DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of Group I (claims 1,5-8,10-15,17,19 and 20) and as Species RAG1-0M4, which comprises SEQ ID NO: 498 and 499 in the reply filed on 07/30/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claim 25 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/30/2026.
Claims 1,5-8,10-15,17,19 and 20 are under examination.
Priority
This application is a 371 of PCT/CN2022/074637, filed 01/28/2022, and claims foreign priority to CN202110175652.9, filed 02/07/2021.
Drawings
The drawings are objected to because all figures use “Fig.” rather than “FIG.”. In addition, the figures with different views, for example Fig. 2, separately label each view with A or B rather than “FIG. 2A” and “FIG. 2B”. This applies to Figures 2-4,7,8,10,12,15-17,20-23. See 37 CFR 1.84(u).
(u) Numbering of views.
(1) The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation "FIG."
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because of the following informalities: The use of the terms which are trade names or marks used in commerce, has been noted in this application, e.g., “RNeasy”. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Appropriate correction is required.
Claim Objections
Claim 14 is objected to because of the following informalities: The chemical structures of (A),(B), and (C) are not completely clear and legible. Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 19 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 19 recites “A cell, wherein the cell comprises the small activating nucleic acid molecule according to claim 1…”. Neither the specification nor claim expressly exclude cells within a human organism. The specification describes human cells (at least pg. 20) and that the cells may include mammalian cells, such as cells from the human body, and in embodiments the cells may be present in mammals, such as the human body (page 21). The term “cell” therefore could reasonably be interpreted as encompassing a cell within a human organism, which is non-statutory subject matter.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 10-12 and 17 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 10 depends on claim 1, claim 11 depends on claim 10, and claim 12 depends on claim 11. Claim 1 has been amended to recite specific oligonucleotide sequences of the first and second oligonucleotide strands. These claimed sequences already have specific chemical modifications at specific positions per the sequence listing for SEQ ID NOs: 498 and 499 as well as Table 4 of the instant specification. See below.
PNG
media_image1.png
89
717
media_image1.png
Greyscale
PNG
media_image2.png
243
702
media_image2.png
Greyscale
Therefore, claim 1 already requires that the sequences have phosphorothioate linkages, 2’-F modifications, and 2’-OMe modifications at specific nucleotide positions, and therefore, claims 10-12 do not further limit the subject matter of the claims upon which they depend.
Claim 17 recites “a nucleic acid molecule, comprising a segment encoding the small activating nucleic acid molecule according to claim 1” and therefore still recites a nucleic acid molecule which is what was recited in claim 1 (a small activating nucleic acid molecule), and does not recite a further limitation of the small activating nucleic acid molecule.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1,5-8,10-13,15,17,19 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Li et al. #1 (machine translation of WO2016145608, Published 22 Sept 2016) in view of Li et al. #2 (US 20100210707, Published 19 Aug 2010) and Maier et al. (US 20170275626, Published 28 Sept 2017).
Claim Interpretation: The examiner has included the elected sequences from Table 4, page 36 below for reference.
PNG
media_image1.png
89
717
media_image1.png
Greyscale
PNG
media_image2.png
243
702
media_image2.png
Greyscale
Regarding claims 1,5 and 17, Li et al. #1 teach small activating RNA (saRNA) which is a double-stranded molecule, its first and second strands form double-stranded complementary strand at the 3 'end of the two chains with at least two prominent bases (page 1) and provides a dsaRNA (Dicer substrate saRNA) design method to increase the efficiency of RNA activation (Summary, page 2, first paragraph). Li et al. #1 teach the target gene is a human gene dsRNA of p21 (page 2). Li et al. #1 teach the p21 gene is an important negative regulator of cell cycle genes and to evaluate the impact of the p21dsaRNA on the growth of tumor cells with p21 dsaRNA was transfected into PC-3 cells and resulted in reduced PC-3 cell viability as the dsaRNA promoted p21 gene expression associated with this ability (Example 1). Li et al. #1 teach design of saRNA for the p21 gene promoter target sites, including dsP21-6a (sense sequence of SEQ ID NO: 40 UGCCAACUCAUUCUCCAAGUAAA, the antisense sequence is: SEQ ID NO: 41 UACUUGGAGAAUGAGUUGGCACT) (See Example 2).
The p21 specific sense dsaRNA of SEQ ID NO: 40 of Li et al. #1 (Db) has 100% identity to the first oligonucleotide strand of instant SEQ ID NO: 498 (Qy) shown in the alignment below:
PNG
media_image3.png
179
583
media_image3.png
Greyscale
The p21 specific antisense dsaRNA of SEQ ID NO: 41 of Li et al. #1 (Db) has 100% identity to the second oligonucleotide strand of instant SEQ ID NO: 499 (Qy) shown in the alignment below:
PNG
media_image4.png
164
570
media_image4.png
Greyscale
Li et al. #1 teach results show that dsP21-6a activates the expression of p21 (See Figure 6 below).
PNG
media_image5.png
301
345
media_image5.png
Greyscale
Li et al. #1 do not teach the specific chemical modifications at the recited positions required by SEQ ID NOs: 498 and 499 as shown above in the claim interpretation section.
Before the effective filing date, Li et al. #2 also taught the need for compounds that can activate gene expression for the study and treatment of genetic disorders (paragraph 0006), and taught compositions, pharmaceutical preparations, kits and methods for increasing expression of a gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a non-coding nucleic acid sequence of the gene (paragraphs 0008,0034). Li et al. #2 also teach saRNA molecules can be provided as a double-stranded molecule, with a second strand complementary to the first strand and forming a duplex region with the first strand, usually with at least a two residue overhang at the 3′ ends of each of the first and second strands, or can be provided as a single stranded molecule that forms a double-stranded region, wherein the first region comprising a ribonucleotide sequence complementary to a non-coding nucleic acid sequence of the gene, and a second region comprises a ribonucleotide sequence complementary to the first region and forming a duplex region with the first region, usually with at least a two residue overhang at the 3′ ends of the strand (paragraph 0084). Li et al. #2 also teach saRNA molecules targeting the p21 gene promoter sequence which cause significant increase in p21 mRNA and protein expression in all cells tested (paragraph 0182-0183), and also recites an saRNA molecule comprising a first and second ribonucleic acid strand wherein the first strand comprises a region of complementarity to a non-coding nucleic acid sequence of the p21 gene sufficient to activate transcription of the p21 gene (claim 28).
Li et al. #2 teach the saRNAs include modified nucleotides, modified internucleotide linkages, non-nucleotides, deoxynucleotides and analogs (paragraph 0090), and that the saRNA can include, for example a backbone phosphate group modification (e.g., methylphosphonate, phosphorothioate, phosphoroamidate and phosphorodithioate internucleotide linkages), which modifications can, for example, enhance their stability in vivo, making them particularly useful in therapeutic applications. A particularly useful phosphate group modification is the conversion to the phosphorothioate or phosphorodithioate forms of the saRNA. Phosphorothioates and phosphorodithioates are more resistant to degradation in vivo than their unmodified oligonucleotide counterparts, increasing the half-lives of the saRNA making them more available to the subject being treated (paragraph 0109). A saRNA may also be modified to comprise 2′-O-methoxyethyl (MOE), or 2′-fluoro, arabino-nucleic acid (FANA), which can enhance the resistance of the polynucleotide to nuclease degradation (paragraph 0109).
Additionally, Maier et al. taught effective nucleotide or chemical motifs for dsRNA agents. Maier et al. taught many different dsRNA agents comprising a sense strand and antisense strand with various motifs, including a dsRNA agent comprising a sense strand having a length of 21 nucleotides, 2’-F modifications at positions 1,3,5,7,9-11,13,15,17,19 and 21, and 2’-OMe modifications at positions 2,4,6,8,12,14,16,18 and 20 and phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between 2 and 3 from the 5’ end (paragraphs 0141-0145) and taught the antisense strand having a length of 23 nucleotides, 2’-OMe modifications at positions 1,3,5,7,9,11-13,15,17,19 and 21-23 and 2’-F modifications at positions 2,4,6,8,10,14,16,18 and 20 and phosphorothioate internucleotide linkages between positions 1 and 2 and 2 and 3, 21 and 22 and 22 and 23 from the 5’ end (paragraphs 0146-0149). Maier et al. also taught embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the sense strand (counting from the 5′-end) (paragraph 0304) and embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5′-end) (paragraph 0313).
Regarding claims 6 and 7, Li et al. #1 teach regarding saRNA molecules, 3 ' protruding ends usually have two bases, and the non-coding regions not complementary to the target gene, for example, two deoxyribonucleotides dTdT (page 1). Therefore, Li et al. #1 teach a dTdT overhang at the 3’ end of one of the strands.
Regarding claim 8, Li et al. #1 teach saRNA molecules can also be single chain molecules in the form of the presence of such single chain molecule may form double stranded structures. The first part of this region from the single-stranded nucleic acid molecule ribonucleotides, and non-coding region of the gene of the complementary binding region and a second portion complementary to a region of the first portion, forming a duplex structure (page 1).
Li et al. #1 do not teach the saRNA is conjugated with one or more chemical groups recited in instant claim 13.
Li et al. #2 cures this deficiency. Li et al. #2 teach passive uptake of modified polynucleotides can be modulated, for example, by the presence of a conjugate such as a polyethylene glycol moiety or a cholesterol moiety at the 5′ terminal of the sense strand (paragraph 0123).
Regarding claim 15, the wherein clause is a functional limitation that would flow from the structure of the small activating nucleic acid molecule of claim 1, and therefore an saRNA having the recited structure would carry out the wherein clause. See the teachings of the references above regarding claim 1.
Regarding claim 19, Li et al. #1 teach dsaRNA transfected PC-3 tumor cells, and that dsaP21- 6 can significantly reduce the PC-3 cell viability as promoting p21 gene expression is associated with this ability (Example 1).
Regarding claim 20, Li et al. #1 do not teach a pharmaceutical composition comprising the small activating nucleic acid molecule of claim 1 and optionally a pharmaceutically acceptable carrier.
Li et al. #2 cures this deficiency. Li et al. #2 taught pharmaceutical preparations of the subject saRNA compounds described above which can be incorporated into a variety of formulations for therapeutic administration by a variety of routes. More particularly, the compounds of the present invention can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers (paragraph 0134). Li et al. #2 also recites a pharmaceutical composition comprising an saRNA comprising at least a first ribonucleic acid strand comprising a region of complementarity to a non-coding nucleic acid sequence of a p21 gene sufficient to activate transcription of the p21 gene, and wherein the composition further comprises at least one of a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient and a pharmaceutically acceptable adjuvant (claim 35).
It would have been obvious to one of ordinary skill in the art before the effective filing date, to have modified the p21 saRNA comprising the sense strand of SEQ ID NO: 40 and antisense strand of SEQ ID NO: 41 of Li et al. #1 with the chemical modifications suggested for saRNAs by Li et al. #2 including phosphorothioate linkages, and 2’-F and 2’-Ome sugar modifications and to arrive at the chemical modification motif/pattern of Maier et al. with a reasonable expectation of success. There would be a reasonable expectation of success, because both Li et al. #1 and Li et al. #2 pertain to saRNAs and teach p21 saRNAs, and Li et al. #2 suggests chemical modifications for saRNAs, and Maier et al. pertains to different chemical modification patterns and motifs for dsRNA, and would amount to applying a known technique of chemical modification to a known product (the saRNA of Li et al. #1) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Li et al. #2 taught benefits of backbone phosphate group modifications including phosphorothioates can enhance their stability in vivo, making them particularly useful in therapeutic applications and that phosphorothioates are more resistant to degradation in vivo than their unmodified oligonucleotide counterparts, increasing the half-lives of the saRNA making them more available to the subject being treated (paragraph 0109), and that a saRNA may also be modified to comprise 2′-O-methoxyethyl (MOE), or 2′-fluoro, arabino-nucleic acid (FANA), which can enhance the resistance of the polynucleotide to nuclease degradation (paragraph 0109). In addition, one of ordinary skill in the art would have been motivated by the teachings of Maier et al. who taught many different dsRNA agents comprising a sense strand and antisense strand with various motifs, including a dsRNA agent comprising a sense strand having a length of 21 nucleotides, 2’-F modifications at positions 1,3,5,7,9-11,13,15,17,19 and 21, and 2’-OMe modifications at positions 2,4,6,8,12,14,16,18 and 20 and phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between 2 and 3 from the 5’ end (paragraphs 0141-0145) and taught the antisense strand having a length of 23 nucleotides, 2’-OMe modifications at positions 1,3,5,7,9,11-13,15,17,19 and 21-23 and 2’-F modifications at positions 2,4,6,8,10,14,16,18 and 20 and phosphorothioate internucleotide linkages between positions 1 and 2 and 2 and 3, 21 and 22 and 22 and 23 from the 5’ end (paragraphs 0146-0149), and taught embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the sense strand (counting from the 5′-end) (paragraph 0304) and embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5′-end) (paragraph 0313).
Therefore, Maier et al. teach the same chemical modification pattern in the sense strand as in instant SEQ ID NO: 498, and a very close modification pattern in the antisense strand as in instant SEQ ID NO: 499, with the only difference being that positions 12 and 22 of the antisense strand of Maier et al. have 2-OMe modifications rather than 2’-fluoro.
Although the cited art does not specifically teach the exact modification pattern regarding the antisense strand, it would have been obvious for one ordinarily skilled in the art to perform routine optimization of the pattern to achieve improved results. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions."
In the instant case, the focus is in the change of form, or substitution of equivalents over the prior art. Substitution of equivalents in terms of identifying optimal locations, both in terms of potency and reduced toxic effects, for 2’F and 2’-OMe modifications in dsRNA, since varying 2’-F and 2’-OMe positions in a double stranded nucleic acid for optimal or better results in known in the prior art.
Accordingly, the limitations of claims 1,5-8,10-13,15,17,19 and 20 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Li et al. #1 in view of Li et al. #2 and Maier et al. as applied to claims 1,5-8,10-13,15,17,19 and 20 above, and further in view of Alnylam (WO 2021119226, EFD 13 Dec 2019) and Jain et al. (WO 2020252589, Published 24 Dec 2020).
The teachings of Li et al. #1 in view of Li et al. #2 and Maier et al. as applied to claims 1,5-8,10-13,15,17,19 and 20 have been described above. Li et al. #2 taught passive uptake of modified polynucleotides can be modulated, for example, by the presence of a conjugate such as a polyethylene glycol moiety or a cholesterol moiety.
Li et al. #1 in view of Li et al. #2 and Maier et al. do not teach that the chemical group conjugated with the small activating nucleic acid molecule is one of structures (A), (B), or (C) as shown in claim 14.
Before the effective filing date, Alnylam taught lipophilic moieties may be conjugated to iRNA agents, and the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain (page 11, lines 23-24), and the lipophilic moiety is conjugated to the double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, or carbamate (page 11, lines 36-38). Alnylam taught a modification of the iRNA involves chemically linking to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA, e.g., into a cell, which include lipid moieties (page 85, lines 27-29), and a ligand alters the distribution, targeting or lifetime of the iRNA agent, or may provide enhanced affinity to a selected target (molecule, cell or organ) (page 86, lines 4-6). Alnylam taught a ligand attached to an iRNA acts as a pharmacokinetic modulator which includes lipophiles, bile acids, steroids, phospholipid analogues and includes fatty acids, dialkylglycerides, diacylglyceride (page 87, lines 15-19).
Alnylam taught embodiments where the ligand or conjugate is a lipid or lipid based molecule, which can typically bind a serum protein and allows for distribution of the conjugate to a target tissue (page 88, lines 13-15). Alnylam also taught carbohydrate conjugates including GalNAc which can also be used to target the iRNA to particular cells such as hepatocytes, and GalNAc and derivatives may be attached via a linker (page 90, lines 29-37).
Alnylam taught an RNAi agent attached to the carbohydrate conjugate via a linker as shown below, wherein X is O or S. The chemical structure below matches everything in the chemical structure (C) other than the part circled below.
PNG
media_image6.png
256
386
media_image6.png
Greyscale
Jain et al. taught ionizable lipids for transfecting living cells with genetic material (paragraph 0002). The compound can be used with a therapeutic agent which is a nucleic acid therapeutic (paragraph 00143,00145,00146).
Jain et al. taught the following ionizable lipid compound PNI 150 (top of page 19) and also recites the compound in claim 11. The circled part of the compound below matches the remaining portion of the instant structure (C).
PNG
media_image7.png
224
626
media_image7.png
Greyscale
The synthesis scheme for PNI 150 is also shown below from page 118.
PNG
media_image8.png
541
891
media_image8.png
Greyscale
It would have been obvious to one of ordinary skill in the art to modify the saRNA of Li et al. #1 in view of Li et al. #2 and Maier et al. by conjugating a chemical group thereto to enhance the activity, cellular distribution or cellular uptake or alter the distribution, targeting or lifetime of the saRNA agent and arrive at the instant structure (C) by coupling the linoleic acid branch of the PNI 150 compound of Jain et al. circled above, as opposed to the carbohydrate groups of the GalNAc, to the amide group in the linker of the compound of Alnylam (circled above) which is used to conjugate the lipid to the oligonucleotide with a reasonable expectation of success. There would be a reasonable expectation of success because Li et al. #2 taught passive uptake of modified polynucleotides can be modulated, for example, by the presence of a conjugate such as a polyethylene glycol moiety or a cholesterol moiety and therefore suggests conjugation to a lipid moiety, and Alnylam taught lipid conjugates with nucleic acids. One of ordinary skill in the art would have been motivated to do so in order to provide a lipophilic or lipid based ligand attached to a known ligand and linker for attachment to the oligonucleotide which provides enhanced activity, cellular distribution or cellular uptake or to alter the distribution, targeting or lifetime of the saRNA agent.
Accordingly, the limitations of claim 14 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1,5-8,10-13,15,17,19 and 20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1,2,6,8,10-13,15-21,23,24,27-31,33,34,36,37 and 40-42 of copending Application No. 18/275,900 (‘900) in view of Li et al. #1 and Maier et al., cited above.
Claims 1,2,6,8,10-13,15-21,23,24,27 and 28 of ‘900 recite a chemically modified small activating RNA comprising a sense oligonucleotide strand and an antisense oligonucleotide strand, wherein the sense oligonucleotide strand or the antisense oligonucleotide strand is at least 75% homologous or complementary to the promoter sequence of a target gene; wherein the two nucleotides at the 5' end and at the 3' end of the sense oligonucleotide strand are chemically modified nucleotides, and the antisense oligonucleotide strand comprises at least one chemically modified nucleotide; and wherein chemical modification of the sense oligonucleotide strand is selected from the group consisting of the following four patterns:
1) two 2'OMe modifications at 5' and 3' ends, 2) two 2'F modifications at its 5' and 3' ends, 3) two 2'OMe modifications at 5' and the last two 3'-end phosphodiester bonds being replaced by phosphorothioate bonds, and 4) two 2'F modifications at 5' and the last two 3'-end phosphodiester bonds being replaced by phosphorothioate bonds;
and/or wherein the chemical modification of the antisense oligonucleotide strand is selected from the group consisting of the following ten patterns:
1) eight 2'F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5' end, 2) five 2'F modifications in total, at positions 1, 5, 12, 16, and 20, respectively, counting from the 5' end, 3) eight 2'F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5' end; and 2'OMe modifications at positions 2, 6, 7, 8, 9, 10, 11, 13, 14, 15, 18, 19, and 21, respectively, counting from the 5' end, 4) five 2'F modifications in total, at positions 1, 5, 12, 16, and 20, respectively, counting from the 5' end; and the last two 3'-end phosphodiester bonds being replaced with phosphorothioate (PS), 5) five 2'F modifications in total, at positions 1, 5, 12, 16, and 20, respectively, counting from the 5' end; the last two 3'-end phosphodiester bonds being replaced with phosphorothioate (PS); and the first nucleotide from its 5' end of which lacking 2'F modification, 6) eight 2'F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5' end; and the first phosphodiester bond at its 5' end and the last two phosphodiester bonds at its 3' end being replaced with PS, 7) eight 2'F modifications in total, at positions 1, 3, 4, 5, 12, 16, 17, and 20, respectively, counting from the 5' end; the first phosphodiester bond at its 5' end and the last two phosphodiester bonds at its 3' end being replaced with PS; and the first nucleotide from its 5' end of which lacking 2'F modification,
8) five 2'F modifications in total, at positions 1, 5, 12, 16, and 20, respectively, counting from the 5' end; the last two 3'-end phosphodiester bonds being replaced with phosphorothioate (PS); and the three ribonucleotides at positions 2, 3 and 4 counting from the 5' end being replaced by deoxynucleotides, and 2'F modification at position 17 counting from the 5' end, 9) the three deoxynucleotides at positions 2, 3, and 4, respectively, counting from the 5' end, and 10) six deoxynucleotides at positions 2, 3, 4, 5, 6, and 7, respectively, counting from the 5' end, respectively.
Claim 20 of ‘900 recites the same limitations of the groups the oligonucleotide can be conjugated to as in instant claim 13.
Claim 21 of ‘900 recites the same limitations of the overhang as in instant claim 6.
Claims 29-30 of ‘900 recite the saRNA target gene is human p21 gene, and targets the promoter region, and claims 31,33 recite specific saRNA sense and antisense strand SEQ ID NOs.
Some of the sequences of the saRNAs recited in claims 31 and 33 are very close to the instant claimed sequences. For example, the antisense sequence of SEQ ID NO: 19 of ‘900 matches 21 nucleotides of instant antisense sequence of SEQ ID NO: 499:
PNG
media_image9.png
177
570
media_image9.png
Greyscale
The antisense sequence of SEQ ID NO: 13 of ‘900 matches 21 nucleotides of instant SEQ ID NO: 499:
PNG
media_image10.png
175
571
media_image10.png
Greyscale
Claims 34,36,37,40-42 of ‘900 recite the same limitations regarding a nucleic acid molecule, a cell, and a pharmaceutical composition as instant claims 17,19 and 20.
The claims of ‘900 do not recite that the saRNA sense strand is SEQ ID NO: 498 and the antisense strand is SEQ ID NO: 499 and the same chemical modification pattern thereof.
The teachings of Li et al. #1 and Maier et al. have been described above in the 103 rejections.
It would have been obvious to one of ordinary skill in the art before the effective filing date, to have modified the claims of ‘900 by substituting the p21 saRNA sequences of ‘900 with the p21 saRNA sense and antisense strand sequences of SEQ ID NO: 40 and SEQ ID NO: 41 of Li et al. #1 and to provide specific chemical modifications at specific positions based on the chemical modification motif/pattern of Maier et al. with a reasonable expectation of success. There would be a reasonable expectation of success, because both the saRNA of the claims of ‘900 and Li et al. #1 pertain to p21 saRNAs and the claims of ‘900 already comprise chemical modifications and Maier et al. pertains to different chemical modification patterns and motifs for dsRNA, and would amount to applying a known technique of chemical modification to a known product ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to do because Maier et al. taught many different dsRNA agents comprising a sense strand and antisense strand with various motifs, including a dsRNA agent comprising a sense strand having a length of 21 nucleotides, 2’-F modifications at positions 1,3,5,7,9-11,13,15,17,19 and 21, and 2’-OMe modifications at positions 2,4,6,8,12,14,16,18 and 20 and phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between 2 and 3 from the 5’ end (paragraphs 0141-0145) and taught the antisense strand having a length of 23 nucleotides, 2’-OMe modifications at positions 1,3,5,7,9,11-13,15,17,19 and 21-23 and 2’-F modifications at positions 2,4,6,8,10,14,16,18 and 20 and phosphorothioate internucleotide linkages between positions 1 and 2 and 2 and 3, 21 and 22 and 22 and 23 from the 5’ end (paragraphs 0146-0149), and taught embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the sense strand (counting from the 5′-end) (paragraph 0304) and embodiments wherein the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5′-end) (paragraph 0313).
It would have been obvious for one ordinarily skilled in the art to perform routine optimization of the pattern to achieve improved results. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions."
In the instant case, the focus is in the change of form, or substitution of equivalents over the prior art. Substitution of equivalents in terms of identifying optimal locations, both in terms of potency and reduced toxic effects, for 2’F and 2’-OMe modifications in dsRNA, since varying 2’-F and 2’-OMe positions in a double stranded nucleic acid for optimal or better results in known in the prior art.
This is a provisional nonstatutory double patenting rejection.
Claim 14 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1,2,6,8,10-13,15-21,23,24,27-31,33,34,36,37 and 40-42 of copending Application No. 18/275,900 (‘900) in view of Li et al. #1 and Maier et al. as applied to claims 1,5-8,10-13,15,17,19 and 20 above and further in view of Alnylam (WO 2021119226, EFD 13 Dec 2019) and Jain et al. (WO 2020252589, Published 24 Dec 2020), cited above.
Claims 1,2,6,8,10-13,15-21,23,24,27-31,33,34,36,37 and 40-42 of copending Application No. 18/275,900 (‘900) and the teachings of Li et al. #1 and Maier et al. have been described above. Claim 20 of ‘900 recites the same limitations of the groups the oligonucleotide can be conjugated to as in instant claim 13.
However, the claims of ‘900 do not recite the chemical group conjugated with the saRNA is selected from one or more of structures (A),(B) or (C).
Alnylam and Jain et al. cure this deficiency, the teachings of which are described in the 103 rejection above for claim 14.
It would have been obvious to one of ordinary skill in the art before the effective filing date to modify the claims of ‘900 which also teach a conjugate including lipids and fatty acids, by conjugating a chemical group thereto to enhance the activity, cellular distribution or cellular uptake or alter the distribution, targeting or lifetime of the saRNA agent and arrive at the instant structure (C) by coupling the linoleic acid branch of the PNI 150 compound of Jain et al. circled above, as opposed to the carbohydrate groups of the GalNAc, to the amide group in the linker of the compound of Alnylam (circled above) which is used to conjugate the lipid to the oligonucleotide with a reasonable expectation of success. There would be a reasonable expectation of success because claim 20 of ‘900 recites the saRNA is conjugated with one or more chemical groups including lipids and fatty acids. One of ordinary skill in the art would have been motivated to do so in order to provide a lipophilic or lipid based ligand attached to a known ligand and linker for attachment to the oligonucleotide which provides enhanced activity, cellular distribution or cellular uptake or to alter the distribution, targeting or lifetime of the saRNA agent as taught by Alnylam.
This is a provisional nonstatutory double patenting rejection.
Conclusion
Claims 1,5-8,10-15,17,19 and 20 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
