DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 02/25/2026. Claims 1-28 are currently pending. The restriction requirement mailed 02/02/2026 is still deemed proper. Applicant elected the invention of Group I (claims 1-22) and species A1 (claims 24-25) without traverse in the reply filed 02/25/2026. Claims 23 and 26-27 are generic. Claim 28 is are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention/species, there being no allowable generic or linking claim. Accordingly, claims 1-27 are examined herein.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). (Please see Fig. 16). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 4, 6-27 are rejected under 35 U.S.C. 103 as being unpatentable over Bestas (Nucleic Acid Therapeutics. Volume 24, Number 1, 2014.; of record, applicant’s submission) in view of U.S. Patent Publication 2008/0118487 A1 to Ferenc (hereinafter ‘Ferenc’).
Claim interpretation: the term “splice variant of myostatin” is interpreted as encompassing any variant of myostatin that differs from full-length myostatin (wild type or mutant) as a result of alternative splicing.
Bestas teaches AONs which are complementary to exon 2 of the myostatin gene and allow expression of a myostatin splice variant by inducing exon skipping (Abstract and p. 14 in the final two paragraphs of the Introduction). The AONs were 25 nt long (p. 16, §Evaluation of SSOs for myostatin corruptive exon skipping), and all effectively spliced exon 2 from the mature transcript (Id.) by targeting either consensus splice sites or exon internal sites (FIG. 2). Bestas further notes that previous studies have demonstrated that reducing myostatin signaling via myostatin antagonists (such as the variants taught by Ferenc) or splice-skipping PMOs (antisense oligonucleotides) was known effective at increasing muscle size in muscle wasting conditions such as Duchenne muscular dystrophy (DMD)(Abstract, p. 21).
Bestas does not teach that the AONs target exon 3 of the myostatin gene.
Ferenc teaches “splice variants of myostatin that promote muscle growth” (Abstract) that are antagonists of mature myostatin and able to promote myoblast proliferation and reduce cancer muscle cachexia in vivo (para [0196]).
Ferenc further teaches that the splice variants have cryptic splice sites in exon 3 (donor site SD3 and acceptor site SA3). As seen in Figure 1, these splice sites can induce the partial excision of the 5’ region of exon 3, producing two types of truncated variants comprising exons 1 and 2 and only the 3’ UTR region of exon 3:
PNG
media_image1.png
461
868
media_image1.png
Greyscale
[0140] The presently disclosed myostatin splice variant (MSV) is believed to be the result of an alternative splicing event. As shown in FIG. 1, the precursor canonical myostatin mRNA may be transcribed so as to include polynucleotide sequences of all three exons of the myostatin gene. The three exons are bounded by splice donor and acceptor sites, SD1 and SA1, and SD2 and SA2 respectively. Removal of the two introns, one between SD1 and SA1, and the other between SD2 and SA2, produces the canonical myostatin mRNA. The translation start site is located in exon 1, and the stop codon is located about one third of the 5 way into exon 3, meaning that normally there is a large 3′ untranslated region within exon 3.
[0141] As disclosed herein for the first time, an alternative splicing event may also take place in the course of myostatin gene expression by a process in which an extra splicing event occurs between SD3 and SA3 or between SD2 and SA3 (FIG. 1), causing the majority of the normally translated portion of the canonical exon 3 to be excised and replaced with the normally 3′ untranslated section of exon 3. This unexpected splicing event creates a new open reading frame from which the MSV protein may be translated.
Ferenc does not teach antisense oligonucleotides which are complementary to exon 3 of the myostatin gene and capable of allowing expressing of the disclosed splice variants. Instead, Ferenc teaches expressing the splice variants from plasmid expression vectors (para [0197]).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the splice-switching AONs complementary to regions of exon 2 of the myostatin gene to induce exon 2 skipping and promote muscle growth, as taught by Bestas, to comprise sequences targeting the specific splice sites in exon 3, as taught by Ferenc, to induce exon 3 skipping and allow expression of Ferenc’s myostatin splice variants capable of promoting muscle growth. Bestas teaches that exon skipping to knock down or inhibit myostatin was an effective way to promote muscle growth in muscle-wasting diseases such as DMD. Bestas teaches one possible set of splice sites that could be targeted to skip exon 2, and demonstrates methods of making AONs capable of targeting the splice sites in the myostatin gene to induce exon skipping. Ferenc provides alternative splice sites which allow expression of alternative myostatin variants also capable of promoting muscle growth. Therefore, Ferenc provides the ordinary artisan with additional variants and the motivation to express those variants using known methods in the art, including those taught by Bestas. Based on Bestas’s teachings, the ordinary artisan would have a reasonable expectation that AONs could successfully be designed to target the particular splice sites taught by Ferenc as an alternative to those disclosed by Bestas.
Regarding claim 4, please note that the claim recites wherein the antisense oligonucleotide “has” 18 bases. The word “has” is open-ended, and is interpreted as meaning that the oligonucleotide must have at least 18 bases, but may have additional bases beyond that. Therefore, insofar as Bestas teaches 25-mer AONs, Bestas teaches the limitations of claim 4.
Regarding claims 6-8, Bestas teaches 2’-O-methyl-modified AONs (p. 14 § Synthesis of oligonucleotides).
Regarding claim 9, Bestas teaches pharmaceutical compositions comprising the AONs and, “In-Vivo jetPEI…at an N/P ratio of 10 in 10% glucose” (p. 15 §Animal Experiments).
Regarding claim 10, it is relevant to note that the claim merely recites an intended use for the product, i.e., “for preventing and/or treating a pathological condition and/or a disease in which myostatin is involved”. This recitation of intended use does not result in a structural difference between the claimed invention and the prior art. Therefore, it does not serve to limit the claim. Please see MPEP 2111.02. Even if the recitation of intended use were limiting, the use of the pharmaceutical condition to treat diseases involving myostatin is already taught by Bestas and Ference, as discussed above.
Regarding claims 11-15, Ferenc teaches that myostatin is involved in diseases involving muscular atrophy, such as muscular dystrophy, cachexia, etc., as well as the muscle wasting associated with cancer (paras [0077-0078]). In combination, Ferenc and Bestas both teach myostatin splice variants caused by exon skipping which promote muscle growth. Regarding claim 15, and for clarity, cardiac failure is interpreted as encompassing heart attacks.
Regarding claims 16-17, Ferenc teaches that the ASO composition may be administered orally (para [0147]), and further that the myostatin variants are present in various livestock animals such as pigs, sheep, cattle, etc., (para [0142]) for which including the ASO composition in a food would be an obvious mode of administration.
Regarding claims 18-22, these claims merely recite various agents followed by intended uses. The intended uses do not further limit the structure of the ASO of claim 1, and an agent is interpreted as encompassing merely the ASO of claim 1 itself. Nonetheless, insofar as Ferenc and Bestas teach that splice-skipping ASOs targeting myostatin are capable of promoting myocyte proliferation (see above); increasing muscle mass (see above); switching splicing of the myostatin gene (see above); decreasing myostatin signaling (i.e., knocking it down or antagonizing it; see above); or treating cancer cachexia (see above); they also teach those limitations.
Regarding claims 23-27, these claims merely recite methods for achieving the same outcomes recited in claims 18-22, and are taught by the prior art for the same reasons discussed above.
Claim 2-3 are rejected under 35 U.S.C. 103 as being unpatentable over Ferenc and Bestas, as applied to claims 1 and 6-27 above, further in view of NCBI reference sequence NM_005259.3 (hereinafter ‘NM_005259.3’; of record, cited in a previous office action).
Ferenc and Bestas render obvious the antisense oligonucleotide of claim 1, from which the instantly rejected claims depend, as described above.
Ferenc and Bestas do not teach wherein the nucleotide sequence of exon 3 is in SEQ ID NO: 1, or more specifically is SEQ ID NO: 2 (relevant to claim 2), nor do they teach that the oligonucleotide comprises a sequence consisting of at least 15 consecutive nucleotides in any one of the recited sequences (relevant to claims 3 and 5). Please note that while the claim uses the word “consisting of” to describe the sequence itself, the claim uses the open-ended “comprises” to describe the oligonucleotide. Therefore, the oligonucleotide is interpreted as including but not being limited to the recited sequences.
Ferenc does teach the presence of cryptic splicing sites in exon 3 of the canonical ovine myostatin gene. While Ferenc does not explicitly teach those sites in other species, they do state that variants were identified in other species, including humans, and their alternative splice sites were determined:
[0124] The present invention relates in certain embodiments to the surprising discovery of a functional and biologically active myostatin variant mRNA molecule, which is the unexpected product of alternative splicing in the course of myostatin gene expression…As also described below, other myostatin splice variant orthologs from a number of additional mammalian species were subsequently identified through determination of alternative splice sites in myostatin gene sequences as disclosed herein.
[0142] Based on the alternative splice sites identified, the MSV sequence for the following sequences has also been established: bovine(bt) (Bos taurus; b1(bt)MSV65, SEQ ID NO: 6 and 53; b2(bt)MSV65, SEQ ID NO: 9 and 56; b3(bt)MSV65, SEQ ID NO: a2 and 59 and b4(bt) MSV65 SEQ ID NO: 15 and 62), bovine(bi) (Bos indicus, b(bi)MSV65, SEQ ID NO: 18 and 65), bovine(bg) (Bos grunniens, Yak, b(bg)MSV65, SEQ ID NO: 21 and 68), porcine (Sus scrofa, pMSV68, SEQ ID NO: 24 and 71), human (Homo sapiens, h1MSV38, SEQ ID NO: 27 and 74 and h2MSV38, SEQ ID NO:77), Chimp (Pan troglodytes, chMSV38, SEQ ID NO: 33 and 80), dog (Canis familiaris, d1MSV36, SEQ ID NO: 36 and 83, d2MSV36, SEQ ID NO: 39 and 86, and d3MSV36, SEQ ID NO: 42 and 89), and cat (Felis catus, caMSV38, SEQ ID NO: 45 and 92).
The above is taken as confirmation from Ferenc that the equivalents of the exon 3 cryptic splice sites found in the ovine sequence are also present in the human myostatin gene, and allow expression of the variants listed in para [0142]. It is noted, per Figure 1, that the canonical myostatin mRNA is produced by the splicing of intron 2 at splice sites SD2 and SA2 at the borders between intron 2 and exons 2 and 3, respectively, whereas the splice variants are produced by a splicing event between SD2 and SA3 (to produce the variant with only the 3’ UTR of exon 3, where intron 2 and the 5’ end of exon 3 are removed), or SD3 and SA3 (to produce the variant where the first 21 bp of exon 3 are retained but intron 2 and the rest of the 5’ region of exon 3 are removed). It is noted that the splice variant bMSVbb, which lacks the 21 nt 5’ terminal segment of exon 3, retains the key C-terminal peptide that Ferenc identified as conserved and functionally important, and would thus be expected to yield the same results as the slightly longer variant (paras [0190], [0204]).
Bestas teaches splice-skipping antisense oligonucleotides targeting the myostatin gene at and near splice sites to induce exon skipping, as already discussed. Specifically, Bestas teaches targeting the splice sites at the 5’ or 3’ end of exon 2 such that exon 2 is excised along with introns 1 and 2. Based on those teachings, it would have been obvious to design antisense oligonucleotides to target the SD3 splice site as taught by Ferenc.
SEQ ID NO: 1 has 100% identity to the exon 3 sequence (positions 881-2819; see the FEATURES section of the reference sequence listing) of NM_005259.3:
RESULT 1
NASEQ2_03192026_133427
Query Match 100.0%; Score 1939; DB 1; Length 2819;
Best Local Similarity 100.0%;
Matches 1939; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AATCCGTTTTTAGAGGTCAAGGTAACAGACACACCAAAAAGATCCAGAAGGGATTTTGGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 881 AATCCGTTTTTAGAGGTCAAGGTAACAGACACACCAAAAAGATCCAGAAGGGATTTTGGT 940
Qy 61 CTTGACTGTGATGAGCACTCAACAGAATCACGATGCTGTCGTTACCCTCTAACTGTGGAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 941 CTTGACTGTGATGAGCACTCAACAGAATCACGATGCTGTCGTTACCCTCTAACTGTGGAT 1000
Qy 121 TTTGAAGCTTTTGGATGGGATTGGATTATCGCTCCTAAAAGATATAAGGCCAATTACTGC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1001 TTTGAAGCTTTTGGATGGGATTGGATTATCGCTCCTAAAAGATATAAGGCCAATTACTGC 1060
Qy 181 TCTGGAGAGTGTGAATTTGTATTTTTACAAAAATATCCTCATACTCATCTGGTACACCAA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1061 TCTGGAGAGTGTGAATTTGTATTTTTACAAAAATATCCTCATACTCATCTGGTACACCAA 1120
Qy 241 GCAAACCCCAGAGGTTCAGCAGGCCCTTGCTGTACTCCCACAAAGATGTCTCCAATTAAT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1121 GCAAACCCCAGAGGTTCAGCAGGCCCTTGCTGTACTCCCACAAAGATGTCTCCAATTAAT 1180
Qy 301 ATGCTATATTTTAATGGCAAAGAACAAATAATATATGGGAAAATTCCAGCGATGGTAGTA 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1181 ATGCTATATTTTAATGGCAAAGAACAAATAATATATGGGAAAATTCCAGCGATGGTAGTA 1240
Qy 361 GACCGCTGTGGGTGCTCATGAGATTTATATTAAGCGTTCATAACTTCCTAAAACATGGAA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1241 GACCGCTGTGGGTGCTCATGAGATTTATATTAAGCGTTCATAACTTCCTAAAACATGGAA 1300
Qy 421 GGTTTTCCCCTCAACAATTTTGAAGCTGTGAAATTAAGTACCACAGGCTATAGGCCTAGA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1301 GGTTTTCCCCTCAACAATTTTGAAGCTGTGAAATTAAGTACCACAGGCTATAGGCCTAGA 1360
Qy 481 GTATGCTACAGTCACTTAAGCATAAGCTACAGTATGTAAACTAAAAGGGGGAATATATGC 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1361 GTATGCTACAGTCACTTAAGCATAAGCTACAGTATGTAAACTAAAAGGGGGAATATATGC 1420
Qy 541 AATGGTTGGCATTTAACCATCCAAACAAATCATACAAGAAAGTTTTATGATTTCCAGAGT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1421 AATGGTTGGCATTTAACCATCCAAACAAATCATACAAGAAAGTTTTATGATTTCCAGAGT 1480
Qy 601 TTTTGAGCTAGAAGGAGATCAAATTACATTTATGTTCCTATATATTACAACATCGGCGAG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1481 TTTTGAGCTAGAAGGAGATCAAATTACATTTATGTTCCTATATATTACAACATCGGCGAG 1540
Qy 661 GAAATGAAAGCGATTCTCCTTGAGTTCTGATGAATTAAAGGAGTATGCTTTAAAGTCTAT 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1541 GAAATGAAAGCGATTCTCCTTGAGTTCTGATGAATTAAAGGAGTATGCTTTAAAGTCTAT 1600
Qy 721 TTCTTTAAAGTTTTGTTTAATATTTACAGAAAAATCCACATACAGTATTGGTAAAATGCA 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1601 TTCTTTAAAGTTTTGTTTAATATTTACAGAAAAATCCACATACAGTATTGGTAAAATGCA 1660
Qy 781 GGATTGTTATATACCATCATTCGAATCATCCTTAAACACTTGAATTTATATTGTATGGTA 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1661 GGATTGTTATATACCATCATTCGAATCATCCTTAAACACTTGAATTTATATTGTATGGTA 1720
Qy 841 GTATACTTGGTAAGATAAAATTCCACAAAAATAGGGATGGTGCAGCATATGCAATTTCCA 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1721 GTATACTTGGTAAGATAAAATTCCACAAAAATAGGGATGGTGCAGCATATGCAATTTCCA 1780
Qy 901 TTCCTATTATAATTGACACAGTACATTAACAATCCATGCCAACGGTGCTAATACGATAGG 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1781 TTCCTATTATAATTGACACAGTACATTAACAATCCATGCCAACGGTGCTAATACGATAGG 1840
Qy 961 CTGAATGTCTGAGGCTACCAGGTTTATCACATAAAAAACATTCAGTAAAATAGTAAGTTT 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1841 CTGAATGTCTGAGGCTACCAGGTTTATCACATAAAAAACATTCAGTAAAATAGTAAGTTT 1900
Qy 1021 CTCTTTTCTTCAGGTGCATTTTCCTACACCTCCAAATGAGGAATGGATTTTCTTTAATGT 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1901 CTCTTTTCTTCAGGTGCATTTTCCTACACCTCCAAATGAGGAATGGATTTTCTTTAATGT 1960
Qy 1081 AAGAAGAATCATTTTTCTAGAGGTTGGCTTTCAATTCTGTAGCATACTTGGAGAAACTGC 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1961 AAGAAGAATCATTTTTCTAGAGGTTGGCTTTCAATTCTGTAGCATACTTGGAGAAACTGC 2020
Qy 1141 ATTATCTTAAAAGGCAGTCAAATGGTGTTTGTTTTTATCAAAATGTCAAAATAACATACT 1200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2021 ATTATCTTAAAAGGCAGTCAAATGGTGTTTGTTTTTATCAAAATGTCAAAATAACATACT 2080
Qy 1201 TGGAGAAGTATGTAATTTTGTCTTTGGAAAATTACAACACTGCCTTTGCAACACTGCAGT 1260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2081 TGGAGAAGTATGTAATTTTGTCTTTGGAAAATTACAACACTGCCTTTGCAACACTGCAGT 2140
Qy 1261 TTTTATGGTAAAATAATAGAAATGATCGACTCTATCAATATTGTATAAAAAGACTGAAAC 1320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2141 TTTTATGGTAAAATAATAGAAATGATCGACTCTATCAATATTGTATAAAAAGACTGAAAC 2200
Qy 1321 AATGCATTTATATAATATGTATACAATATTGTTTTGTAAATAAGTGTCTCCTTTTTTATT 1380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2201 AATGCATTTATATAATATGTATACAATATTGTTTTGTAAATAAGTGTCTCCTTTTTTATT 2260
Qy 1381 TACTTTGGTATATTTTTACACTAAGGACATTTCAAATTAAGTACTAAGGCACAAAGACAT 1440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2261 TACTTTGGTATATTTTTACACTAAGGACATTTCAAATTAAGTACTAAGGCACAAAGACAT 2320
Qy 1441 GTCATGCATCACAGAAAAGCAACTACTTATATTTCAGAGCAAATTAGCAGATTAAATAGT 1500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2321 GTCATGCATCACAGAAAAGCAACTACTTATATTTCAGAGCAAATTAGCAGATTAAATAGT 2380
Qy 1501 GGTCTTAAAACTCCATATGTTAATGATTAGATGGTTATATTACAATCATTTTATATTTTT 1560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2381 GGTCTTAAAACTCCATATGTTAATGATTAGATGGTTATATTACAATCATTTTATATTTTT 2440
Qy 1561 TTACATGATTAACATTCACTTATGGATTCATGATGGCTGTATAAAGTGAATTTGAAATTT 1620
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2441 TTACATGATTAACATTCACTTATGGATTCATGATGGCTGTATAAAGTGAATTTGAAATTT 2500
Qy 1621 CAATGGTTTACTGTCATTGTGTTTAAATCTCAACGTTCCATTATTTTAATACTTGCAAAA 1680
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2501 CAATGGTTTACTGTCATTGTGTTTAAATCTCAACGTTCCATTATTTTAATACTTGCAAAA 2560
Qy 1681 ACATTACTAAGTATACCAAAATAATTGACTCTATTATCTGAAATGAAGAATAAACTGATG 1740
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2561 ACATTACTAAGTATACCAAAATAATTGACTCTATTATCTGAAATGAAGAATAAACTGATG 2620
Qy 1741 CTATCTCAACAATAACTGTTACTTTTATTTTATAATTTGATAATGAATATATTTCTGCAT 1800
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2621 CTATCTCAACAATAACTGTTACTTTTATTTTATAATTTGATAATGAATATATTTCTGCAT 2680
Qy 1801 TTATTTACTTCTGTTTTGTAAATTGGGATTTTGTTAATCAAATTTATTGTACTATGACTA 1860
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2681 TTATTTACTTCTGTTTTGTAAATTGGGATTTTGTTAATCAAATTTATTGTACTATGACTA 2740
Qy 1861 AATGAAATTATTTCTTACATCTAATTTGTAGAAACAGTATAAGTTATATTAAAGTGTTTT 1920
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2741 AATGAAATTATTTCTTACATCTAATTTGTAGAAACAGTATAAGTTATATTAAAGTGTTTT 2800
Qy 1921 CACATTTTTTTGAAAGACA 1939
|||||||||||||||||||
Db 2801 CACATTTTTTTGAAAGACA 2819
SEQ ID NO: 24 is the 100% reverse complement to positions 890-907 of NM_005259.3, (i.e., the region where SD3 is located per Figure 1 of Fernec):
RESULT 1
NASEQ2_03192026_134823/c
Query Match 100.0%; Score 18; DB 1; Length 2819;
Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTACCTTGACCTCTAA 18
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have tried substituting the generic splice-skipping antisense oligonucleotide, as taught by Ferenc and Bestas, with a specific antisense oligonucleotide comprising any sequence that is complementary to the region of exon 3 of the human myostatin gene at or near the splice sites disclosed by Ferenc, such as SEQ ID NO: 24. The ordinary artisan would have been motivated to do so based on Ferenc’s teachings that this would have yielded a truncated variant effective for promoting muscle growth. The ordinary artisan would also have had a reasonable expectation of success based on Bestas’s teachings that antisense oligonucleotides targeted at other myostatin splice sites successfully induced skipping of the associated exon.
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Ferenc, Bestas, and NM_005259.3, as applied to claims 1-4 and 6-27 above, further in view of Maruyama (Toshifumi Yokota and Rika Maruyama (eds.). “Tips to Design Effective Splice-Switching Antisense Oligonucleotides for Exon Skipping and Exon Inclusion”. In: Exon Skipping and Inclusion Therapies: Methods and Protocols, Methods in Molecular Biology, vol. 1828, 2018.).
Ferenc, Bestas and NM_005259.3 render obvious the antisense oligonucleotide of claim 4, from which the instantly rejected claim depends, as described above.
Ferenc, Bestas and NM_005259.3 also render obvious an antisense oligonucleotide comprising SEQ ID NO: 24, as described above.
Ferenc, Bestas and NM_005259.3 do not render obvious an antisense oligonucleotide wherein the nucleotide sequence of the antisense oligonucleotide is SEQ ID NO: 24.
Maruyama teaches that the length of SSOs is an important factor that appears to depend on the chemical modification (p. 85). Maruyama notes that, “longer oligos lead to secondary structures and off-target effects” (p. 81), thus motivating the ordinary artisan to select shorter SSOs when possible.
Maruyama further teaches that the typical length of 2’-O-methyl RNA AONs, such as those taught by Bestas, is 9-25 nt.
Lastly, in the Methods section, Maruyama teaches various routine methods and publicly available software tools for the optimization of SSOs.
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the 25-mer oligonucleotide as taught by Ferenc, Bestas and NM_00529.3 by optimizing its length, as taught by Maruyama. Maruyama teaches a range of possible lengths, optimization methods and tools, and encourages the design of shorter SSOs where possible to reduce off-target effects. Thus in regards to the limitations of the claims, where the prior art teaches the optimization of SSO length within a range of 9-25 and provides the tools to do so, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp for optimization of the SSO. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4 and 6-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
It is noted that while certain specific embodiments of the claims were previously rejected in this Office Action as rendered obvious by the prior art, the claims are rejected here insofar as while the prior art teaches at least some embodiments encompassed by the claims, the application as filed is not particularly enabling for, nor does it provide written support, for the generic breadth of the invention as claimed.
Claim 1 is drawn to a generic antisense oligonucleotide of 15-30 bases which has a sequence complementary to a sequence in exon 3 of the myostatin gene of any species and is capable of allowing the expression of a splicing variant of myostatin. The genus of antisense sequences which are 15-30 bases long and complementary to a sequence in exon 3 of myostatin is vast: as discussed above and taught by NM_005259.3, exon 3 spans positions 881-2819 of the human myostatin RNA. Claim 1 does not limit the antisense sequence to any particular target in that range. For each length of oligonucleotide, therefore, there are approximately 1,900+ possible target sequences in exon 3, or close to 30,000 in total, all with highly variable nucleotide sequences. This number only includes the possible positions in the human myostatin gene, but the claim encompasses any myostatin gene from any species, which significantly increases the size and sequence variability of the genus.
In contrast to the breadth of claim 1, the instant specification provides and tests 54 exemplary sequences targeting human myostatin, as shown in Table 1. However, the sequences or target sites do not appear to share a core sequence or sequence motif which correlates with the function of allowing expression of any myostatin splice variant in any species.
The state of the art shows that the structure and function of myostatin splice variants across species was highly variable and not well understood. For examples, Shin discloses the identification of five myostatin isoforms in quail (Shin et al. A novel mechanism of myostatin regulation by its alternative splicing variantduring myogenesis in avian species. Am J Physiol Cell Physiol 309: C650 –C659, 2015.). As seen in Fig. 2, the structures of those isoforms and the locations of their splice sites are highly variable, and none appear to result from alternative splice sites in exon 3. Shin goes on to note that, “Evolutionary divergence is evident in alternative splicing of MSTN.” (p. C658), with birds, fish and mammals having variable numbers of isoforms and even MSTN genes. Ferenc (cited above) provides further insights on what was known about myostatin at the time, noting that, “Myostatin is known to regulate its own expression via a mechanism that is incompletely understood at present” (para [0002]) and that, “Complexity in the molecular regulation of biological processes by products of the myostatin gene remains incompletely understood.” (para [0007]). They go on to note their discovery of a previously unknown ovine and bovine myostatin splice variant (para [0124]) as well as other orthologs in pigs, humans, cats, dogs and chimpanzees (described above). It follows that if alternative splicing in myostatin is not well-understood, and splice variants are not well-characterized, the ordinary artisan would not be able to predict what regions outside of the few known splice sites in the myostatin gene to target with a splice-switching ASO.
The instant specification further provides evidence of this unpredictability. For example, Fig. 2 shows the locations of the 54 ASOs tested. However, of those, only Fox1 (targeting nucleotides 5184-5165 of H. sapiens myostatin, Genbank Accession No. NG:009800.1; para [0064]) appeared to produce significant amounts of MSTN-b (Fig. 3). ASOs targeting regions immediately adjacent to that, such as MST_Ex3_7 (positions 5101-5118, para [0121]), and the positions +6 to -6 to either side (Fig. 7) induced MSTN-b expression. It is relevant to note that this appears to be the same region disclosed by Ferenc as containing the cryptic splice donor site, while several of the ASOs tested (e.g., LESE4, BP, as shown in Fig. 3) were noticeably further downstream or upstream.
Claim 2 limits the target region to exon 3 of the human myostatin gene. However, as discussed above, no other splice sites in exon 3 capable of allowing expression of myostatin splice variants were known besides those disclosed by Ferenc. Absent such teachings, the ordinary artisan would not have known, based on the instant disclosure and the prior art, the correlation between the structure of antisense oligonucleotides and their function of allowing expression of a myostatin splice variant.
Claims 4 and 6-22 do not further limit the structure of the antisense oligonucleotide.
Based on the breadth of the claims, the limited amount of guidance provided by the specification and the art, the high degree of variation among members of the claimed genus, and further the unpredictability in the art, one of ordinary skill in the art would conclude that Applicant was not in possession of the invention as broadly claimed.
Claim Rejections - 35 USC § 112(a) – Enablement
Claims 10-15 and 18-27 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. The specification is enabling for agents for and methods of:
promoting myocyte proliferation (claims 18, 24)
increasing muscle mass (claims 19, 25)
switching the splicing of the myostatin gene from production of myostatin to production of a splicing variant thereof (claims 20, 26)
decreasing myostatin signaling (claims 21, 27)
treating muscular dystrophy or cancer cachexia (claims 11-14)
All of the above comprising the specific antisense oligonucleotide of claims 3 or 5.
However, the specification does not reasonably provide enablement for agents for and methods of treating and/or preventing the broad genus of any condition or disease in which myostatin is involved, all types of muscular atrophy and sarcopenia, cancer, diabetes, cardiovascular diseases, renal diseases and bone diseases with the broad genus of any antisense oligonucleotide which is complementary to a target sequence in exon 3 of the myostatin gene and allows expression of a splice variant. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention
The invention is the class of invention that the CAFC has characterized as “the unpredictable arts such as chemistry and biology.” Mycogen Plant Sci., Inc. v. Monsanto Co., 243 F.3d 1316, 1330 (Fed. Cir. 2001).
Breadth of the Claims and Guidance in the Art
Claim 1, as discussed in the rejection of the claims for lack of written description above, encompasses a broad genus of antisense oligonucleotides. Claims 10-15 and 22 are drawn to agents and pharmaceutical drugs and recite various intended uses such as preventing and/or treating any pathological condition and/or disease in which myostatin is involved or a therapeutic effect is gained through muscle mass recovery, including diabetes, cardiovascular diseases, bone diseases, and cancer. Claims 23-27 are drawn to methods of accomplishing the same outcomes as those recited in claims 10-15 and 22.
The scope of the recited diseases and conditions is vast, effectively encompassing any and all diseases or conditions because myostatin is involved in many diseases and conditions where muscle wasting is involved, such as cancer and chronic heart failure, and appears to play a role in tissue glucose uptake and diabetes (Argiles et al. Myostatin: more than just a regulator of muscle mass. Drug Discovery Today Volume 17, Numbers 13/14 July 2012). However, it is important to note that while myostatin may play a role in the muscle wasting associated with these diseases, there is no evidence that it is a causative factor of the disease itself. The diseases in which it is involved are also significantly distinct and variable in terms of their etiology, symptoms and treatments, ranging from cancer to heart disease.
It is also relevant to note that the claims recite preventing said diseases. The instant specification does not define “prevention”, which is interpreted as encompassing anything from delaying onset to completely preventing any form of the disease, regardless of whether it is symptomic. Looking to the prior art for guidance, a search of the prior art did not identify any methods which utilized antisense oligonucleotides targeting myostatin and could effectively prevent cancer, diabetes, muscular dystrophy, etc. In fact, certain diseases, such as Duchenne muscular dystrophy, are caused by mutations in the dystrophin gene (Argiles, p. 705). While the prior art indicates that inhibition of myostatin can help alleviate some of the symptoms of DMD when combined with dystrophin gene therapy (see the art rejections above), it provides no evidence that antisense oligonucleotides which allow for expression of myostatin splice variants can prevent an inherited genetic disease.
In addition, the role of myostatin is complex and difficult to predict, even when limited to muscle wasting from various causes. For example, Fokin reported that myostatin dysfunction (i.e., inhibition) did not protect from fasting-induced loss of muscle mass in mice (Title)(J Musculoskelet Neuronal Interact. 2019;19(3):342–353.). Dial et al. report similarly contradictory findings regarding muscle wasting and myostatin (Physiol Rep. 2020;8:e14500.). For example, they note that “elevated serum myostatin was associated with leaner and stronger participants” in a study on type 1 diabetes, which was, “in line with a recent observation in which elevated myostatin levels were observed in elderly men who were more active and less frail” (p. 6). Overall, they conclude that, “Equivocal findings in this area suggest that serum expression of myostatin may have disease-specific responses that are secondary to each pathology.” and that, “the analyses here along with the growing number of studies observing myostatin as a biomarker in the context of chronic and metabolic diseases reveals the complex and some-what unpredictable behavior of the myokine” (p. 7).
Based on those disclosures, the role of myostatin in various diseases is complex and unpredictable. In some muscle wasting diseases, myostatin is elevated and its inhibition would be appear to be protective, but in age- or fasting-induced muscle wasting, myostatin levels appeared elevated and/or myostatin inhibition did not alleviate the symptoms. Similarly, the correlation between elevated myostatin and increased lean mass in patients with type 1 diabetes indicated that the relationship between myostatin expression and activity is not clear in that disease. Finally, given the many diverse causes of diseases such as cancer, diabetes, muscular dystrophy, etc., the ordinary artisan would have predicted that ASO-mediated alternative splicing to knock down or inhibit myostatin, as detailed by the instant specification, would have effectively treated the symptoms or addressed the underlying pathologies of the claimed diseases.
Guidance of the Specification
The specification discloses that out of 54 ASOs tested, the administration of 7 antisense oligonucleotides allowed expression of splice variant MSTN-b in human rhabdomyosarcoma cells (para [0230-31]). These ASOs were designated MSTN_Ex3_7, MSTN_Ex3_7-1 (SEQ ID NO: 30 in Table 1) , MSTN_Ex3_7-2 (SEQ ID NO: 31), MSTN_Ex3_7-3 (SEQ ID NO: 27), MSTN_Ex3_7-4 (SEQ ID NO: 32), MSTN_Ex3_7-5 (SEQ ID NO: 33), and MSTN_Ex3_7-6 (SEQ ID NO: 28), with their target locations shown in Fig. 8. In para [0233], the specification discloses that administration of these ASOs resulted in a decrease in myostatin signaling. One ASO, MSTN-Ex3_7-2b, a variation of MSTN-Ex3_7-2 with different modifications (SEQ ID NO: 62; see Table 2 para [0219]), promoted grown in human myoblast cells (para [0234]). Therefore, it appears that ASOs comprising those sequences are at least enabled for allowing expression of MSTN-b, decreasing myostatin signaling, and promoting myoblast proliferation. Based on Ferenc’s disclosures, in which a similar splicing variant also improved cancer cachexia, it appears reasonable to expect that these ASOs would have a similar effect.
Experimentation Required
In order to practice the claimed invention, an undue amount of experimentation would be required. For example, it would be necessary for one of ordinary skill in the art to test the full genus of all ASOs targeting any sequence in exon 3 to determine whether they are capable of allowing expression of a myostatin variant, for the full breadth of all diseases or conditions which in any way involve myostatin. The art shows that diseases within this scope are so diverse, and even within the scope of diseases with a known association with myostatin, the role of myostatin is not fully understood, and the results of myostatin inhibition via production of a splice variant are unpredictable.
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue amount experimentation would be required to make and use the invention as claimed.
Subject Matter Eligibility Analysis
Regarding claim 1, it is noted that the claim is drawn to a product, an antisense oligonucleotide which has a nucleotide sequence complementary to a target sequence in exon 3 of the myostatin gene and is capable of allowing the expression of a splicing variant of myostatin. The oligonucleotide structure is a judicial exception because it encompasses naturally-occurring oligonucleotides such miRNA, long non-coding RNA, or fragments of genomic DNA, which are complementary to the myostatin exon 3 DNA coding sequence or RNA transcript. However, the claimed product possesses markedly different characteristics as compared to its closest known naturally occurring counterpart, which renders it eligible at Step 2A Prong One of the subject matter eligibility analysis.
A thorough search of the prior art did not yield evidence of naturally-occurring oligonucleotides which are both complementary to some portion of myostatin exon 3 and are capable of allowing the expression of a splicing variant of myostatin. The closest naturally occurring counterpart would be miR-27, which targets the myostatin 3’ UTR in exon 3 of myostatin (Huang et al. MicroRNA-27a promotes myoblast proliferation by targeting myostatin. Biochemical and Biophysical Research Communications 423 (2012) 265–269.)(Abstract). However, while this mRNA is complementary to a region of exon 3, it does not allow expression of a splicing variant of myostatin. Instead, it knocks down expression of myostatin, which is a markedly different functional characteristic.
Other relevant naturally-occurring oligonucleotides are the myogenin promoter-associated lncRNA Myoparr, and Malat1. Myoparr allows expression of myostatin (Hitachi et al. Myogenin promoter-associated lncRNA Myoparr is essential for myogenic differentiation. EMBO Reports (2019) 20:e47468.)(Abstract). Logically, an oligonucleotide which allows expression of a myostatin pre-mRNA would allow expression of a mature splicing variant after the pre-mRNA undergoes alternative splicing. However, Myoparr is complementary to the promoter region, not exon 3 (p. 2/22 §Identification and characterization of a myogenin promoter associated lncRNA, Myoparr, in skeletal muscle cells; Figure 1A). Lastly, Malat1 is a non-coding RNA which appears to regulate myostatin regulation as well as being a target of myostatin associated with myogenin, but the mechanisms by which that regulation occurs are unknown, and it is likewise not complementary to exon 3 (Watts et al. Myostatin-induced inhibition of the long noncoding RNA Malat1 is associated with decreased myogenesis. Am J Physiol Cell Physiol 304: C995–C1001, 2013.). Both oligonucleotides are markedly different from the claimed oligonucleotide in both structure and function.
Conclusion
No claim is allowed at this time.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA M ZAHORIK/Examiner, Art Unit 1636