Prosecution Insights
Last updated: July 17, 2026
Application No. 18/279,038

METHOD FOR PRODUCING ALFALFA MOSAIC VIRUS-LIKE PARTICLES USING PLANT EXPRESSION SYSTEM AND USE THEREOF

Final Rejection §103§Other
Filed
Aug 25, 2023
Priority
Feb 25, 2021 — RE 10-2021-0025902 +1 more
Examiner
STOCKDALE, JESSICA NICOLE
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
BIOAPPLICATIONS INC
OA Round
2 (Final)
43%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allowance Rate
13 granted / 30 resolved
-16.7% vs TC avg
Strong +44% interview lift
Without
With
+44.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
27 currently pending
Career history
69
Total Applications
across all art units

Statute-Specific Performance

§101
0.6%
-39.4% vs TC avg
§103
69.8%
+29.8% vs TC avg
§102
8.9%
-31.1% vs TC avg
§112
11.7%
-28.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 30 resolved cases

Office Action

§103 §Other
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims Claims 8, 15-16, and 24 are canceled. Claims 1-7, 9-14, and 17-23 are pending. Claims 7, 9-14, and 17-23 are drawn to a non-elected invention and therefore withdrawn from consideration. Claims 1-6 are examined herein. The previous objections to claims 1 and 4 are withdrawn in view of Applicant’s amendments. Claims 1-6 are rejected. Priority Application No. 18/279,038 filed on 08/25/2023 is a 371 of PCT Application No. PCT/KR2022/002106 filed on 02/11/2022, and also claims foreign priority to Korean Patent Application No. KR10-2021-0025902 filed on 02/25/2021. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Applicant states in Remarks date 03/30/2026 “Applicant hereby submits a certified translation of the priority document, Korean Application No. KR10-2021-0025902, which was filed on February 25, 2021.” However, a certified English translation of the priority document was not submitted in Applicant’s response despite this statement. A certified English translation of neither PCT Application No. PCT/KR2022/002106 nor Korean Application No. KR10-2021-0025902 has been filed. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-6 are rejected under 35 U.S.C. 103 as being unpatentable over Chu (US-20040068764-A1), Sohn (CA-3119964-A1, published 05/22/2020), and Ullrich (Ullrich, K. K., Hiss, M., & Rensing, S. A. (2015). Means to optimize protein expression in transgenic plants. Current opinion in biotechnology, 32, 61-67.). This is a modified rejection from the previous rejection set forth in the Office Action dated 12/29/2025, necessitated by Applicant’s amendments to the claims. Claim 1 is drawn to a recombinant vector for expression in a plant, comprising: a polynucleotide encoding a Rubisco transit peptide comprising the amino acid sequence represented by SEQ ID NO: 2; and a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 encoding an Alfalfa mosaic virus (AMV) capsid protein. Claim 2 is drawn to the recombinant vector of claim 1, wherein the polynucleotide encoding a Rubisco transit peptide comprises the nucleotide sequence represented by SEQ ID NO: 1. Claim 3 is drawn to the recombinant vector of claim 1, wherein the recombinant vector further comprises a polynucleotide encoding a polyhistidine-tag comprising the amino acid sequence represented by SEQ ID NO: 6. Claim 4 is drawn to the recombinant vector of claim 3, wherein the polyhistidine-tag is linked to the C-terminal end or the N-terminal end of the polynucleotide encoding an AMV capsid protein. Claim 5 is drawn to the recombinant vector of claim 3, wherein in the recombinant vector, between a promoter and a terminator, (1) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding an AMV capsid protein and a polynucleotide encoding a polyhistidine-tag are sequentially linked; or (2) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polyhistidine-tag and a polynucleotide encoding an AMV capsid protein are sequentially linked. Claim 6 is drawn to a transgenic plant, which is transformed with the recombinant vector according to claim 1. Regarding claim 1, Chu teaches an invention related to a method of enhancing virus-resistance in plants (title) by introducing into the plants gene constructs comprising gene sequences encoding the coat proteins of viruses (abstract, ¶0025). Specifically, Chu teaches introducing into a plant an isolated nucleic acid molecule comprising a nucleotide encoding a virus-encoded coat protein that is an alfalfa mosaic virus (AMV) coat protein (claims 1 and 3 of Chu). Chu teaches the AMV virus-encoded coat protein comprises an amino acid sequence of SEQ ID NO: 8 (claim 9 of Chu) which has 100% sequence identity to the protein that is encoded by instant SEQ ID NO: 3 (see alignment below). Chu also teaches increased levels of coat protein expression increased resistance/ immunity against AMV (¶0417). Regarding claim 6, Chu also teaches a transformed plant comprising the AMV virus encoded coat protein comprising the amino acid sequence of SEQ ID NO: 8 of Chu which is 100% identical to the protein encoded by the nucleotide sequence of instant SEQ ID NO: 3 (see alignments below) (Claims 32, 34, and 40 of Chu). However, Chu does not explicitly teach: the recombinant expression vector comprises a polynucleotide encoding a Rubisco transit peptide comprising the amino acid sequence represented by SEQ ID NO: 2, and the AMV virus-encoded coat protein is encoded by a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 (a codon-optimized sequence for expression in Nicotiana benthamiana according to the spec, p. 34) (remaining limitation of claim 1) wherein the polynucleotide encoding a Rubisco transit peptide comprises the nucleotide sequence represented by SEQ ID NO: 1 (remaining limitation of claim 2) wherein the recombinant vector further comprises a polynucleotide encoding a polyhistidine-tag comprising the amino acid sequence represented by SEQ ID NO: 6 (claim 3) wherein the polyhistidine-tag is linked to the C-terminal end or the N-terminal end of the polynucleotide encoding an AMV capsid protein (claim 4) wherein in the recombinant vector, between a promoter and a terminator, (1) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding an AMV capsid protein and a polynucleotide encoding a polyhistidine-tag are sequentially linked; or (2) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polyhistidine-tag and a polynucleotide encoding an AMV capsid protein are sequentially linked (claim 5) In analogous art, Sohn teaches an invention related to expression of virus-like particles in a plant using recombinant vectors (title), and teaches when a Rubisco transit peptide is fused to a virus-like particle that is a target protein in a transgenic plant, expression of the target protein in the transgenic plant is increased (p. 5, lines 10-18, p. 14, lines 4-11). In other analogous art, Ullrich teaches in a review paper various means to optimize protein expression in transgenic plants (title). Specifically regarding the remaining limitation of claim 1, Sohn teaches the Rubisco transit peptide comprises an amino acid sequence of SEQ ID NO: 1 of Sohn which has 100% sequence identity to instant SEQ ID NO: 2 (claim 1 of Sohn) (see alignment below). Furthermore, Ullrich teaches one important step in introducing a transgene for protein production comprises altering the codon usage to match the host genome, and codon usage data for some plants (including Nicotiana benthamiana) can be found in the ‘codon usage database’ (http://www.kazusa.or.jp/codon/) (p. 62, section titled Nucleotide frequencies of mRNA (codon usage and GC content)). Specifically regarding the remaining limitation of claim 2, Sohn teaches the Rubisco transit peptide is encoded by a nucleotide sequence comprising SEQ ID NO: 2 of Sohn which has 100% sequence identity to instant SEQ ID NO: 1 (claim 2 of Sohn) (see alignment below). Regarding claim 3, Sohn teaches the recombinant vector further comprises a polynucleotide encoding a polyhistidine-tag encoding the amino acid sequence of SEQ ID NO: 7 of Sohn, which is 6 consecutive histidines and is 100% identical to instant SEQ ID NO: 6 (Fig. 1, SEQ ID NO: 7, and claim 3 of Sohn). Regarding claim 4, Sohn teaches the recombinant vector is characterized in that a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polydistidine tag, and a polynucleotide encoding a capsid protein (a PCV2 capsid protein in this particular invention) are sequentially linked between a promoter and a terminator (i.e. the polyhistidine tag is linked to the N-terminal of the capsid protein) (claim 4 of Sohn). Regarding claim 5, Sohn teaches the recombinant vector is characterized in that a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polydistidine tag, and a polynucleotide encoding a capsid protein (a PCV2 capsid protein in this particular invention) are sequentially linked between a promoter and a terminator (i.e. a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polyhistidine-tag and a polynucleotide encoding a capsid protein are sequentially linked) (claim 4 of Sohn). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Chu to include the limitations of Sohn and Ullrich to arrive at the instantly claimed method with a reasonable expectation of success because incorporation of the capsid protein taught by Chu and the vector components of a histidine tag and rubisco transit peptide taught by Sohn into a single recombinant vector for expression in transgenic plants could be achieved by one of ordinary skill in the art without encountering any special technical difficulties. One of ordinary skill would also have a reasonable expectation of success of arriving at the sequence of instant SEQ ID NO: 3 without encountering any special technical difficulties because it is a codon optimized sequence for expression in Nicotiana benthamiana, and codon optimization of proteins for expression in various plants is known and routinely utilized to optimize protein production, and various databases and software are available to optimize codon usage in various plant species such as the codon usage database taught by Ullrich (p. 62). One having ordinary skill in the art would have been motivated to combine the teachings because Chu teaches increased levels of AMV coat protein expression increased resistance/ immunity against AMV in plants (¶0417), and Sohn teaches when a RuBisCO transit peptide is fused to a target protein and a polyhistidine was attached for isolation and purification so as to be targeted to chloroplasts in order to increase the expression level of the protein in the translation stage, the expression level and isolation and purification efficiency of the protein were increased, and confirmed that target protein production efficiency could be dramatically increased in the transgenic plant (p. 5, lines 10-18). Therefore, it would have been obvious to combine the teachings to increase expression of the target peptide, AMV taught by Chu, using the additional recombinant vector components taught by Sohn to increase AMV capsid protein expression and as a result increase resistance/ immunity to AMV in transgenic plants. Furthermore, one having ordinary skill in the art would have been motivated to combine the teaching of Chu and Ullrich because Ulrich teaches an important step in introducing a transgene for optimizing protein expression/ production comprises altering the codon usage to match the host genome (title, p. 62). Therefore, it would have been obvious to combine the teachings for the purpose of optimizing protein expression/ production in the plant species of interest. Claims 1-2 and 6 are further rejected under 35 U.S.C. 103 as being unpatentable over Chu (US-20040068764-A1), Almeida (De Almeida, Elionor RP, et al. "Transgenic expression of two marker genes under the control of an Arabidopsis rbcS promoter: Sequences encoding the Rubisco transit peptide increase expression levels." Molecular and General Genetics MGG 218.1 (1989): 78-86), Hwang (US-10239928-B2), and Ullrich (Ullrich, K. K., Hiss, M., & Rensing, S. A. (2015). Means to optimize protein expression in transgenic plants. Current opinion in biotechnology, 32, 61-67.). This is a modified rejection from the previous rejection set forth in the Office Action dated 12/29/2025, necessitated by Applicant’s amendments to the claims. Claim 1 is drawn to a recombinant vector for expression in a plant, comprising: a polynucleotide encoding a Rubisco transit peptide comprising the amino acid sequence represented by SEQ ID NO: 2; and a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 encoding an Alfalfa mosaic virus (AMV) capsid protein. Claim 2 is drawn to the recombinant vector of claim 1, wherein the polynucleotide encoding a Rubisco transit peptide comprises the nucleotide sequence represented by SEQ ID NO: 1. Claim 6 is drawn to a transgenic plant, which is transformed with the recombinant vector according to claim 1. Regarding claim 1, Chu teaches an invention related to a method of enhancing virus-resistance in plants (title) by introducing into the plants gene constructs comprising gene sequences encoding the coat proteins of viruses (abstract, ¶0025). Specifically, Chu teaches introducing into a plant an isolated nucleic acid molecule comprising a nucleotide encoding a virus-encoded coat protein that is an alfalfa mosaic virus (AMV) coat protein (claims 1 and 3 of Chu). Chu teaches the AMV virus-encoded coat protein comprises an amino acid sequence of SEQ ID NO: 8 (claim 9 of Chu) which has 100% sequence identity to the protein that is encoded by instant SEQ ID NO: 3 (see alignment below). Chu also teaches increased levels of coat protein expression increased resistance/ immunity against AMV (¶0417). Regarding claim 6, Chu also teaches a transformed plant comprising the AMV virus encoded coat protein comprising the amino acid sequence of SEQ ID NO: 8 of Chu which is 100% identical to the protein encoded by the nucleotide sequence of instant SEQ ID NO: 3 (see alignments below) (Claims 32, 34, and 40 of Chu). However, Chu does not explicitly teach: the recombinant expression vector comprises a polynucleotide encoding a Rubisco transit peptide comprising the amino acid sequence represented by SEQ ID NO: 2, and the AMV virus-encoded coat protein is encoded by a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 (a codon-optimized sequence for expression in Nicotiana benthamiana according to the spec, p. 34) (remaining limitation of claim 1) wherein the polynucleotide encoding a Rubisco transit peptide comprises the nucleotide sequence represented by SEQ ID NO: 1 (remaining limitation of claim 2) In analogous art, Almeida teaches the rubisco transit peptide increases expression levels of transgenes in transgenic plants (title, summary), and specifically teaches the transit peptide is linked to the N-terminal of the target protein (Fig. 1 A-B). In other analogous art, Hwang teaches a rubisco transit peptide (SEQ ID NO: 11 of Hwang) that comprises an amino acid sequence with 100% sequence identity to instant SEQ ID NO: 2 (see alignment below). Hwang further teaches the rubisco transit peptide is encoded by a polynucleotide (SEQ ID NO: 10 of Hwang) that comprises a nucleotide sequence having 100% sequence identity to instant SEQ ID NO: 1 (see alignment below). In other analogous art, Ullrich teaches in a review paper various means to optimize protein expression in transgenic plants (title). Ullrich teaches one important step in introducing a transgene for protein production comprises altering the codon usage to match the host genome, and codon usage data for some plants (including Nicotiana benthamiana) can be found in the ‘codon usage database’ (http://www.kazusa.or.jp/codon/) (p. 62, section titled Nucleotide frequencies of mRNA (codon usage and GC content)). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Chu to include the limitations of Almeida, Hwang, and Ullrich to arrive at the instantly claimed method with a reasonable expectation of success because incorporation of a rubisco transit peptide into the plant expression construct taught by Chu could be achieved by one having ordinary skill in the art without encountering any special technical obstacles. One of ordinary skill would also have a reasonable expectation of success of arriving at the sequence of instant SEQ ID NO: 3 without encountering any special technical difficulties because it is a codon optimized sequence for expression in Nicotiana benthamiana, and codon optimization of proteins for expression in various plants is known and routinely utilized to optimize protein production, and various databases and software are available to optimize codon usage in various plant species such as the codon usage database taught by Ullrich (p. 62). One having ordinary skill in the art would have been motivated to combine the teachings because Chu also teaches increased levels of coat protein expression increased plant resistance/ immunity against AMV (¶0417), and Almeida teaches the transit peptide linked to the N terminal of a target protein increases expression levels (title, abstract, Fig. 1 A-B). Therefore, it would have been obvious to combine the teachings to increase expression of the target peptide, AMV taught by Chu, using the rubisco transit peptide taught by Almeida to increase AMV capsid protein expression and as a result increase resistance/ immunity to AMV in transgenic plants. Furthermore, one having ordinary skill in the art would have been motivated to combine the teachings with Hwang because Hwang taught a known and readily obtainable nucleotide and amino acid sequence of the rubisco transit peptide. Furthermore, one having ordinary skill in the art would have been motivated to combine the teachings with Ullrich because Ulrich teaches an important step in introducing a transgene for optimizing protein expression/ production comprises altering the codon usage to match the host genome (title, p. 62). Therefore, it would have been obvious to combine the teachings for the purpose of optimizing protein expression/ production of the AMV capsid protein in the plant species of interest. Claims 3-5 are rejected under 35 U.S.C. 103 as being unpatentable over Chu, Almeida, Hwang, and Ullrich as applied to claim 1 above, and further in view of Lee (KR-102077772-B1). This is a modified rejection from the previous rejection set forth in the Office Action dated 12/29/2025, necessitated by Applicant’s amendments to the claims. Claim 3 is drawn to the recombinant vector of claim 1, wherein the recombinant vector further comprises a polynucleotide encoding a polyhistidine-tag comprising the amino acid sequence represented by SEQ ID NO: 6. Claim 4 is drawn to the recombinant vector of claim 3, wherein the polyhistidine-tag is linked to the C-terminal end or the N-terminal end of the polynucleotide encoding an AMV capsid protein. Claim 5 is drawn to the recombinant vector of claim 3, wherein in the recombinant vector, between a promoter and a terminator, (1) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding an AMV capsid protein and a polynucleotide encoding a polyhistidine-tag are sequentially linked; or (2) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polyhistidine-tag and a polynucleotide encoding an AMV capsid protein are sequentially linked. Regarding claims 3-5, Chu, Almeida, Hwang, and Ullrich teach the limitations of claim 1 as set forth in the previous obviousness rejection. The teachings of Chu, Almeida, Hwang, and Ullrich as they are applied to claim 1 are set forth previously herein and are incorporated by reference. Further regarding claim 3, Chu also teaches detecting the level of expression of the introduced nucleotide sequence may be determined by ELISA or western blot (¶0092). Further regarding claim 5, Chu also teaches the AMV coat protein coding sequence was inserted in the vector between a promoter and a terminator (¶0248). However, Chu does not explicitly teach: wherein the recombinant vector further comprises a polynucleotide encoding a polyhistidine-tag comprising the amino acid sequence represented by SEQ ID NO: 6 (claim 3) wherein the polyhistidine-tag is linked to the C-terminal end or the N-terminal end of the polynucleotide encoding an AMV capsid protein (claim 4) wherein in the recombinant vector, between a promoter and a terminator, (1) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding an AMV capsid protein and a polynucleotide encoding a polyhistidine-tag are sequentially linked; or (2) a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding a polyhistidine-tag and a polynucleotide encoding an AMV capsid protein are sequentially linked (claim 5) In analogous art, Lee teaches an invention related to a virus for expression in plants (abstract), and teaches 6 consecutive histidines (i.e. 100% identical to instant SEQ ID NO: 6) are added to the C-terminal of the virus target protein (Fig. 1). Lee teaches the polyhistidine tag allowed confirmation of the target protein expression via Western blot (example 2 of Lee). Additionally, because Chu teaches the AMV protein is located between a promoter and terminator (¶0248), and Almeida teaches the rubisco transit peptide is linked at the N- terminal of a target peptide (Fig. 1A-B), and Lee teaches the histidine tag is linked at the C terminal of a target protein, the combination of the teachings would satisfy the limitations of instant claim 5 (i.e. wherein between a promoter and a terminator, a polynucleotide encoding a Rubisco transit peptide, a polynucleotide encoding an AMV capsid protein and a polynucleotide encoding a polyhistidine-tag are sequentially linked). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Chu, Almeida, Hwang, and Ullrich to include the limitations Lee to arrive at the instantly claimed method with a reasonable expectation of success because incorporation of the 6His-tag at the C terminal of a target protein (as taught by Lee), specifically the AMV target protein taught by Chu, could be achieved by one of ordinary skill in the art without encountering any special technical difficulties. One having ordinary skill in the art would have been motivated to combine the teachings because the addition of a His-tag would allow for confirmation of target protein expression via Western blot (example 2 of Lee), therefore providing a method of confirmation of transgenic plants. Alignments Alignment of instant SEQ ID NO: 3 encoding SEQ ID NO: 8 of Chu: RESULT 1 US-10-432-008-8 (NOTE: this sequence has 15 duplicates in the database searched. See complete list at the end of this report) Sequence 8, US/10432008 Publication No. US20040068764A1 GENERAL INFORMATION APPLICANT: Paul Wing Gay CHU APPLICANT: Ronald George GARRETT APPLICANT: Sten Roger KALLA APPLICANT: German Carlos SPANGENBERG APPLICANT: Philip John LARKIN APPLICANT: Thomas Joseph HIGGINS TITLE OF INVENTION: METHOD OF ENHANCING VIRUS-RESISTANCE IN PLANTS AND PRODUCING VIRUS-IMMUNE TITLE OF INVENTION: PLANTS FILE REFERENCE: 0626/69458 CURRENT APPLICATION NUMBER: US/10/432,008 CURRENT FILING DATE: 2003-05-16 NUMBER OF SEQ ID NOS: 56 SEQ ID NO 8 LENGTH: 221 TYPE: PRT ORGANISM: alfalfa mosaic virus strain 425M Alignment Scores: Length: 221 Score: 1171.00 Matches: 221 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-18-279-038-3 (1-663) x US-10-432-008-8 (1-221) Qy 1 ATGAGTTCTTCACAAAAGAAAGCTGGTGGTAAAGCTGGTAAGCCTACTAAGAGATCTCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 MetSerSerSerGlnLysLysAlaGlyGlyLysAlaGlyLysProThrLysArgSerGln 20 Qy 61 AACTATGCTGCCTTACGGAAAGCTCAGCTTCCGAAACCACCGGCCTTGAAGGTCCCAGTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21 AsnTyrAlaAlaLeuArgLysAlaGlnLeuProLysProProAlaLeuLysValProVal 40 Qy 121 GTAAAGCCAACAAATACAATACTGCCACAGACTGGTTGCGTTTGGCAATCGTTAGGGACG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 41 ValLysProThrAsnThrIleLeuProGlnThrGlyCysValTrpGlnSerLeuGlyThr 60 Qy 181 CCTTTGAGTCTTTCATCTTTTAATGGATTAGGTGTTAGATTCCTTTATAGTTTTCTTAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ProLeuSerLeuSerSerPheAsnGlyLeuGlyValArgPheLeuTyrSerPheLeuLys 80 Qy 241 GACTTTGCAGGACCAAGAATCCTCGAAGAAGATCTGATTTACAGGATGGTGTTTTCCATT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 81 AspPheAlaGlyProArgIleLeuGluGluAspLeuIleTyrArgMetValPheSerIle 100 Qy 301 ACACCCAGCTACGCTGGCACCTTTTGTCTTACTGATGACGTGACCACTGAAGATGGTAGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 101 ThrProSerTyrAlaGlyThrPheCysLeuThrAspAspValThrThrGluAspGlyArg 120 Qy 361 GCAGTTGCTCATGGAAATCCTATGCAAGAATTCCCTCACGGCGCATTTCACGCTAATGAA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AlaValAlaHisGlyAsnProMetGlnGluPheProHisGlyAlaPheHisAlaAsnGlu 140 Qy 421 AAGTTTGGGTTTGAGTTGGTTTTTACAGCTCCTACCCATGCTGGAATGCAAAACCAAAAT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 141 LysPheGlyPheGluLeuValPheThrAlaProThrHisAlaGlyMetGlnAsnGlnAsn 160 Qy 481 TTCAAGCATTCCTATGCCGTTGCGTTGTGTTTGGATTTTGACGCACAGCCTGAGGGATCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 161 PheLysHisSerTyrAlaValAlaLeuCysLeuAspPheAspAlaGlnProGluGlySer 180 Qy 541 AAAAATCCTTCATATAGGTTCAACGAGGTCTGGGTTGAGAGAAAAGCATTCCCACGAGCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 LysAsnProSerTyrArgPheAsnGluValTrpValGluArgLysAlaPheProArgAla 200 Qy 601 GGACCCCTACGCTCTTTGATTACTGTAGGACTACTCGATGAAGCTGATGATCTTGATCGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 201 GlyProLeuArgSerLeuIleThrValGlyLeuLeuAspGluAlaAspAspLeuAspArg 220 Qy 661 CAT 663 ||| Db 221 His 221 Alignment of instant SEQ ID NO: 2 with SEQ ID NO: 1 of Sohn: RESULT 2 BHU82489 (NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report) ID BHU82489 standard; peptide; 25 AA. XX AC BHU82489; XX DT 09-JUL-2020 (first entry) XX DE RuBisCO transit peptide, SEQ ID 1. XX KW Ribulose-1,5-Bisphosphate Carboxylase; KW Ribulose-1,5-bisphosphate oxygenase; RuBisCO protein; KW prophylactic to disease; vaccine, antiviral; viral infection; virucide. XX OS Unidentified. XX CC PN WO2020101187-A1. XX CC PD 22-MAY-2020. XX CC PF 16-OCT-2019; 2019WO-KR013581. XX PR 15-NOV-2018; 2018KR-00141184. PR 15-OCT-2019; 2019KR-00127987. XX CC PA (BIOA-) BIOAPPLICATIONS INC. XX CC PI Sohn E, Lee Y, Lee S; XX DR WPI; 2020-43953Q/047. XX CC PT New recombinant vector useful for transforming plants for isolating and CC PT purifying recombinant porcine circovirus 2 capsid protein, contains CC PT polynucleotide encoding ribulose-1,5-bisphosphate carboxylase/oxygenase CC PT transit peptide. XX CC PS Claim 1; SEQ ID NO 1; 37pp; Korean. XX CC The present invention relates to a polynucleotide encoding the RuBisCO CC transit peptide comprising the amino acid sequence represented by SEQ ID CC NO: 1 (see BHU82489), and PCV2 (Porcine circovirus type 2) capsid CC comprising the amino acid sequence represented by SEQ ID NO: 3 (see CC BHU82491) or SEQ ID NO: 5 (see BHU82493). The invention further claims: CC (1) a transformed plant transformed with the recombinant vector; (2) a CC method for isolating and purifying a recombinant PCV2 capsid protein; (3) CC a method for preparing a vaccine composition comprising virus-like CC particles involves (i) transforming a plant using the recombinant vector, CC (ii) separating and purifying PCV2 capsid protein from the transformed CC plant obtained in step (i), and preparing the PCV2 capsid protein as CC virus-like particles, and (iii) preparing a vaccine composition CC comprising virus-like particles obtained in step (ii); (4) a vaccine CC composition prepared by the above method; and (5) a method for preventing CC porcine circovirus infection involves administering to an individual the CC vaccine composition. The recombinant vector is useful for transforming CC plants which is useful for isolating and purifying a recombinant PCV2 CC capsid protein. The composition is useful for preventing porcine CC circovirus infection. The plant is dicotyledonous plant chosen from CC Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, CC chinese cabbage, cabbage and lettuce or monocotyledonous plant chosen CC from rice, barley, wheat, rye, corn, sugarcane, oats, and onions. XX SQ Sequence 25 AA; Query Match 100.0%; Score 130; Length 25; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CMQVWPPIGKKKFETLSYLPDLT 23 ||||||||||||||||||||||| Db 1 CMQVWPPIGKKKFETLSYLPDLT 23 Alignment of instant SEQ ID NO: 1 with SEQ ID NO: 2 of Sohn: RESULT 2 BHU82490 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) ID BHU82490 standard; DNA; 237 BP. XX AC BHU82490; XX DT 09-JUL-2020 (first entry) XX DE RuBisCO transit peptide DNA, SEQ ID 2. XX KW Ribulose-1,5-Bisphosphate Carboxylase; KW Ribulose-1,5-bisphosphate oxygenase; RuBisCo gene; ds; KW prophylactic to disease; vaccine, antiviral; viral infection; virucide. XX OS Unidentified. XX CC PN WO2020101187-A1. XX CC PD 22-MAY-2020. XX CC PF 16-OCT-2019; 2019WO-KR013581. XX PR 15-NOV-2018; 2018KR-00141184. PR 15-OCT-2019; 2019KR-00127987. XX CC PA (BIOA-) BIOAPPLICATIONS INC. XX CC PI Sohn E, Lee Y, Lee S; XX DR WPI; 2020-43953Q/047. XX CC PT New recombinant vector useful for transforming plants for isolating and CC PT purifying recombinant porcine circovirus 2 capsid protein, contains CC PT polynucleotide encoding ribulose-1,5-bisphosphate carboxylase/oxygenase CC PT transit peptide. XX CC PS Claim 2; SEQ ID NO 2; 37pp; Korean. XX CC The present invention relates to a polynucleotide encoding the RuBisCO CC transit peptide comprising the amino acid sequence represented by SEQ ID CC NO: 1 (see BHU82489), and PCV2 (Porcine circovirus type 2) capsid CC comprising the amino acid sequence represented by SEQ ID NO: 3 (see CC BHU82491) or SEQ ID NO: 5 (see BHU82493). The invention further claims: CC (1) a transformed plant transformed with the recombinant vector; (2) a CC method for isolating and purifying a recombinant PCV2 capsid protein; (3) CC a method for preparing a vaccine composition comprising virus-like CC particles involves (i) transforming a plant using the recombinant vector, CC (ii) separating and purifying PCV2 capsid protein from the transformed CC plant obtained in step (i), and preparing the PCV2 capsid protein as CC virus-like particles, and (iii) preparing a vaccine composition CC comprising virus-like particles obtained in step (ii); (4) a vaccine CC composition prepared by the above method; and (5) a method for preventing CC porcine circovirus infection involves administering to an individual the CC vaccine composition. The recombinant vector is useful for transforming CC plants which is useful for isolating and purifying a recombinant PCV2 CC capsid protein. The composition is useful for preventing porcine CC circovirus infection. The plant is dicotyledonous plant chosen from CC Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, CC chinese cabbage, cabbage and lettuce or monocotyledonous plant chosen CC from rice, barley, wheat, rye, corn, sugarcane, oats, and onions. XX SQ Sequence 237 BP; 50 A; 78 C; 48 G; 61 T; 0 U; 0 Other; Query Match 100.0%; Score 231; Length 237; Best Local Similarity 100.0%; Matches 231; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATG 60 Qy 61 GTCGCTCCTTTCAACGGACTTAAGTCCTCCGCTGCCTTCCCAGCCACCCGCAAGGCTAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GTCGCTCCTTTCAACGGACTTAAGTCCTCCGCTGCCTTCCCAGCCACCCGCAAGGCTAAC 120 Qy 121 AACGACACTACTTCCATCACAAGCAACGGCGGAAGAGTTAACTGCATGCAGGTGTGGCCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AACGACACTACTTCCATCACAAGCAACGGCGGAAGAGTTAACTGCATGCAGGTGTGGCCT 180 Qy 181 CCGATTGGAAAGAAGAAGTTTGAGACTCTCTCTTACCTTCCTGACCTTACC 231 ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCGATTGGAAAGAAGAAGTTTGAGACTCTCTCTTACCTTCCTGACCTTACC 231 Alignment of instant SEQ ID NO: 2 with SEQ ID NO: 11 of Hwang: RESULT 4 US-15-597-253-11 Sequence 11, US/15597253 Patent No. 10239928 GENERAL INFORMATION APPLICANT: POSTECH ACADEMY-INDUSTRY FOUNDATION TITLE OF INVENTION: METHOD OF HIGHLY EXPRESSING TARGET PROTEIN FROM PLANT USING RbcS TITLE OF INVENTION: FUSION PROTEIN AND METHOD OF PREPARING COMPOSITION FOR ORAL TITLE OF INVENTION: ADMINISTRATION OF MEDICAL PROTEIN USING TARGET PROTEIN TITLE OF INVENTION: EXPRESSION PLANT BODY FILE REFERENCE: EPL20173015US CURRENT APPLICATION NUMBER: US/15/597,253 CURRENT FILING DATE: 2017-05-17 PRIOR APPLICATION NUMBER: KR 10-2016-0062409 PRIOR FILING DATE: 2016-05-20 PRIOR APPLICATION NUMBER: KR 10-2017-0037747 PRIOR FILING DATE: 2017-03-24 NUMBER OF SEQ ID NOS: 17 SEQ ID NO 11 LENGTH: 80 TYPE: PRT ORGANISM: Artificial FEATURE: OTHER INFORMATION: rbcS transit peptide Query Match 100.0%; Score 130; Length 80; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CMQVWPPIGKKKFETLSYLPDLT 23 ||||||||||||||||||||||| Db 55 CMQVWPPIGKKKFETLSYLPDLT 77 Alignment of instant SEQ ID NO: 1 with SEQ ID NO: 10 of Hwang: RESULT 3 US-15-597-253-10 Sequence 10, US/15597253 Patent No. 10239928 GENERAL INFORMATION APPLICANT: POSTECH ACADEMY-INDUSTRY FOUNDATION TITLE OF INVENTION: METHOD OF HIGHLY EXPRESSING TARGET PROTEIN FROM PLANT USING RbcS TITLE OF INVENTION: FUSION PROTEIN AND METHOD OF PREPARING COMPOSITION FOR ORAL TITLE OF INVENTION: ADMINISTRATION OF MEDICAL PROTEIN USING TARGET PROTEIN TITLE OF INVENTION: EXPRESSION PLANT BODY FILE REFERENCE: EPL20173015US CURRENT APPLICATION NUMBER: US/15/597,253 CURRENT FILING DATE: 2017-05-17 PRIOR APPLICATION NUMBER: KR 10-2016-0062409 PRIOR FILING DATE: 2016-05-20 PRIOR APPLICATION NUMBER: KR 10-2017-0037747 PRIOR FILING DATE: 2017-03-24 NUMBER OF SEQ ID NOS: 17 SEQ ID NO 10 LENGTH: 240 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: rbcS transit peptide Query Match 100.0%; Score 231; Length 240; Best Local Similarity 100.0%; Matches 231; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATG 60 Qy 61 GTCGCTCCTTTCAACGGACTTAAGTCCTCCGCTGCCTTCCCAGCCACCCGCAAGGCTAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GTCGCTCCTTTCAACGGACTTAAGTCCTCCGCTGCCTTCCCAGCCACCCGCAAGGCTAAC 120 Qy 121 AACGACACTACTTCCATCACAAGCAACGGCGGAAGAGTTAACTGCATGCAGGTGTGGCCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AACGACACTACTTCCATCACAAGCAACGGCGGAAGAGTTAACTGCATGCAGGTGTGGCCT 180 Qy 181 CCGATTGGAAAGAAGAAGTTTGAGACTCTCTCTTACCTTCCTGACCTTACC 231 ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCGATTGGAAAGAAGAAGTTTGAGACTCTCTCTTACCTTCCTGACCTTACC 231 Response to Arguments Applicant argues beginning on p. 7 of remarks dated 03/30/2026 the following arguments: Priority The Examiner alleges that a certified translation of the priority Korean Application No. KR10-2021-0025902 has not been filed. Applicant hereby submits a certified translation of the priority document, Korean Application No. KR10-2021-0025902, which was filed on February 25, 2021. Examiner’s response: A certified translation of the priority documents cannot be found in Applicant’s response. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Applicant argues beginning on p. 7 of remarks dated 03/30/2026 the following arguments: Claim Objections The Examiner objected to claim 1 because the Examiner alleges that the claim language of "A recombinant vector for expressing a plant" should be amended to "A recombinant vector for expression in a plant" or another grammatically correct equivalent. Solely to advance prosecution and without acquiescing to the propriety of this objection, claim 1 has been amended to recite "A recombinant vector for expression in a plant," as requested by the Examiner. Applicant respectfully requests this objection be withdrawn. The Examiner objected to claim 4 because the Examiner alleges that the claim language of "C-term end or the N-term end" should be amended to "C-terminal end or the N-terminal end". Solely to advance prosecution and without acquiescing to the propriety of this objection, claim 4 has been amended to recite "C-terminal end or the N-terminal end," as suggested by the Examiner. Applicant respectfully requests this objection be withdrawn. Examiner’s response: The objections to the claims have been withdrawn in view of Applicant’s amendments. Applicant argues beginning on p. 9 of remarks dated 03/30/2026 the following arguments: 35 U.S.C. 103 1. A prima facie case of obviousness has not been established Claims 1-6 in view of Chu and Sohn Claim 1, as amended, recites that the recombinant vector comprises, inter alia, "a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 encoding an Alfalfa mosaic virus (AMV) capsid protein." Neither Chu nor Sohn teach or suggest a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein, nor are they alleged to do so. Rather, Chu is cited in the context of dependent claim 2 for allegedly teaching an AMV-encoded coat protein encoded by a nucleotide sequence having 100% sequence identity to SEQ ID NO: 10 of previous claim 2. However, Chu does not teach or suggest a nucleotide sequence of SEQ ID NO: 3 as recited in present independent claim 1. Moreover, Sohn also does not teach or suggest a nucleotide sequence of SEQ ID NO: 3 as recited in present independent claim 1, nor is it alleged to do so. In fact, the nucleotide sequence of SEQ ID NO: 3 is a sequence that encodes an AMV capsid protein that exhibits a substantial amount of sequence variation from other AMV capsid-related gene sequences known in the art. This is supported, for instance, by an NCBI BLAST sequence search for known sequences showing sequence identity to SEQ ID NO: 3, the results of which are appended to this response as Appendix 1 for the Examiner's convenience. As shown in Appendix 1, the Alfalfa mosaic virus RNA 3, complete sequence shows the highest identity to SEQ ID NO: 3 at only 85.67%, with only 568 out of 663 nucleotides being identical. The alignment of the sequence of the Alfalfa mosaic virus RNA 3, complete sequence vs SEQ ID NO: 3 is also shown in Appendix 1. This indicates that the nucleotide sequence of SEQ ID NO: 3 exhibits numerous modifications at various positions throughout the sequence. As such, a person of ordinary skill in the art (POSITA) would find no reason or motivation to specifically modify a known nucleotide sequence encoding an AMV capsid protein to specifically result in the highly unique nucleotide sequence of SEQ ID NO: 3, let alone in combination with a polynucleotide encoding a Rubisco transit peptide comprising the amino acid sequence represented by SEQ ID NO: 2, in a recombinant vector for expression in a plant. Thus, aprimafacie case of obvious of independent claim 1 and dependent claims thereof, including claims 2-6, over Chu and Sohn has not been established, and this rejection should be withdrawn. Claims 1, 2, and 6 over Chu, Almeida, and Hwang Present claims 1, 2, and 6 are non-obvious over Chu, Almeida, and Hwang for at least the same reasons why present claims 1-6 are non-obvious over Chu and Sohn as discussed above, and the further teachings of Almeida and Hwang do not remedy such deficiencies, nor are they alleged to do so. As discussed above, Chu does not teach or suggest a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein, or provide any reason or motivation to specifically modify a nucleotide sequence encoding an AMV capsid protein to specifically arrive at the highly unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1 as amended. Further, neither Almeida nor Hwang teach or suggest a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein, or provide any reason or motivation to specifically modify a nucleotide sequence encoding an AMV capsid protein to specifically arrive at the highly unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1 as amended. Almeida and Hwang are each cited for allegedly providing certain teachings relating to a Rubisco transit peptide, but do not teach or suggest any specific combination of a Rubisco transit peptide with an AMV capsid protein, let alone an AMV capsid protein encoded by the unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1. Moreover, Hwang demonstrates that the use of a Rubisco transit peptide having the same sequence as SEQ ID NO: 2 of the present claims resulted in low expression of serum parathyroid hormone protein and failed to increase its expression. See, e.g., Hwang, at Example 3 and FIG. 2. This demonstrates that it would not have been obvious to a POSITA to combine the recited Rubisco transit peptide with an AMV capsid protein encoded by the recited polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 with a reasonable expectation of increasing expression. Thus, aprimafacie case of obvious of independent claim 1 and dependent claims thereof, including claims 2 and 6 included in this rejection, over Chu, Almeida, and Hwang has not been established, and this rejection should be withdrawn. Claims 3-5 over Chu, Almeida, Hwang, and Lee Present claims 3-5 are non-obvious over Chu, Almeida, Hwang, and Lee for at least the same reasons why present claims 1, 2, and 6 are non-obvious over Chu, Almeida, and Hwang as discussed above, and the further teachings of Lee do not remedy such deficiencies, nor are they alleged to do so. As discussed above, none of Chu, Almeida, or Hwang teach or suggest a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein, or provide any reason or motivation to specifically modify a nucleotide sequence encoding an AMV capsid protein to specifically arrive at the highly unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1 as amended. Nor do they teach or suggest the specific combination of a Rubisco transit peptide having the recited sequence with an AMV capsid protein encoded by the unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1. Lee also does not teach or suggest a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein, or provide any reason or motivation to specifically modify a nucleotide sequence encoding an AMV capsid protein to specifically arrive at the highly unique nucleotide sequence of SEQ ID NO: 3 as recited in present claim 1 as amended. Lee is merely cited for certain teachings allegedly relating to a histidine tag, but does not teach or suggest specifically including the histidine tag in the claimed recombinant vector having the recited features, including a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein. Lee also does not provide any reason or motivation to specifically arrive at the present claims that include, inter alia, a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 that encodes an AMV capsid protein. Thus, a prima facie case of obvious of claims 3-5 over Chu, Almeida, Hwang, and Lee has not been established, and this rejection should be withdrawn. This argument has been fully considered and is found not persuasive for the following reason(s): The nucleotide sequence of instant SEQ ID NO: 3 appears to be a codon optimized AMV capsid protein sequence for expression in Nicotiana benthamiana that encodes the amino acid sequence of instant SEQ ID NO: 4 (spec., p. 34). Because Chu teaches the AMV virus-encoded coat protein comprises an amino acid sequence of SEQ ID NO: 8 (claim 9 of Chu) which has 100% sequence identity to the protein that is encoded by instant SEQ ID NO: 3 (see alignment below), and because at least Ullrich teaches an important step in introducing a transgene for protein production comprises altering the codon usage to match the host genome, and codon usage data for some plants (including Nicotiana benthamiana) can be found in the ‘codon usage database’ (http://www.kazusa.or.jp/codon/) (p. 62, section titled Nucleotide frequencies of mRNA) (although various other references are also available in the prior art regarding codon optimization, and it is also widely, routinely used in the field), it would therefore be obvious to optimize the polynucleotide sequence encoding SEQ ID NO:8 of Chu (i.e. which is identical to instant SEQ ID NO: 4) for the purpose of optimizing protein expression in any plant species of interest including Nicotiana benthamiana to arrive at the instantly claimed nucleotide sequence of SEQ ID NO: 3. For this reason, Applicant’s argument is not persuasive (see full modified 103 rejection above). Applicant argues beginning on p. 12 of remarks dated 03/30/2026 the following arguments: 35 U.S.C. 103 2. Even if a prima facie case of obviousness has been established, this has been rebutted by secondary considerations of non-obviousness, including unexpected results Rebuttal evidence, such as in the form of unexpected results may be presented by the Applicant to demonstrate non-obviousness. See , e.g., MPEP § 2145. Specifically, according to MPEP § 2145: "Usually, a showing of unexpected results is sufficient to overcome a prima facie case of obviousness." (citing In re Albrecht, 514 F.2d 1389, 1396 (CCPA 1975)). For instance, greater than expected results or superiority of a certain property or result are evidence of nonobviousness. See, e.g., MPEP § 716.02(a)(I)-(II). Additionally, according to MPEP § 716.02(a)(II): "Evidence of unobvious or unexpected advantageous properties, such as superiority in a property the claimed compound shares with the prior art, can rebut prima facie obviousness." The Examples of the present application demonstrate that the claimed recombinant vector for expression in a plant achieves unexpected results, particularly in view of its superiority in achieving high expression in the soluble fraction as compared to what was known in the art at the time of filing, including the cited references themselves. For instance, as demonstrated in Example 2 of the present application, the claimed recombinant vector having the recited features (including a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 encoding an AMV capsid protein) was shown to result in targeting the recombinant AMV capsid protein fused with the Rubisco transit peptide to the chloroplast with an advantageously high expression efficiency, as more than 90-95% of the expressed recombinant AMV capsid protein was confirmed in the aqueous fraction, and only about 5-10% of the AMV capsid protein observed in the pellet fraction. See Example 2, at page 36 of the present application as originally filed. A POSITA would consider such results to be highly unexpected and advantageous, especially in view of the data provided in the cited Sohn and Hwang references. Sohn discloses that fusion of a Rubisco transit peptide to a PCV2 capsid protein results in about 70% expression in the soluble fraction, which is substantially less than the 90-95% expression achieved by the claimed recombinant vector. See Sohn, at Example 2, page 30. This significant enhancement in soluble expression of the recombinant AMV capsid protein could not have been predicted based on the teachings of Sohn and, thus, are unexpected. Hwang further supports the unexpectedness of the advantageously high expression efficiency achieved by the claimed recombinant vector. Hwang provides evidence that the use of a Rubisco transit peptide alone does not universally increase the expression of target proteins. Specifically, Hwang demonstrates that while the use of the full-length RbcS results in high expression of serum parathyroid hormone protein, the use of only the Rubisco transit peptide results in low expression of the same protein. See, e.g., Hwang, at Example 3. This clearly demonstrates that a POSITA would not have reasonably expected that combining the recited Rubisco transit peptide with an AMV capsid protein encoded by a polynucleotide comprising the unique nucleotide sequence of SEQ ID NO: 3 would result in such high expression efficiency of 90-95% as shown in Example 2 of the present application. As such, the data in Sohn and Hwang evidences that the effect of the Rubisco transit peptide is highly dependent on the nature of the target protein, and that the highly superior expression of the AMV capsid protein achieved by the claimed recombinant vector (e.g., 90-95% expression in the soluble fraction) would not have been reasonably expected or predicted by a POSITA. Thus, the claimed recombinant vector achieves unexpected results and superior advantageous properties over the cited references in a manner that would not have been expected by a POSITA at the time of filing, thereby rebutting any prima facie case of obviousness in accordance with MPEP § 2145 and MPEP § 716.02(a)(I)-(II). Accordingly, these rejections should be withdrawn. This argument has been fully considered and is found not persuasive for the following reason(s): This is not found persuasive. With regard to Applicant’s argument that Applicant has offered evidence of unexpected and unobvious results, pursuant to MPEP 716.02(b), the evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992) (Mere conclusions in appellants’ brief that the claimed polymer had an unexpectedly increased impact strength "are not entitled to the weight of conclusions accompanying the evidence, either in the specification or in a declaration."); Ex parte C, 27 USPQ2d 1492 (Bd. Pat. App. & Inter. 1992) (Applicant alleged unexpected results with regard to the claimed soybean plant, however there was no basis for judging the practical significance of data with regard to maturity date, flowering date, flower color, or height of the plant.). In the instant case, Applicant alleges the unexpected result of the claimed recombinant vector having the recited features (including a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3 encoding an AMV capsid protein) was shown to result in targeting the recombinant AMV capsid protein fused with the Rubisco transit peptide to the chloroplast with an advantageously high expression efficiency, as more than 90-95% of the expressed recombinant AMV capsid protein was confirmed in the aqueous fraction. Applicant appears to attribute the unexpected results to the AMV capsid protein encoded by a polynucleotide comprising the unique nucleotide sequence of SEQ ID NO: 3. However, these results do not appear unexpected and unobvious. The sequence of SEQ ID NO: 3 is a nucleotide sequence codon optimized for expression in Nicotiana benthamiana, and Applicant’s results are based on the expression levels observed in the model species Nicotiana benthamiana of which the sequence was specifically optimized for. Because codon optimization of transgenes to match the host’s genome is known to increase protein production, it would be obvious to optimize the gene encoding the AMV capsid protein to match the host’s genome and one of ordinary skill in the art would reasonably expect to observe the increased expression levels as observed in the instant specification. This is especially supported given the plant of which the protein is expressed is the model species Nicotiana benthamiana, as compared to the clover and alfalfa species described in Chu. Given what is known in the art about codon optimization, and because it is routinely used in the field to increase protein production in targeted plant species, the argument that SEQ ID NO: 3 (which, again, is codon optimized for expression in Nicotiana benthamiana that produces an identical protein as taught by Chu) results in unexpectedly high expression efficiency does not appear unexpected or unobvious. Further, even if Applicant can make such a showing, MPEP 716.02(c) provides that the evidence of unexpected results must be weighed against evidence supporting prima facie obviousness in making a final determination of the obviousness of the claimed invention. MPEP 716.02(c) directs the examiner to MPEP 716.01(d), which establishes that although the record may establish evidence of secondary considerations which are indicia of nonobviousness, the record may also establish such a strong case of obviousness that the objective evidence of nonobviousness is not sufficient to outweigh the evidence of obviousness. Newell Cos. v. Kenney Mfg. Co., 864 F.2d 757, 769, 9 USPQ2d 1417, 1427 (Fed. Cir. 1988), cert. denied, 493 U.S. 814 (1989); Richardson-Vicks, Inc., v. The Upjohn Co., 122 F.3d 1476, 1484, 44 USPQ2d 1181, 1187 (Fed. Cir. 1997) (showing of unexpected results and commercial success of claimed ibuprofen and pseudoephedrine combination in single tablet form, while supported by substantial evidence, held not to overcome strong prima facie case of obviousness). The showing, when made, must outweigh the rationale in support of a finding of prima facie obviousness provided in the 103 rejection(s). Here, Chu, Sohn, and Ullrich teach all of the limitations of the claims and there is clear motivation to combine the teachings. Sohn provides motivation to include the Rubisco transit peptide that is to increase expression of the target peptide as well as other vector components. Ullrich also provides motivation to codon optimize the nucleotide sequence encoding instant SEQ ID NO: 4 (i.e. to arrive at codon-optimized SEQ ID NO: 3) which is also to increase expression/ protein production. In view of the foregoing, Applicant’s evidence is not deemed to outweigh the basis for the rejection. Finally, MPEP 716.02(d) provides that whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980). In this case, the scope of the claims is not commensurate with the evidence. The scope of the claims encompasses a recombinant vector for expression in any plant species, and any plant species transformed with the recombinant vector according to claim 1. However, Applicant only provides evidence of Nicotiana benthamiana expressing the vector and producing the argued results (p. 35-36). Additionally, the claims encompass plants transformed by any means and includes both stable and transient transformation. However, Applicant appears to only provide evidence of transiently transformed plants (by syringe Agroinfiltration into a leaf) that produce the argued results (p.35-36). For these reasons, Applicants the scope of the claims is not commensurate with the evidence. Conclusion and Inquiries No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. JESSICA N. STOCKDALE Examiner Art Unit 1663 /JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663 /CHARLES LOGSDON/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Aug 25, 2023
Application Filed
Dec 29, 2025
Non-Final Rejection mailed — §103, §Other
Mar 30, 2026
Response Filed
Jun 29, 2026
Final Rejection mailed — §103, §Other (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12624364
PLANT REGULATORY ELEMENTS AND USES THEREOF FOR AUTOEXCISION
3y 0m to grant Granted May 12, 2026
Patent 12612640
GENE RELATED TO BIOSYNTHESIS OF ERGOTHIONEINE, AND USE THEREOF
1y 9m to grant Granted Apr 28, 2026
Patent 12590314
Expressing Multiple Genes from a Single Transcript in Algae and Plants
3y 3m to grant Granted Mar 31, 2026
Patent 12590318
NOVEL INSECT INHIBITORY PROTEINS
2y 3m to grant Granted Mar 31, 2026
Patent 12545923
MUTANT GENE CONFERRING A COMPACT GROWTH PHENOTYPE IN WATERMELON
3y 0m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
43%
Grant Probability
87%
With Interview (+44.0%)
2y 5m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 30 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month