gene promoter-targeting small activating RNA, and at which positions of the sense and antisense strand, would preserve activity or improve duplex stability. Kang also does not appear to provide any guidance to determine which of the virtually unlimited sequences of sense and antisense strands, targeting the unlimited promoter sequences encompassed by the claims, would produce a functional small activating RNA, let alone determine which chemical modification(s) would preserve activity or improve duplex stability. Li describes several similar p21 gene promoter-targeting small activating RNAs to Li, including “Rag1-40,” which comprises a sense strand 100% identical to the nucleobase sequence of SEQ ID NOs: 5, 14-17, and 24, and an antisense strand 100% identical to the nucleobase sequence of instant SEQ ID NOs: 6-12, and 25. See Fig. 13 of Li, the portion of which including Rag1-40 is copied below in Fig. B. As shown in Fig. B, below, Rag1-40 of Li comprises a mismatched “C” at the 3’ end of the sense strand relative to the antisense strand, and the antisense strand comprises an overhang relative to the sense strand, which consists of 5’-CA-3’. FIGURE B. CCAACUCAUUCUCCAAGUC CCAACUCAUUCUCCAAGUC SEQ ID NOs: 5, 14-17, and 24 UACUUGGAGAAUGAGUUGGCA UACUUGGAGAAUGAGUUGGCA SEQ ID NOs: 6-12, and 25 PNG media_image2.png 73 276 media_image2.png Greyscale Li is silent as to any modifications of the small activating RNA, and does not provide any guidance to determine which of the many possible chemical modifications to the sense and antisense strand of the p21 gene promoter-targeting small activating RNA, and at which positions of the sense and antisense strand, would preserve activity or improve duplex stability. Li also does not appear to provide any guidance to determine which of the virtually unlimited sequences of sense and antisense strands, targeting the unlimited promoter sequences encompassed by the claims, would produce a functional small activating RNA, let alone determine which chemical modification(s) would preserve activity or improve duplex stability. Based on Figs. 13 and 16 of Li, the skilled artisan would conclude that small activating RNA design is unpredictable; several designed small activating RNAs do not facilitate gene expression despite differing by only a few nucleotides relative to functional small activating RNAs. Wang teaches a substantially identical small activating RNA to Kang and Li, wherein the sense strand comprises 2’F modifications (Fig. 1c). Thus, it was known that 2’F modifications were tolerated in the sense strand of a p21 gene promoter-targeting small activating RNA. However, Wang is similarly deficient with respect to guidance as to the antisense and sense strand sequences, and chemical modifications applied thereto which would result in a functional small activating RNA targeting the unlimited promoter sequences encompassed by the claims. In general, means to prepare sense and antisense sequences identical to and complementary to a target gene promoter sequence were available to the skilled artisan. Oligonucleotides comprising various chemical modifications, including phosphorothioate, 2’OMe, LNA, vinylphosphonate, etc., in various combinations, were also well known in the prior art, particularly, with respect to oligonucleotides which inactivate gene expression, e.g., siRNAs. The prior art also generally describes various modifications to small activating RNAs which are useful for their stabilization. See Regents (Li et al., US 9,297,008 B2, published 29 March 2016; col. 11-13, col. 16, col. 20-21). However, it is not apparent that the skilled artisan would have had sufficient guidance to determine which species in the vast space of RNAs comprising a sense and antisense strand and chemical modifications applied thereto, would produce a functional small activating RNA targeting the unlimited promoter sequences encompassed by the claims. Indeed, Yoon (Yoon and Rossi, 2018, Current Pharmaceutical Biotechnology, 19, pg. 604-610) makes clear that “design of saRNAs on gene promoters is largely a hit-or miss process” (pg. 604, left col.). This is corroborated by Laham-Karam (Laham-Karam et al., 2017, Antioxidants & Redox Signaling, Vol. 29, No. 9, pg. 813-831), which teaches that “mystery still exists regarding the promoter areas that can be targeted by saRNA… not all saRNAs that have been designed have demonstrated activity in regulating gene promoters” (pg. 815-816). Laham-Karam teaches that algorithms to predict suitable promoter sites “have at best reported 50% success” (pg. 816, left col.). Laham-Karam teaches that in addition, “the actual sequence and chemical properties of the saRNA are also an important consideration,” and reports that although there are some similarities to siRNA design, “this is by far not absolute,” which suggests that the skilled artisan cannot simply transfer siRNA sequence and chemical design choices to small activating RNAs with a reasonable expectation of success. Laham-Karam provides some guidelines regarding saRNA design, for example, that “mismatches are often not tolerated in saRNA,” and that “modifications… have not been tolerated on the 5’ guide strand of saRNA” (pg. 816, right col.). However, these guidelines appear to contradict with the designs of effective saRNA designs of Kang, Li, and Wang, suggesting that there is substantial unpredictability as to which sequence and chemical modification design choices will result in a functional saRNA. Taken together, considering the large variation in the genus (i.e., any sense and antisense sequence, targeting any promoter sequence, with virtually any combination of chemical modifications), the small percentage of species described in the specification, and the lack of predictability provided by the specification or prior art for the full scope of the claimed genus, it is reasonable to conclude that Applicant did not possess the invention as claimed at the time of filing. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 36 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 36 recites a “cell comprising the small activating RNA according to claim 1….” Neither the specification nor claim expressly exclude cells within a human organism. The specification describes human cells (at least pg. 30, line 24) and subjects to which the small activating RNA is administered (pg. 25). The term “cell,” therefore, could reasonably be interpreted as encompassing a cell within a human organism, which is non-statutory subject matter. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Application No. 18/275,907 Claims 1-2, 6, 8, 10-13, 15-16, 18-21, 23, 29-30, 34, 36-37, and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5-8, 10-15, 17, 19, and 20 of co-pending Application No. 18/275,907. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Co-pending claim 1 recites a “small activating nucleic acid molecule… wherein the first oligonucleotide strand and the second oligonucleotide strand are shown in the following sequences: (1) SEQ ID NO: 498 and SEQ ID NO: 499; (2) SEQ ID NO: 498 and SEQ ID NO: 500; (3) SEQ ID NO: 501 and SEQ ID NO: 499; and (4) SEQ ID NO: 501 and SEQ ID NO: 500. Based on the sequence listing and Table 4 of the co-pending application (pg. 36), the co-pending small activating nucleic acid molecule is a species of the small activating RNA molecule recited in instant claims 1-2, 6, 8, 10-13, 15-16, 18-19, 21, 23, and 29-30. The co-pending claims anticipate instant claims 1-2, 6, 8, 10-13, 15-16, 18-19, 21, 23, and 29-30. Co-pending claims 13-14 anticipate instant claim 20. Co-pending claims 17, and 19-20 anticipate instant claims 34, 36-37, and 42. Claims 41 and 50 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5-8, 10-15, 17, 19, and 20 of co-pending Application No. 18/275,907 in view of Regents (Li et al., US 9,297,008 B2, published 29 March 2016. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The co-pending claims do not teach a pharmaceutical composition of combined agents, comprising the small activating RNA and a small molecule drug, wherein the small molecule drug is Mitomycin C. However, Regents teaches substantially identical small activating RNA molecules to those of the co-pending claims, as well as pharmaceutical compositions of combined agents, comprising the small activating RNA and a small molecule drug, wherein the drug is Mitomycin C (col. 28, lines 9-34; col. 30, which describes p21 gene promoter-targeting small activating RNAs). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the pharmaceutical composition of the co-pending claims with a small molecule drug, wherein the small molecule drug is Mitomycin C in view of Regents. It would have amounted to a simple combination of known elements in a pharmaceutical composition, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the pharmaceutical composition of the co-pending claims with Mitomycin C, and would have been motivated to do so in an effort to use the small activating RNAs for various in vitro and in vivo applications, because the co-pending claims and Regents teach substantially identical small activating RNAs, which Regents teaches are combinable in pharmaceutical compositions with Mitomycin C. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Aug 04, 2023
Application Filed
Sep 02, 2026
Non-Final Rejection mailed — §101, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12686866
METHODS OF CANCER TREATMENT
5y 1m to grant Granted Jul 21, 2026
Patent 12674161
STAT3 TARGETING OLIGONUCLEOTIDES AND USES THEREOF
1y 1m to grant Granted Jul 07, 2026
Patent 12668800
METHODS AND COMPOSITIONS FOR TARGETED TRANS-SPLICING
1y 7m to grant Granted Jun 30, 2026
Patent 12655424
METHODS AND COMPOSITIONS FOR TRANS-SPLICING UTILIZING SMALL NUCLEAR RNAS AND SMALL NUCLEOLAR RNAS
1y 7m to grant Granted Jun 16, 2026
Patent 12644148
IN VITRO DETECTION OF NUCLEIC ACID
5y 3m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
99%
With Interview (+61.2%)
3y 7m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 62 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month