DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendments to the claims filed April 27, 2026 are acknowledged. Claims 1-16 were cancelled, and claims 17-32 were introduced. Claims 17-32 are pending and under consideration hereinafter.
Priority
Applicant’s priority claims to Application Nos. 63/152,953 and PCT/NZ2022/050020 are acknowledged. Claims 17-32 find support in Application No. 63/152,953 and therefore, the effective filing date of the claims under examination is February 24, 2021.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
I. Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Specifically, the sequence set forth in claim 23 is not identified by a sequence identifier, and the sequence “TAACCACATAACCGCAAGA[X]nTATTGTGCTACTCTCCTCGT” on pg. 10 of the specification is not identified by a sequence identifier.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
II. Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence “TAACCACATAACCGCAAGA[Y]TATTGTGCTACTCTCCTCGT” is set forth throughout the disclosure. The sequence is identified with the sequence identifier “SEQ ID NO: 61.” The sequence listing filed August 24, 2023 only sets forth SEQ ID NOs: 1-60, and no such SEQ ID NO: 61 is provided in the sequence listing.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Drawings
The drawings are objected to because of the following informalities:
The view numbers are preceded by the term “FIGURE.” 37 C.F.R. 1.84(u)(1) states that “view numbers must be preceded by the abbreviation "FIG."
The view numbers for the partial views for Fig. 3 are followed by "(CONTINUED)" instead of a capital letter such as FIG. 1A, FIG. 1B, etc. 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.”
Appropriate correction is required.
Specification
The specification is objected to because of the following informalities:
The specification recites “SS08 (SEQ ID NO: ?)” (pg. 18). The specification does not appear to associate any sequence set forth in the sequence listing with “SS08.” It would be preferable to remove “(SEQ ID NO: ?),” accordingly.
The use of terms which are trade names or marks used in commerce has been noted in this application, e.g., “Alexa Fluor” (pg. 27, line 2) and “Sybr” (at least pg. 37). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms, including the exemplary terms above, should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
The disclosure is also objected to because it contains embedded hyperlinks and/or other form of browser-executable code, i.e., “(http://www.ebi.ac.uk)” (pg. 9), and “https//www.ebi.ac.uk/Tools/msa/clustalo/” (pgs. 12 and 18). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Appropriate correction is required.
Claim Objections
Claims 20, 30-32 are objected to because of the following informalities:
Claim 20 recites “polynucleotide of salt thereof,” which should be amended to recite “polynucleotide or salt thereof.”
Claims 30-31 recite “an aptamer modified with a redox active moiety” which is used to measure binding between the polynucleotide and at least one SARS-Cov-2 antigen. It is reasonably clear based on the specification (e.g., pg. 21) that the claims intend to require that the polynucleotide, not a completely unrelated aptamer, is modified with a redox active moiety. It would be preferable to amend claim 30 to recite, for example, “wherein the polynucleotide is modified with a redox activity moiety and tethered to a metal electrode,” and to amend claim 31 to recite, for example, “wherein the metal electrode is a gold electrode and the presence of the SARS-Cov-2 virus antigen in the test sample is detected by measuring a change in the redox potential of the redox moiety labelled polynucleotide.”
Claim 32 recites “the aptamer.” The specification provides that the term “aptamer” and “polynucleotide” are used interchangeably. Thus, is it reasonably clear that the term “aptamer” refers to the previously recited polynucleotide. The claim should be amended to recite consist terminology, such that the claim either recites “aptamer” or “polynucleotide,” throughout.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 25 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 25 recites that “the Gibbs Free Energy of the polynucleotide or salt thereof is between about -1.0 and about -15.0.” Neither the claim nor specification provide any guidance regarding Gibbs Free Energy. For example, the specification does not describe any conditions under which the polynucleotide must have a Gibbs Free Energy within the range. Gibbs Free Energy for a polynucleotide or salt thereof when measured in the context of binding to a target (rather than, e.g., folding of the polynucleotide), depends on the experimental conditions, e.g., the affinity for a target, the temperature of the experiment, etc. The structural implications for the polynucleotide or salt thereof are unclear, because a polynucleotide or salt thereof tested in one condition may have a Gibbs Free Energy within the claimed range, but tested in another condition, may not.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 17-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states the following:
“The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus.”
“Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).”
Species Encompassed – Claims 17-25
Claim 17 recites a “polynucleotide or salt thereof comprising or consisting in a sequence that has at least 75…, 99% or 100% sequence identity to any one of SEQ ID Nos: 1, 3, 5, 7, 9, 11 and 13….” The specification does not set forth a definition for the phrase “consisting in.” The term “consist in” means to “have something as a main and necessary part or quality” according to the Cambridge Dictionary. Accordingly, a polynucleotide or salt thereof “consisting in” a sequence that has at least 75% identity to any one of the recited SEQ ID NOs would be interpreted as referring to any two or more linked nucleotides within a sequence that has at least 75% identity to any one of the recited SEQ ID NOs. Claim 17 also encompasses a polynucleotide or salt thereof comprising a sequence that has at least 75% sequence identity to one of the recited SEQ ID NOs.
Claim 18 is interpreted as encompassing polynucleotides comprising the sequence of SEQ ID NO: 3, 7, or 13, or consisting in the sequence of SEQ ID NO: 3, 7, or 13, which is interpreted as referring to any two or more linked nucleotides within one of the recited SEQ ID NOs. Claim 19 is interpreted as encompassing polynucleotides comprising the sequence of SEQ ID NO: 3, or consisting in the sequence of SEQ ID NO: 3, which is interpreted as referring to any two or more linked nucleotides within SEQ ID NO: 3.
Claims 20-22 are interpreted as encompassing polynucleotides or salts thereof comprising a sequence at least 75% identical to any one of the recited SEQ ID NOs, wherein the polynucleotide has a sequence length of between about 65 to about 85 nucleotides, wherein “about” is interpreted as referring to plus or minus 10% of each numerical value in the range (pg. 8).
Claim 23 is interpreted as encompassing a polynucleotide or salt thereof comprising the recited sequence, wherein [Y] is a nucleic acid sequence comprising or consisting in any one of the recited SEQ ID NOs, wherein, as stated above, “consisting in” is interpreted as any two or more linked nucleotides within a recited SEQ ID NO.
Each of claims 17-23 recite that the polynucleotides or salts thereof have the function of selectively binding to a SARS-Cov-2 nucleocapsid protein (i.e., with respect to claims encompassing SEQ ID NOs: 1-14), or to a SARS-Cov-2 spike protein (i.e., with respect to claims encompassing SEQ ID NOs: 15-60). Claims 24-25 recite additional functional limitations to the polynucleotides of claim 17, with respect to the “binding affinity,” or “Gibbs Free Energy” of the polynucleotides.
Together, claims 17-25 encompass a genus of polynucleotides or salts thereof, wherein the polynucleotides or salts thereof have the function of selectively binding to a SARS-Cov-2 nucleocapsid protein or a SARS-Cov-2 spike protein. The claims also encompass polynucleotides with a range of binding affinities for a SARS-Cov-2 virus antigen and a range of Gibbs Free Energy. It is noted that the genus of claims 17, 20, and 24-25 essentially encompasses virtually any polynucleotide, of virtually any sequence, owing to the phrase “consisting in,” which is interpreted as any two or more linked nucleotides of a sequence having between 75%-100% to a recited SEQ ID NO; in other words, the any two or more linked nucleotides of the polynucleotide need not even be within a region having identity to the SEQ ID NO based on the current claim language (“A polynucleotide… consisting in a sequence that has at least 75… identity to any one of SEQ ID Nos…”). The specification has not sufficiently described the genus of polynucleotides or salts thereof which selectively binding to a SARS-Cov-2 nucleocapsid protein or a SARS-Cov-2 spike protein, or which have a binding affinity or Gibbs Free Energy within the recited ranges.
Species Disclosed in the Specification
The specification discloses polynucleotides which consist of the sequences set forth in SEQ ID NOs: 1-60 (Figs. 1-4). The specification describes that the “aptamers described herein were generated/selected using generated/selected using affinity matrix-based systematic evolution of ligands by exponential enrichment (SELEX), capture SELEX, or in silico SELEX methodologies” (pg. 35). The specification, while disclosing SEQ ID NOs: 1-60, does not demonstrate that each of SEQ ID NOs: 1-60 selectively bind to a SARS-Cov-2 nucleocapsid protein or a SARS-Cov-2 spike protein. The specification only describes three polynucleotides with such selective binding: a polynucleotide consisting of SEQ ID NO: 3 (“N06”), SEQ ID NO: 7 (“N08”), or SEQ ID NO: 13 (“N11”), each of which selectively bind to a SARS-Cov-2 nucleocapsid protein (Examples 3-7, pg. 38-41; Fig. 7A-C). The specification describes that each polynucleotide consisting of SEQ ID NO: 3, 7, or 13 has a binding affinity (Kd) within the range recited in claim 24 (“Figures 7A-7C show…,” pg. 3). The specification does not describe the Gibbs Free Energy of any of SEQ ID NOs: 1-60.
The specification also provides evidence that several SEQ ID NOs do not selectively bind to a SARS-Cov-2 nucleocapsid protein or a SARS-Cov-2 spike protein. For example, SEQ ID NO: 10 (“N09”) as shown in Fig. 7D, and SEQ ID NOs: 17 (“SS04”), 23 (“SS19”), 25 (“SS12”), 27 (“SS18”), 29 (“SS20”), and 55 (“SS48”) as shown in Figs. 8A-G.
Taken together, the specification describes 3 species with the genus of polynucleotides which have the recited function(s): i.e., the sequences of SEQ ID NOs: 3, 7, and 13. The specification does not provide any guidance to determine which nucleotides of the aforementioned SEQ ID NOs may be varied so as to retain the recited function(s). The specification does not provide any guidance to determine which of the untested SEQ ID NOs have the recited function(s). The specification does not provide any guidance to determine which variants of the untested SEQ ID NOs, or remaining species encompassed by the genus, which have virtually unlimited sequences, would have the recited function(s). The specification also provides evidence that the skilled artisan could not predict whether a polynucleotide will selectively bind to a SARS-Cov-2 antigen, even when the polynucleotide is generated or selected using SELEX methodologies which are designed to prepare aptamers which bind to a desired target.
Guidance in the Prior Art
A thorough search of the prior art failed to uncover any polynucleotide or salt thereof comprising or consisting of a sequence at least 75% sequence identical to one of SEQ ID NOs: 1-60. Polynucleotides which selectively bind to a SARS-Cov-2 virus nucleocapsid or spike protein were known in the prior art. However, the prior art polynucleotides do not appear to meet the scope of the claims as presently examined. As stated above, the search failed to uncover prior art polynucleotides which comprise at least 75% sequence identity to one of the SEQ ID NOs, and the prior art polynucleotides also do not appear to “consist in” one of the recited SEQ ID NOs. The prior art polynucleotides do not provide predictability for the many, virtually unlimited sequences encompassed by the claims, or the specific sequences set forth in the SEQ ID NOs, because the prior art teaches that aptamer technology is unpredictable. See, for example, Emami (Emami et al., 2020, Journal of Theoretical Biology, 497 (2020), pg. 1-14) which provides that SELEX “success rates are relatively low,” and “often fail[] to enrich high-affinity aptamers,” and that despite the use of various computational tools, the skilled artisan cannot yet predict the structures of aptamers which will selectively bind to a target (Abstract, pg. 1; Introduction, pg. 2; Conclusion, pg. 12).
Conclusion
Considering the large variation in the genus, the small percentage of species described in the specification, and the lack of predictability provided by the art for the full scope of the claimed genus, it is reasonable to conclude that Applicant did not possess the invention as claimed at the time of filing.
Claims 26-32
Claims 26-28 are rejected for depending from claim 17 and failing to remedy the written description issues described above. The claims encompass polynucleotides or salts thereof modified with a detectable label, e.g., a redox active moiety, or methylene blue or a derivative thereof. Detectable labels, including redox activity moieties, would be known to the skilled artisan, as would means to modify nucleic acids with such labels. However, with respect to claim 28, the specification does not describe any “derivative molecules” of methylene blue, or provide any guidance as to the structures of the derivatives that would be “detectable,” e.g., by redox activity. Derivative molecules of methylene blue are known, or could be synthesized using known means in the art, but the prior art does not appear to provide sufficient guidance for the skilled artisan to determine which of the many possible derivatives, with any number of structural changes relative to the structure of methylene blue would be “detectable,” e.g., by redox activity.
Claims 29-32 encompass polynucleotides or salts thereof comprising or consisting in a sequence defined in any one of SEQ ID NOs: 1-60, wherein, as stated above “consisting in” is interpreted as any two or more linked nucleotides within a recited SEQ ID NO. The polynucleotides or salts thereof have the function of selectively binding to a SARS-Cov-2 nucleocapsid protein (i.e., with respect to SEQ ID NOs: 1-14), or to a SARS-Cov-2 spike protein (i.e., with respect to SEQ ID NOs: 15-60). As described above, the specification has not sufficiently described polynucleotides or salts thereof which comprise a sequence defined in one of SEQ ID NOs: 1-60 which have the function of selectively binding to a SARS-Cov-2 nucleocapsid or spike protein, nor has the specification sufficiently described polynucleotides or salts thereof which “consist in” a sequence defined in one of SEQ ID NOs: 1-60 which have the function of selectively binding to a SARS-Cov-2 nucleocapsid or spike protein. These claims also encompass polynucleotides or salts thereof which are insufficiently described for the reasons described above.
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
Claims 29-31 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for methods of detecting the presence of a SARS-Cov-2 virus in a test sample comprising contacting a test sample with a polynucleotide consisting of SEQ ID NO: 3, 7, or 13, does not reasonably provide enablement for methods comprising contacting a test sample with any other polynucleotides encompassed by the claims. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make or use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor, but rather is a conclusion reached by weighing many factors. These factors were outlined in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention and Breadth of the Claims
Claims 29-31 are directed to methods for detecting the presence of a SARS-Cov-2 virus in a test sample, comprising contacting the test sample with a polynucleotide or salt thereof comprising or consisting in a sequence defined by any one of SEQ ID NOs: 1-14, and/or 15-60, and measuring binding between the polynucleotide and at least one SARS-Cov-2 virus antigen (understood to refer to the nucleocapsid or spike protein previously recited), wherein a measured binding interaction indicates the presence of a SARS-Cov-2 virus antigen in the test sample. The claims also encompass methods in which the polynucleotide is modified with a redox active moiety and a change in redox potential indicates the presence of the SARS-Cov-2 antigen.
Enablement of the claims requires that one of ordinary skill be able to detect the presence of a SARS-Cov-2 virus in a test sample using any polynucleotide encompassed by the claims, based on the binding between the polynucleotide and at least one SARS-Cov-2 virus antigen (understood to refer to the nucleocapsid or spike protein previously recited).
Guidance in the Specification
The guidance in the specification with respect to the polynucleotides encompassed by the claims which would be predicted to function in the detection methods is described above. Based on the analysis above, the only polynucleotides disclosed in the specification which would be predicted to function in the method are the polynucleotides consisting of SEQ ID NOs: 3, 7, and 13.
Guidance in the Prior Art
The guidance in the prior art with respect to the polynucleotides encompassed by the claims which would be predicted to function in the detection methods is described above and applied hereinafter. As stated therein, the prior art does describe polynucleotides which selectively bind to a SARS-Cov-2 virus nucleocapsid protein or spike protein, as well as methods substantially identical to the claimed methods, i.e., comprising a methylene blue-redox labeled SARS-Cov-2 spike protein-binding aptamer tethered to a gold electrode (see Zakashansky et al., 12 February 2021, Anal. Methods, 13, pg. 874-883). The prior art does not provide any additional predictability for SEQ ID NOs: 1-60 disclosed in the specification; the only polynucleotides disclosed in the specification which would be predicted to function in the method are the polynucleotides consisting of SEQ ID NOs: 3, 7, and 13. The prior art also establishes that aptamer function is unpredictable, even when aptamers are prepared using SELEX methodologies, which are designed to provide aptamers which specifically bind to a desired target. See, for example, Emami (Emami et al., 2020, Journal of Theoretical Biology, 497 (2020), pg. 1-14) which provides that SELEX “success rates are relatively low,” and “often fail[] to enrich high-affinity aptamers,” and that despite the use of various computational tools, the skilled artisan cannot yet predict the structures of aptamers which will selectively bind to a target (Abstract, pg. 1; Introduction, pg. 2; Conclusion, pg. 12).
Experimentation Required and Level of Skill in the Art
In order to practice the invention, a large amount of highly unpredictable experimentation would be required. The skilled artisan would need to prepare members of the genus of polynucleotides encompassed by the claims. The skilled artisan would then need to determine whether the polynucleotides, when in contact with a test sample, actually detect the presence of SARS-Cov-2 virus in the test sample. The skilled artisan could prepare polynucleotides encompassed by the claims, and test whether they detect the presence of SARS-Cov-2 virus in a test sample based on the level of skill in the art. However, the amount of experimentation required to practice the methods across their full scope is undue at least because the genus of polynucleotides encompassed by the claims is massive, and structurally diverse, and neither the specification nor prior art provide sufficient guidance for the skilled artisan to predict which of the polynucleotides encompassed by the claims would actually work in the method. Indeed, the specification provides evidence that even when polynucleotides are prepared using methodology designed to provide aptamers which specifically bind to a desired target (i.e., SELEX), non-functional polynucleotides are produced. In order to practice the methods, the skilled artisan would essentially need to engage in a massive and unpredictable screening effort.
Conclusion
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the guidance provided in the specification, the lack of working examples to meet the scope of the claims, and the lack of predictability in the specification and prior art for the polynucleotides encompassed by the methods, it is the conclusion that undue experimentation would be required to make and use the invention as claimed.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights