Prosecution Insights
Last updated: October 02, 2026
Application No. 18/279,169

PRODUCTS AND METHODS FOR TREATMENT OF DYSTROPHIN-BASED MYOPATHIES USING CRISPR-CAS9 TO CORRECT DMD EXON DUPLICATIONS

Non-Final OA §102
Filed
Aug 28, 2023
Priority
Mar 04, 2021 — provisional 63/156,443 +2 more
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Research Institute At Nationwide Children's Hospital
OA Round
1 (Non-Final)
56%
Grant Probability
Moderate
1-2
OA Rounds
6m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 56% of resolved cases
56%
Career Allowance Rate
36 granted / 64 resolved
-3.7% vs TC avg
Strong +40% interview lift
Without
With
+40.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
38 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
40.6%
+0.6% vs TC avg
§102
15.3%
-24.7% vs TC avg
§112
27.1%
-12.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 64 resolved cases

Office Action

§102
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim to priority from International Application No. PCT/US22/18829 filed 03/04/2022 and from US Provisional Application No. 63/156,443 filed 03/04/2021 is hereby acknowledged. Election/Restrictions Applicant's election with traverse of Invention Group I (Claims 1-12) and Species A(a (An RNA spacer having 90% identity to SEQ ID NO: 122), B (SEQ ID NO: 122, with gRNA of SEQ ID NO: 30), C (1 (U6 promoter)) and D( AAV9) in the reply filed on 06/08/2026 is acknowledged. The traversal is on the ground(s) that the reference Ruan (Ruan, X. et al. WO 2016/186772 A2, published Nov. 24, 2016; cited on IDS filed 11/27/2023) does not break unity based on sequence homology of 92.2% to 98.8% compared to SEQ ID Nos: 1,2 and 3 of instant Application. This is not found persuasive because Applicant’s arguments are based on amendments of claims to cite SEQ ID Nos: 93-184 and remove SEQ ID NOs: 1, 2 and 3 filed on 06/08/2026, while the restriction requirement was based on claims as filed with preliminary amendments filed on 04/15/2024. The requirement is still deemed proper and is therefore made FINAL. Claims 13-18 and 27-31 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 06/08/2026. Application Status This Application is a National Entry phase Application under 35 U.S.C. § 371 of the International Application No. PCT/US22/18829 filed 03/04/2022. This Office Action is in response to Applicant’s amendments and arguments filed on 06/08/2026. Amendments to claims filed on 06/08/2026 are hereby acknowledged. Claims 1, 12, and 18 are currently amended. Claims 19-26 and 32 are cancelled. Claims 13-18 and 27-31 are withdrawn from consideration. Therefore, claims 1-18 and 27-31 are pending, but only claims 1-12 are under consideration in this Office Action. Information Disclosure Statement The information disclosure statements (IDSs) submitted on 11/27/2023 and 01/02/2026 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, or cited on a submitted IDS, they have not been considered. Drawings The Drawing sheets filed 08/28/2023 are hereby acknowledged and are acceptable. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see [0069]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms “In-Fusion” ([00134]-[00135]), “rAPid DNA Dephos & Ligation” ([00134]-[00135]), “Lipofectamine” ([00139], [00141]), “Hyclone” ([00139]), “PromoCell” ([00139], [00149], [00158]), “EnGen” ([00141]), “DNeasy” ([00141]), “ChemiDoc” ([00141]), “Triton X-100”, “ProLong” ([00143]), “Alexa Fluor 568”, “Alexa Fluor 488” ([00143], [00145]), “TRIzol”, “RevertAid ([00149], [00158]), which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-11 are rejected under 35 U.S.C. § 102(a)(1) as being anticipated by Hsu (Hsu, P.D. et al. US 2019/0048337 A1, published February 14, 2019). Regarding claim 1, It recites “A nucleic acid comprising: a nucleotide sequence encoding an RNA spacer sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID Nos: 93-184; a nucleotide sequence encoding the RNA spacer sequence set forth in any one of SEQ ID Nos: 93-184;” and it also recites: “(c ) a nucleotide sequence comprising an RNA spacer sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID Nos: 93-184” and in (d), it recites “ a nucleotide sequence comprising (i) the RNA spacer sequence set forth in any one of SEQ ID Nos: 93-184”. A search for the sequence SEQ ID NO: 99 (Qy = Query) of instant Application, leads to the following results (Db = Database): RESULT 1 US-15-732-190-132602 Sequence 132602, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 132602 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Query Match 100.0%; Score 23; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCUGCCUCAGCCUCCCAAGUAGC 23 ||||||||||||||||||||||| Db 1 GCUGCCUCAGCCUCCCAAGUAGC 23 RESULT 2 US-15-732-190-158480 Sequence 158480, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 158480 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Query Match 100.0%; Score 23; Length 24; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCUGCCUCAGCCUCCCAAGUAGC 23 ||||||||||||||||||||||| Db 2 GCUGCCUCAGCCUCCCAAGUAGC 24 Therefore, the sequence set forth in instant Application’s SEQ ID NO: 99 is known and published, and present 100% identity with sequences set forth in Hsu’s SEQ ID Nos: 132,602 and 158,480. The sequences are not described as “RNA spacer sequence” but as gRNAs comprising a “targeting domain”. Instant’s Specification describes “a spacer sequence” as follow: “The natural CRISPR Cas9 system contains two RNAs, one is called the crRNA and contains sequences called spacer (assigns its targeting specificity) direct repeat (helps it bind with tracrRNA and Cas9) and a tracrRNA which contains a region complementary to the crRNA direct repeat and anneals to the crRNA direct repeat sequence such that they form a dsRNA that binds to Cas9.” (see [0054]). Hsu describes a first RNA comprising a targeting domain and a complementary domain and a second RNA with a second complementary domain (see Fig.1A). Therefore, since the structure of SEQ ID NO: 99 is 100% identical to the sequences SEQ ID Nos: 132,602 and 158,480 described in Hsu, Hsu anticipates elements of claim 1. Hsu also teaches that the nucleic acid composition further comprises a nucleotide sequence that encodes a third gRNA molecule comprising a targeting domain that is complementary to a third target domain of the DMD gene, and that the targeting domains of can comprise nucleotide sequences set forth in SEQ ID Nos: 206-826,366 (see [0074]). Hsu also teaches that the gRNA is comprised within a nucleic acid molecule, e.g., a vector, viral vector, adeno-associated virus vector (see [0076]). Hsu also teaches vectors comprising DNA encoding for the Cas9 protein and gRNAs ( see [1147]-[1149]). Regarding claims 2-5, Hsu teaches that the nucleic acid molecule can comprise a promoter (see [0086]-[0087]). Hsu also teaches that useful promoters for gRNAs include T7, H1, EF-1a, 7SK, U6, U1, tRNA promoters and Muscle Creatine Kinase promoter ([0592], [0618]-[0619], [1124], [1130], [1255]). Regarding claims 6, 8, 9 and 10, Hsu teaches vectors that are AAV vectors ( see [0076]-[0085], [1134], [1139]-[1144]). Hsu specifically teaches AAV9 vector (see [0076], [0175], [1139]-[1140]). Hsu teaches that in some embodiments, the AAV is a self-complementary AAV (scAAV) ([1142]). Regarding claim 7, Hsu teaches that the viral vectors are defective and missing some viral sequences that are being replaced by an expression cassette. Hsu teaches that the missing viral functions can be supplied in trans by packaging cell line comprising plasmid encoding for Rep and Cap genes from AAV (see [1144]. Examiner interprets that the viral vectors comprising the expression cassette with the oligonucleotide of interest, lack rep and cap genes. Regarding claim 11, Hsu teaches nanoparticle and exosome ([1147], [1150], [1181], see Table 4 ([1124])). Claims 1-4 and 6-12 are rejected under 35 U.S.C. § 102(a)(2) as being anticipated by Kabadi (Kabadi, A. M. et al. US Patent No. 12,053,531 B2, dated August 6, 2024, benefitting from priority from US Application No. 17/748,495 filed May 19, 2022, and US Provisional Applications Nos. 62/247,484 filed 10/28/2016 and 62/324,064 filed 04/18/2016). Regarding claim 1, a search of instant Application’s SEQ ID NO: 122 (Qy = Query) leads to the following result: RESULT 2 US-17-748-495A-1295552 Sequence 1295552, US/17748495A Patent No. 12053531 GENERAL INFORMATION APPLICANT: Vertex Pharmaceuticals Incorporated TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF DUCHENNE MUSCULAR TITLE OF INVENTION: DYSTROPHY (DMD) FILE REFERENCE: 01245-0021-01US CURRENT APPLICATION NUMBER: US/17/748,495A CURRENT FILING DATE: 2022-05-19 PRIOR APPLICATION NUMBER: US 15/763,328 PRIOR FILING DATE: 2016-03-26 PRIOR APPLICATION NUMBER: PCT/US2016/059386 PRIOR FILING DATE: 2016-10-28 PRIOR APPLICATION NUMBER: US 62/247,484 PRIOR FILING DATE: 2015-10-28 PRIOR APPLICATION NUMBER: US 62/324,064 PRIOR FILING DATE: 2016-04-18 NUMBER OF SEQ ID NOS: 1410475 SEQ ID NO 1295552 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: chemically synthesized Query Match 91.3%; Score 21; Length 22; Best Local Similarity 66.7%; Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0; Qy 2 AAUAUGCUCUAAACUAUAGUG 22 ||:|:||:|:||||:|:||:| Db 2 AATATGCTCTAAACTATAGTG 22 The alignment clearly shows a nucleic acid sequence of SEQ ID NO: 1,295,552 (Db = Database) from US Patent No. 12,053,531 B2, i.e., Kabadi, presenting 91.3% identity to a sequence encoding the RNA spacer sequence of instant SEQ ID NO: 122. Kabadi teaches in “Brief Description of the sequence listing” section in column 10, lines 46-67, that SEQ ID Nos: 627,855-1,410,399 is a list of gRNA 20-24 bp spacer sequences for targeting the dystrophin gene with an Acidominoccoccus, a Lachnospiraceae, and a Franciscella Novicida Cpf1 endonuclease ( see column 10, lines 64-67). Therefore, Kabadi teaches a nucleotide sequence encoding an RNA spacer comprising at least 90% identity to the sequence set forth in one of SEQ ID Nos: 93-184, i.e., SEQ ID NO: 122 specifically. Regarding claim 2, Kabadi teaches the nucleic acid, being a vector comprising one or more transcription and/or translation control elements and further comprising a promoter sequence (see column 52, lines 39-67). Regarding claims 3 and 4, Kabadi teaches the promoter can be U6 or H1 (see column 52, lines 59-62). Regarding claim 6, Kabadi teaches an Adeno-associated virus comprising the nucleic acid (see column 8, lines 39-46). Regarding claim 7, Kabadi teaches that rep and cap genes are separate (i.e., not in) the rAAV genome (see column 54, lines 55-59; column 55, lines 18-25). Regarding claim 8, Kabadi teaches the virus is a rAAV (see column 54, lines 50-67; column 55, lines 18-25; lines 32-41). Regarding claims 9 and 10, Kabadi teaches the virus can be of serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74 (see column 54, lines 59-65; columns 55 and 56, Tables 3 and 4). Regarding claim 11, Kabadi teaches lipid nanoparticles (LNP) as delivery vehicle for the nucleic acid (see column 8, lines 36-46; column 53, lines 26-34, lines 55-67; column 54, lines 1-23; column 74, lines 1-17). Regarding claim 12, Kabadi teaches a composition comprising the nucleic acid and a pharmaceutically acceptable carrier ( see column 57, lines 39-67; column 58, lines 1-34). Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Aug 28, 2023
Application Filed
Jul 27, 2026
Non-Final Rejection mailed — §102 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735465
METHOD OF PREPARING CIRCULAR PERMUTATION-BASED FUNCTIONAL RECOMBINANT HUMAN-DERIVED FIBROBLAST GROWTH FACTOR 7 AND USE THEREOF
3y 9m to grant Granted Sep 15, 2026
Patent 12680098
Modified antisense oligonucleotide for inhibition of FoxP3 expression
4y 0m to grant Granted Jul 14, 2026
Patent 12655421
NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS
5y 9m to grant Granted Jun 16, 2026
Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
1y 12m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
5y 0m to grant Granted Jan 20, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
56%
Grant Probability
96%
With Interview (+40.2%)
3y 8m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 64 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month