DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This is a National Stage Entry under 35 U.S.C. 371 of International Patent Application
No. PCT/US2022/019371, filed March 08, 2022.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 36, 40, 41, and 55 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
Treating a subject with a CA- 125 expressing cancer using a virus comprising a nucleic acid encoding a MUC16 promoter operably linked to an essential viral gene and a one or more anti-cancer proteins, or a cell comprising the virus;
Stimulating an immune response in a subject with a CA- 125 expressing cancer using a virus comprising a nucleic acid encoding a MUC16 promoter operably linked to an essential viral gene and an immune activating protein, or a cell comprising the virus; and
Inhibiting proliferation of a CA-125 expressing cell using a virus comprising a nucleic acid encoding a MUC16 promoter operably linked to an essential viral gene and a one or more anti-cancer proteins, or a cell comprising the virus,
The specification does not reasonably provide enablement for:
A method of treating or preventing cancer, or CA-125 expressing cancers, in a subject in need thereof, said method comprising administering to said subject a therapeutically or prophylactically effective amount of the virus of claim 1 or a cell comprising said virus;
A method of stimulating an immune response in a subject in need thereof, said method comprising administering to said subject an effective amount of the virus of claim 1 or a cell comprising said virus; or
A method of inhibiting proliferation of a CA-125 expressing cell, said method comprising contacting said CA-125 expressing cell with the virus of claim 1.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
There are many factors to be considered when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any necessary experimentation is “undue.” These factors include, but are not limited to:
• (A) The breadth of the claims;
• (B) The nature of the invention;
• (C) The state of the prior art;
• (D) The level of one of ordinary skill;
• (E) The level of predictability in the art;
• (F) The amount of direction provided by the inventor;
• (G) The existence of working examples; and
• (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988).
The level of skill in the art is high and would include, e.g., Ph.D. level scientists.
Here, the instant claims are broadly drawn to a method for treating and preventing cancer, stimulating an immune response, and inhibiting proliferation of cancer within a subject by administering a virus encoding a MUC16 promoter operably linked to an essential viral gene. As defined by the specification, an essential viral gene is a gene required for viral propagation, replication, spread, or cell entry.
As the claims are written, this essential viral gene can be E2A. As such, a virus encoding MUC16 driving only E2A, which satisfies the limitations of claim 1, would not predictably treat, prevent, or inhibit cancer cells or stimulate an immune response. The claims are not enabled based on, but not limited to, two major lines of evidence. First, the MUC16 promoter drives expression in CA-125 positive cells. Not all cancerous cells express CA-125 and therefore a virus encoding MUC16 driving only E2A would not treat, prevent or inhibit those cancer as MUC16 would not be predictably effective in expressing in CA-125 negative cancer cells. Second, it is not a reasonable prediction for a virus encoding MUC16 driving only an essential viral gene such as E2A to, in some way, induce cell death of cancerous cells.
The evidence disclosed in the specification demonstrates the treatment, inhibition, and a stimulation of an immune response when the conditionally replicative virus encoding the MUC16 promoter is paired with at least one essential viral gene and at least one anti-cancer protein such as GM-CSF or IL-12. Additionally, no cell death is reported when a fluorescent protein not known for anti-cancer properties is expressed in the MUC16 promoter virus (Figure 9 A, B, C).
The art also establishes the need of MUC16 promoter to drive a protein that can affect cancer cells. Zhang et al. (Drug Delivery, 2018, hereinafter, "Zhang") teach the use of the MUC16 promoter to target CA-125 positive ovarian cancer cells. Using nanoparticles Zhang delivered plasmids encoding a MUC16 promoter driving shRNA against gro-a. This allowed for the reduction of the gro-a protein secretion resulting in inhibited cancer growth in vivo. Again, importantly CA-125 cells were only affected by the MUC16 promoter construct and needed to affect downstream proteins.
Similarly, Weichselbaum et al (US20030091539A1, hereinafter, “Weichselbaum”) teaches the use of an adenovirus encoding a MUC1 promoter, which is in the same family as MUC16, to drive cytokines such as TNFa to inhibit tumor growth. While not targeted to CA-125 expressing cells, Weichselbaum teaches the cancer antagonizing effects when a virus is paired with an anti-cancer protein. In the same vein, Kuroki et al. (PLOS one, 2017, hereinafter, "Kuroki") teaches the use of an adenovirus encoding a MUC16/CA-125 targeted TR3 variant to target and kill ovarian cancer cells. Kuroki again highlights the importance of anti-cancer protein to target and affect CA-125 cancer cells. There has been no evidence of using a virus with a MUC16 promoter and an essential viral gene such as E2A alone, and importantly, without an exogenous protein, for treating cancer, stimulating an immune response, and inhibiting proliferation of cancer.
In regard for prevention of cancer, it is noted that the term “preventing” was interpreted in an absolute sense to mean to always keep something from happening or arising.
CA-125 overexpresses during cancer and CA-125 levels increase over time compared to control subjects not known to have cancer (Nebgen et al. Current Oncology Reports, 2019). The lower levels of CA-125 in healthy cells would increase difficulty and unpredictability in using a conditionally replicative and targeted virus encoding MUC16 for the prevention of cancer.
Together with the evidence discussed above, the MUC16 promoter would not predictably express will in cancerous cells not expressing CA-125 and a virus encoding the MUC16 promoter with just an essential viral gene, such as E2A, would not predictably prevent cancer.
The specification only exemplifies and reduces to practice treatment of cancer using an adenovirus encoding an anti-cancer protein driven by the MUC16 promoter. However, the specification offers no reasonable direction or working example for the absolute prevention of cancer, especially using a virus that does not even express an anti-cancer protein.
The specification only exemplifies and reduces to practice treating cancer, stimulating an immune response, and inhibiting proliferation of cancer using an adenovirus driven by a MUC16 promoter with exogenous genes that are known to kill cells. However, the specification offers no reasonable direction or working example for the use of a virus encoding a MUC16 promoter operably linked to an essential viral gene to treat—let alone prevent—cancer, stimulate an immune response, or inhibit proliferation of cancer.
In view of the foregoing, a vast quantity of experimentation, including expansive clinical trials, would be needed to use the invention based on the content of the disclosure.
Taken together, the specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
The term “about” in claims 2 and 5 are a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Therefore, the claim 2 is interpreted as the MUC16 promoter is 20 - 6000 nucleic acid residues in length. Claim 5 is interpreted as being 6000 nucleic acids upstream to 200 nucleic acid residues downstream of a MUC16 transcription start site. .
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1 - 2, 5, 9, 10 – 11, 13, 20, 23, 25, 27, 29, 30, 35 – 36, 40 - 41, and 55 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang, and in further view of Weichselbaum and Beard et al. (US20070015907A1, hereinafter, “Beard”).
Regarding claim 1, Zhang teaches a MUC16 promoter used in a PGL-4.10 vector used in ovarian cancer cell lines (Results, ¶2).
Regarding claim 2, Zhang the MUC16 promoter has a length of at least 4kb (Results, Screen of MUC16 promoter sequences, ¶1).
Regarding claim 5, Zhang teaches the MUC16 promoter comprises a nucleic acid sequence of at least 2.5kb upstream and 200 bp downstream of the transcription start site (Results, Screen of MUC16 promoter sequences, ¶1; Discussion ¶6).
Regarding claim 9, SEQ ID NO: 2 encodes for a fragment of the MUC16 promoter. While not an exact match Xu et al. (CN106434660A, 2017), which share several authors of Zhang, also teach the use MUC16 promoter to target ovarian cancer cells, have several overlapping regions such as CN106434660A sequence 1 and 4 to SEQ ID NO: 2 of the instant application. Furthermore, Beard teaches a sequence comprising the MUC16 promoter. Notably, SEQ ID NO:2 shares 100% similarity with a portion of sequence 311 of Beard (reproduced below).
Query Match 100.0%; Score 646; Length 57082;
Best Local Similarity 100.0%;
Matches 646; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAGGTAGGGGCTCTATCTGCATCTTTCTTTCTTTTTTTCTTTCTTTCCCTTCCTCCCTTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1010 TAGGTAGGGGCTCTATCTGCATCTTTCTTTCTTTTTTTCTTTCTTTCCCTTCCTCCCTTC 1069
Qy 61 CTCACTCCCTCGGTCCTCTCTTTCTTTCCTTTTCTTTCTTCCTTCCTCCCTTCCTCCCTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1070 CTCACTCCCTCGGTCCTCTCTTTCTTTCCTTTTCTTTCTTCCTTCCTCCCTTCCTCCCTC 1129
Qy 121 CCTCCCTCTCTCTTTCTCTCTTTCTTTCTTTCCTTCTTTCTTTCTTTCTCTCTTCCTTCC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1130 CCTCCCTCTCTCTTTCTCTCTTTCTTTCTTTCCTTCTTTCTTTCTTTCTCTCTTCCTTCC 1189
Qy 181 CTCCCTCCCTCCTTCCTTCCTTTCTCTTTCTTTCTCTTTCTTTCTTTTTTTCCTTCCTTC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1190 CTCCCTCCCTCCTTCCTTCCTTTCTCTTTCTTTCTCTTTCTTTCTTTTTTTCCTTCCTTC 1249
Qy 241 CTTCCTTCTTTCTCTTTCTCTCCCTCCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1250 CTTCCTTCTTTCTCTTTCTCTCCCTCCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTC 1309
Qy 301 TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCTTCCTTCC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1310 TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCTTCCTTCC 1369
Qy 361 TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTTCTTTCTTTCTCTTTCTTTTTGAGA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1370 TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTTCTTTCTTTCTCTTTCTTTTTGAGA 1429
Qy 421 CAGAGCTCTTATTACCCATGCTGGAGTGCAGTGGTGTGACCTTGGCTTACTGCAACATCT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1430 CAGAGCTCTTATTACCCATGCTGGAGTGCAGTGGTGTGACCTTGGCTTACTGCAACATCT 1489
Qy 481 GCCTCCTAGGGTCAAGTGATTCTCCTGCCTCAGCCTCCTAAGTAGCTGGGATTACAGACA 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1490 GCCTCCTAGGGTCAAGTGATTCTCCTGCCTCAGCCTCCTAAGTAGCTGGGATTACAGACA 1549
Qy 541 CATGCCACCACACCCAATATTTATTTTTATTAAAATTTTTTTTAAAATTATTTTTAAAAA 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1550 CATGCCACCACACCCAATATTTATTTTTATTAAAATTTTTTTTAAAATTATTTTTAAAAA 1609
Qy 601 ATTAAAAATAATTTTGTATTTTTAGTAGAGACGGGGTTTCTCCATG 646
||||||||||||||||||||||||||||||||||||||||||||||
Db 1610 ATTAAAAATAATTTTGTATTTTTAGTAGAGACGGGGTTTCTCCATG 1655
Regarding claim 41, Zhang teaches the use of MUC16 promoter to drive the targeting of gro-α, also known as the chemokine CXCL1 which is involved in the immune response, as evidenced by Schumacher et al. (PNAS, 1992).
Zhang fails to teach the use of the MUC16 promoter encoded in a viral vector and therefore linked to an essential viral gene, with the virus including an anti-cancer protein such as a cytokine, or an immune activating protein, or a detectable protein. Zhang also fails to teach the virus being an oncolytic virus such as adenovirus and a method of producing the virus. Nor does Zhang teach a therapeutic amount of a virus to stimulate an immune response.
However, Weichselbaum does teach an adenovirus vector with a DF3/MUC1 promoter (¶0023).
Regarding claims 10, 11, and 13, Weichselbaum teaches that the virus further includes a nucleic acid sequence encoding one or more anti-cancer proteins such as the cytokine IL-12 (¶0077).
Regarding claim 20, Weichselbaum teaches a virus further encoding a detectable protein such as GFP (¶0144).
Regarding claims 23 and 25, Weichselbaum teaches the virus is a virus, including an oncolytic adenovirus (¶0021).
Regarding claim 27, Weichselbaum teaches to produce virion “a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed… When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into a special cell line (e.g., by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media" (¶0032).
Regarding claim 29, Weichselbaum teaches an isolated nucleic acid encoding the virus of claim 1 (¶0023).
Regarding claims 30, 36, 40, and 55 Zhang teaches the use of a MUC16 promoter as a “tool to drive ovarian cancer-localized gene expression since MUC16/CA125 is overexpressed in most ovarian carcinomas” (Abstract) therefor inhibiting proliferation in CA-125 expressing cells in combination with MUC16 driven proteins (Figure 5). Weichselbaum teaches a therapeutic amount of the virus formulated in a pharmaceutically acceptable composition comprising a therapeutically effective amount of the virus of claim 1 (¶0023, 0088).
Regarding claim 35, Weichselbaum teaches a cell comprising the virus of claim 1 (¶0023; ¶0079).
Zhang, Weichselbaum, and Beard are considered to be analogous to the claim invention because they are in the same field of treating cancer by leveraging the mucin protein family. Zhang teaches the use of MUC16 promoter to target and treat ovarian cancer cells. Weichselbaum teaches a known and effective method for producing and applying mucin family driven oncolytic viruses. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to utilize the art-recognized method to encode target CA-125 expressing ovarian cancer cells with a MUC16 promoter, as taught by Zhang, that is encoded in an adenovirus, as taught by Weichselbaum, because doing so would advantageously targeting of ovarian cancer cells, thereby increasing probability of affecting the affected cancerous region. One of ordinary skill in the art would have reasonable expectation of success in using different promoters within the viral vector backbone to increase efficacy of cancer treatment given that this method is well known, has been successfully demonstrated, and commonly used in the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang, Weichselbaum, and Beard as applied to claims 1 - 2, 5, 9, 10 – 11, 13, 20, 23, 25, 27, 29, 30, 35 – 36, 40 - 41, and 55 above, and further in view of Kuroki.
As discussed above, claims 1 - 2, 5, 9, 10 – 11, 13, 20, 23, 25, 27, 29, 30, 35 – 36, 40 - 41, and 55 were rendered prima facie obvious by the teachings of Zhang, Weichselbaum, and Beard. The references fail to teach the use of TRAIL with a virus.
However, Kuroki teaches the use of adenovirus encoding the CA-125/MUC16 targeted variant of TRAIL to target and kill MUC16 expressing ovarian cancer cells (Abstract).
Kuroki, Zhang, Weichselbaum, and Beard are considered to be analogous to the claim invention because they are in the same field of treating cancer. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to utilize the art-recognized method to use the MUC16 promoter, as taught by Zhang, to drive expression of the MUC16 targeted TRAIL in the adenovirus as taught by Kuroki, because doing so would advantageously targeting of ovarian cancer cells, thereby increasing probability of killing MUC16 positive ovarian cancer cells. One of ordinary skill in the art would have reasonable expectation of success in using the MUC16 promoter driving the TRAIL in the adenovirus to increase targeting and therefor efficacy of cancer treatment given that this method is well known, has been successfully demonstrated, and commonly used in the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 18 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang, Weichselbaum, and Beard as applied to claims 1 - 2, 5, 9, 10 – 11, 13, 20, 23, 25, 27, 29, 30, 35 – 36, 40 - 41, and 55 above, and further in view of Du et al. (Cancer Gene Therapy, 2014, hereinafter, "Du").
As discussed above, claims 1 - 2, 5, 9, 10 – 11, 13, 20, 23, 25, 27, 29, 30, 35 – 36, 40 - 41, and 55 were rendered prima facie obvious by the teachings of Zhang, Weichselbaum, and Beard. The references fail to teach the use of an anti-CTLA-4 antibody encoded in adenovirus.
However, Du teaches the use of adenovirus encoding the anti-CTLA-4 antibody (Abstract, Figure 6).
Du, Zhang, Weichselbaum, and Beard are considered to be analogous to the claim invention because they are in the same field of treating cancer. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to utilize the art-recognized method to use the MUC16 promoter, as taught by Zhang, to drive expression of anti-CTLA-4 antibody encoded in the adenovirus as taught by Du, because doing so would advantageously targeting of ovarian cancer cells, thereby increasing probability of killing the ovarian cancer cells. One of ordinary skill in the art would have reasonable expectation of success in using the MUC16 promoter driving the anti-CTLA-4 antibody in the adenovirus to increase targeting and therefor efficacy of cancer treatment given that this method is well known, has been successfully demonstrated, and commonly used in the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Conclusion
NO CLAIMS ARE ALLOWED
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Danyal H Alam whose telephone number is (571)272-1102. The examiner can normally be reached M - F 9am - 5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DANYAL HASSAN ALAM/Examiner, Art Unit 1672
/THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1672