Prosecution Insights
Last updated: October 04, 2026
Application No. 18/276,794

METHODS AND COMPOSITIONS FOR GENERATING STEM CELL-DERIVED IMMUNE CELLS WITH ENHANCED FUNCTION

Non-Final OA §102§103
Filed
Aug 10, 2023
Priority
Feb 10, 2021 — provisional 63/147,933 +2 more
Examiner
ANGELL, JON E
Art Unit
1641
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Toolgen Incorporated
OA Round
1 (Non-Final)
71%
Grant Probability
Favorable
1-2
OA Rounds
1m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
587 granted / 827 resolved
+11.0% vs TC avg
Strong +21% interview lift
Without
With
+21.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
30 currently pending
Career history
862
Total Applications
across all art units

Statute-Specific Performance

§101
6.7%
-33.3% vs TC avg
§103
27.6%
-12.4% vs TC avg
§102
23.2%
-16.8% vs TC avg
§112
26.6%
-13.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 827 resolved cases

Office Action

§102 §103
DETAILED ACTION This Action is in response to the communication filed on 04/27/2026. Claims 26-34, 36-46 are pending. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election with traverse of Group I and the species iPSC, inhibiting one or both of DGKα or DGKζ and the corresponding SEQ ID NO: 3 (for DGKα) or SEQ ID NO: 11 (for DGKζ), Cas9, NK cells expressing CD56, and TAG-72, in the reply filed on 04/27/2026 is acknowledged. The traversal is on the ground(s) that Group I and II are related under “product and process of use of said product.” This is not found persuasive because although the inventions are related, there is a lack of unity of invention as claim 26 does not make a contribution over the prior art as evidenced by the reference cited in the previous office action as well as the prior art cited in the rejection(s) below. That is, since the technical feature linking Group I and II (i.e., the modified cell of claim 26) does not make a contribution over the cited prior art, by rule unity of invention does not exist and the restriction is proper. The requirement is still deemed proper and is therefore made FINAL. Claims 28, 38-39, 41 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention (claims 38-39) or species (claims 28, 41), there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 04/27/2026. Claims 26-34, 36-37, 40-46 are encompassed by the elected subject matter and are under consideration. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 26-27, 30, 31-34, 36-37, 40, 42-46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by WO2018030874A1 (hereinafter “KIM”, of record – IDS citation’ English translation by Google Translate provided). Regarding claim 26, KIM teaches a modified cell wherein the function of at least one target gene selected from DGKA (DGKα) and DGKZ (DGKζ) is inhibited, wherein the modified cell is capable of differentiating into an immune cell that retains the gene inhibition of the modified cell and comprises enhanced activity. For instance, see abstract, page 65 (bottom of page), It is noted that KIM teaches that the modified cell can be an IPS cell (as indicated below), which is a cell that is capable of differentiating to an immune cell that retains the gene inhibition of the modified cell and comprises enhanced activity. Regarding claim 27, KIM teaches that the cell is an induced pluripotent stem (iPS) cells (e.g., see middle of page 4). Regarding claim 30, KIM teaches knockout of two alleles of the target gene, indicating that both alleles of the target gene are inhibited (e.g., see top part of page 17). Regarding claim 31, KIM teaches that the target gene can be DGKA (e.g., see bottom of page 4). Regarding claim 32, KIM teaches that the target gene can be DGKZ (e.g., see bottom of page 4). Regarding claim 33, KIM teaches that both DGKα or DGKζ can be inhibited (e.g., see bottom of page 4). Regarding claim 34, KIM teaches the modified cell comprises a nucleic acid encoding a chimeric antigen receptor (CAR) (e.g., see middle to bottom of page 4). Regarding claim 36, KIM teaches that a guide RNA-nuclease complex can be used wherein the gRNA can be one that comprises a targeting sequence that is complementary to SEQ ID NO: 11 (a target sequence of DGKζ) (e.g., see top part of page 4; top part of page 63, page 104 Table identifying sequence 111). It is noted that claim 26 only requires a single gRNA/target sequence (SEQ ID NO) and KIM explicitly teaches target sequence SEQ ID NO:111 as indicated above. SEQUENCE INFORMATION CC PN WO2018030874-A1. XX CC PD 15-FEB-2018. XX CC PF 14-AUG-2017; 2017WO-KR008835. XX PR 12-AUG-2016; 2016KR-00103308. PR 08-MAY-2017; 2017US-0502822P. XX CC PA (TOOL-) TOOLGEN INC. XX CC PI Kim SJ, Kim Y, Yu H, Jung I, Lee JM; XX CC PT New artificially manipulated immunoregulatory gene useful in composition CC PT for treating disease such as autoimmune diseases, hyperproliferative CC PT diseases, refractory disease and inflammatory disease in patient. XX CC PS Claim 10; SEQ ID NO 111; 253pp; Korean. XX CC The present invention relates to a novel engineered immunoregulatory gene CC which is produced by a guide nucleic acid-editor protein complex, where CC the guide nucleic acid can be a guide RNA (gRNA) and the editor protein CC can be a Cas9 protein. The engineered immunoregulatory gene is selected CC from the group consisting of a programmed cell death-1 (PD-1) gene, a CC cytotoxic T-lymphocyte associated protein 4 (CTLA-4) gene, an A20 gene, a CC diacylglycerol kinase alpha (DGK alpha/DGKA) gene, a diacylglycerol CC kinase zeta (DGK-zeta/DGKZ) gene, a FAS gene, an early growth response CC protein 2 (EGR2) gene, a PPP2R2D gene, a PSGL-1 gene, a KDM6A gene and a CC TET2 gene. The invention further claims: (1) a method for screening a CC target sequence selected from SEQ ID NO: 1-289 (see BFC02037-BFC02325); CC (2) a guide nucleic acid specific to the target sequence; (3) an CC engineered immune cell comprising at least one of the engineered CC immunomodulatory gene; (4) a method for manipulating an immune cell; and CC (5) an immune cell produced by the method. The engineered CC immunoregulatory gene of the present invention can be used for preparing CC engineered immune cells that can be used in a composition for treating a CC disease selected from autoimmune diseases, hyperproliferative diseases, CC refractory disease, inflammatory disease and age-related disease. The CC present sequence represents a human DGK-zeta gene fragment DNA which is CC specifically claimed and can be used as a target sequence for the guide CC nucleic acid-editor protein complex of the present invention. XX Query Match 100.0%; Score 20; Length 23; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTAGGAGTCAGCGACATATG 20 |||||||||||||||||||| Db 1 CTAGGAGTCAGCGACATATG 20 Regarding claim 37, KIM teaches that the nuclease can be Cas9 (e.g., see page 5, page 6 in reference to Figure 14, etc.). Regarding claim 40, KIM teaches that the immune cell can be an NK cell (e.g., see page 9). Regarding claim 42, KIM teaches that the immune cell is an NK cell that expresses CD56 (e.g., see page 9). Regarding claims 43-46, KIM teaches that the immune cell can be modified to include a specific CAR wherein the CAR is a tumor associated antigen, that can be TAG-17, thus indicating that the cell comprise a nucleic acid encoding and expressing a CAR such that the modified immune cell recognizes a tumor antigen that is TAG-72 (e.g., see page middle of page 13). Therefore, KIM anticipates the instant claims. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 29 is rejected under 35 U.S.C. 103 as being unpatentable over WO201803087 (hereinafter “KIM”, of record – IDS citation; English translation by Google Translate provided) in view of UMEKAGE et al. (Inflamm Regen, Sep 2, 2019; 39:17, 5 pages). KIM teaches a modified cell wherein at least one of DGKα and DGKζ is inhibited, as explained in the rejection above. KIM does not teach that the modified cell is derived from a triple homozygous HLA haplotype donor, as required by claim 29. UMEKAGE teaches iPS cells derived from a triple homozygous HLA haplotype donor. Specifically, UMEKAGE teaches iPS cells harvested from donors who are triple homozygous (HLA-A, HLA-B and HLA-DR) (see page 2 under “Donor Recruitment”). UMEKAGE teaches that the cells are being produced to establish a safe and effective iPSC stock that can be used for regenerative medicine (see abstract). Furthermore, UMEKAGE teaches that HLA homozygous iPSCs are useful because they minimize the influence of immune rejection, which remains an issue in allogeneic transplantation (see abstract, page 1 under “Background”). Therefore, it would have been prima facie obvious to one of ordinary skill in the art prior to the day the claimed invention was filed to use cells derived from a triple homozygous HLA haplotype donor as the modified cell. The reason to use a cell derived from a triple homozygous HLA haplotype donor is to minimize immune rejection. Furthermore, the fact that UMEKAGE teaches that the cells can be used in regenerative medicine provides the basis for a reasonable expectation of success. Therefore, claim 29 is not patentable over the cited prior art. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. J. E. Angell Primary Examiner Art Unit 1637 /J. E. ANGELL/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Aug 10, 2023
Application Filed
Sep 17, 2026
Non-Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12746253
BLOOD-BRAIN BARRIER PERMEABLE HETERODUPLEX NUCLEIC ACID
4y 2m to grant Granted Sep 29, 2026
Patent 12741996
Modulation of Wnt5a to Treat Glaucoma
2y 9m to grant Granted Sep 22, 2026
Patent 12741035
UTILIZATION OF GENE TARGETING ANTIBODY FUSION PROTEINS TO PERFORM IN VIVO THERAPEUTIC GENE EDITING
1y 5m to grant Granted Sep 22, 2026
Patent 12709742
RNA expression modulating or editing method via regulation of Cas13 protein
3y 10m to grant Granted Aug 18, 2026
Patent 12702693
TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF CODON-OPTIMIZED mRNA ENCODING CFTR
4y 10m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
71%
Grant Probability
92%
With Interview (+21.1%)
3y 3m (~1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 827 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month