Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on May 26, 2026. Claims 1-10, 12-18, 21-22, 24 and 26-27 are pending and currently examined.
Priority
(The certificated copy was electronically retrieved via DAS) Acknowledgment is made of applicant's claim for foreign priority based on an application PCTEP2021055401, filed on 03/03/2021. It is noted, however, that applicant has not filed a certified copy as required by 37 CFR 1.55.
Nucleotide and/or Amino Acid Sequence Disclosures
(ASCII text file in bytes is corrected) REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
Claim Objection
(Previous objection- withdrawn) The base claims 1-3 and 8-13 are objected to because of the following informalities:
These claims recite the phrase “characterized in that… “, where applicant may consider using a wherein clause.
This objection is withdrawn in view of the amendment filed on May 26, 2026.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(Previous rejection- withdrawn) Claims 1-10, 12-18, 21-22 and 24 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
This rejection is withdrawn in view of the amendment filed on May 26, 2026.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
(New Rejection-necessitated by amendment) Claims 22 and 24 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
By depending the amended base claim 1 and claim 21, claims 22 and 24 are directed to a vaccine or a method to produce vaccine by introducing at least one or two of the claimed protein components selected from SEQ ID NOs: 2, 6, 10, 14, 18, 21-22 or a sequence having at least 90% sequence identity to these SEQ ID NOs.
The written description rejection is made because the claims are interpreted as being drawn to a protein component of vaccine including the amino acid sequence SEQ ID NOs as claimed or a sequence having at least 90% to these SEQ ID NOs. This means that up to 10% amino acids sequences of the vaccine protein component that can be used for vaccination can vary. The applicable standard for the written description requirement can be found in MPEP 2163; University of California v. Eli Lilly, 43 USPQ2d 1398 at 1407; PTO Written Description Guidelines; Enzo Biochem Inc. v. Gen-Probe Inc., 63 USPQ2d 1609; Vas- Cath Inc. v. Mahurkar, 19 USPQ2d 1111; and University of Rochester v. G.D. Searle & Co., 69 USPQ2d 1886 (CAFC 2004).
The instant specification discloses that the protein component of vaccine comprises a sequence coding for an amino acid sequence having at least 90%... at least 99.8%, or at least 99.9% sequence identity to the claimed SEQ ID NOs (See e.g., [0118] to [0132]). However, the specification does not indicate which portions of the claimed SEQ ID NOs are essential to retain the ability to be a functional vaccine component or which portions of the SEQ ID NOs can be modified or altered up to 10% and still retain an ability to become a vaccine candidate. For evidence, Timm et al. (Med Microbiol Immunol. 2015 Feb;204(1):29-38) teaches that mutation of even a single amino acid within an HCV epitope can defeat CD8+ T cell recognition through multiple mechanisms (See page 31, left column, paragraph 1). Caddy S. (https://theconversation.com/coronavirus-a-single-escape-mutant-shouldnt-render-a-vaccine-useless-153812) teaches that scientists have predicted that mutations in the spike protein of SARS-CoV-2 could emerge that stop antibodies being effective, and a spike protein monoclonal antibody only recognizes a single part of the spike. This means that a single mutation could, in theory, stop the antibody from binding and neutralizing the virus (See page 1).
The court clearly states in Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.).
As discussed above, the skilled artisan cannot envision the detailed sequence structure of the encompassed vaccine protein contents that are "at least 90% identical” to SEQ ID NOs as claimed, therefore, the full breadth of the claims does not meet the written description provision of 35 U.S.C. 112, first paragraph.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
(New Rejection-necessitated by amendment) Claims 1-5, 8-10, 13-14 and 17-18 are rejected under 35 U.S.C. 103 as being unpatentable over Thao et al. (bioRxiv, this version posted February 21, 2020, hereinafter “Thao”) as evidenced by GenScript (https://www.genscript.com/gsfiles/gene_synthesis_handbook.pdf?page_no=1&position_no=1&sensors=googlesearch), and Thao-Nature ( Nature. 2020 Jun;582(7813):561-565) (Please note: Thao-Nature is the publication version of Thao et al., its Fig. 3a was used in the current action for clarification).
The base claim 1 is directed to a fully synthetic, long-chain nucleic acid with at least 4,000 bases, arrangement, wherein the nucleic acid comprises:
Sequence part A encodes for a nucleocapsid protein N of a coronavirus,
Sequence part B encodes for an envelope protein E of a coronavirus,
Sequence part C encodes for a membrane protein M of a coronavirus, and
Sequence part D encodes for a glycosylated surface protein S of a coronavirus; or the nucleic acid encompasses a ribonucleic acid sequence corresponding to the deoxyribonucleic acid sequence according to the sequence parts A-D; and
b) does not comprise one or both of:(1) a nucleic acid sequence part that encodes an amino acid sequence having the function of a SARS-CoV-2 amino acid sequence encoded by ORF7a;or (2) a nucleic acid sequence part that encodes an amino acid sequence having the function of a SARS-CoV-2 amino acid sequence encoded by ORF3a.
Thao describes the rapid reconstruction of SARS-CoV-2 using a synthetic genomics platform and teaches that the reverse genetics has been an indispensable tool to gain insights into viral pathogenesis and vaccine development. They show the full functionality of a yeast-based synthetic genomics platform to genetically reconstruct diverse RNA viruses, including members of the Coronaviridae. Viral subgenomic fragments are generated using viral isolates, cloned viral DNA, clinical samples or synthetic DNA, and these fragments are then reassembled in one step in Saccharomyces cerevisiae using transformation-associated recombination cloning to maintain the genome as a yeast artificial chromosome. T7 RNA polymerase is then used to generate infectious RNA to rescue viable virus.
Using this platform, they are able to engineer and generate chemically synthesized clones such as the SARS-CoV-2 in only a week after receipt of the synthetic DNA fragments (See Abstract). Here the chemically synthesized DNA fragment is provided by GenScript (See page 15, paragraph 1). The technique for chemically synthesized DNA can be found in GenScript’s hand book. The detailed cloning by GenScript can be evidenced by their late publication of Thao-Nature, which teaches that the SARS-CoV-2 synthetic DNA fragments were synthesized and cloned in pUC57 or pUC57mini by GenScript, containing homologous regions to TAR vectors pVC604 and pCC1BAC-His3 (Thao-Nature, page 566, right column, paragraphs 1 and 2; Extended Data Table 3). Thao also teaches that they fragmented the genome of SARS-COV-2 into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kbp (See page 8, paragraph 2).
Accordingly, Thao teaches a fully synthetic long-chain nucleic acid comprising sequences encoding S, M, N and E proteins of coronavirus (See page 26-27) as claimed.
As for the limitation of “nucleic acid does not comprise ORF7a or ORF3a of SARS-CoV-2” as claimed, Thao teaches that the synthetic genomics platform is also used for constructing MERS-COV, HCPV-229E and HCoV-HKU1 (See page 7). It is obvious that there is no ORF7a or ORF3a of SARS-COV-2 in the constructs of MERS-COV, HCPV-229E and HCoV-HKU1. Also, MERS-COV, HCPV-229E and HCoV-HKU1 does not contain ORF-associated nucleic acid sequence of SARS-COV-2 or ORF6 or ORF8 of SARS-COV-2 because ORF6 and ORF8 accessory genes are known from SARS-related coronaviruses like SARS-CoV and SARS-CoV-2 and are not present in HCoV-229E, HCoV-HKU1, or MERS-CoV, which teaches claims 3-5 as well.
As for the “long-chain nucleic acid with at least 4,000 bases”, Thao teaches that they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kbp (See page 8), and then clone/assemble them to form a synthesized RNA virus genome that is over 4,000 bases as claimed.
PNG
media_image1.png
530
1037
media_image1.png
Greyscale
Thus, the invention as a whole was prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Regarding claims 2 and 13, they require a specific length of the synthesized nucleic acid. Thao teaches synthesizing the RNA virus whole genome by the company, GenScript. In Thao’s study, they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kb and synthesized them (See page 8, paragraph 2) and then assembled the synthetic genomics into the TAR vector, where the assembled synthesized-nucleic acid is over 8,000 bases and up to 31.9 kb depending on the virus types (See Table 1 above), which teaches the claim 2. As for the nucleic acid being a maximum size of 1,000,000 bases in claim 13, one of the skilled in the art can assemble the small synthesized nucleic acid fragments into a large fragment such as 1,000,000 bases based on the needs. Thao discloses that they synthesize the nucleic acid through GenScript. As a new technique, GenScript now provides GenBrick™ synthesis service for synthesizing 200 kb long DNA sequences at once (https://www.genscript.com/synthetic-biology-gene-synthesis-service.html), which teaches an alternative way to synthesize the nucleic acids with maximum size of 1,000,000 bases based on fragment assembly and/or a direct-synthesis.
Regarding claims 8-10, they require the nucleic acid comprises different combinations of the sequence parts A-D. Thao teaches a synthetic genomics platform providing the technical advance to rapidly generate molecular clones of diverse RNA viruses by using viral isolates, cloned DNA, synthetic DNA, and even clinical samples as starting material (See page 8, paragraph 1). Based on the Fig. 3a, Thao and Thao-
PNG
media_image2.png
567
371
media_image2.png
Greyscale
Nature teach that the reconstructed SARS-COV-2 comprises all the sequence parts A-D that are (A) nucleocapsid protein N, (B) envelope protein E, (C) membrane protein
M and (D) glycosylated surface protein S (See Fig. 3, Thao-Nature; page 8, paragraph 2, Thao; Fig. 1 below).
Regarding claim 14, Thao teaches that the TAR vector is used to clone the viral cDNA (See page 17 and Fig. 1 below).
PNG
media_image3.png
443
673
media_image3.png
Greyscale
Regarding claims 17-18, they require that a kit comprising two or more nucleic acids where the two or more nucleic acids are present in at least one plasmid.
Thao teaches the synthetic DNA constructs comprise the Sequence part A-D as claimed, which were delivered as sequence-confirmed plasmids (See page 9). TAR cloning is then performed to rescue the recombinant virus such as rSARS-CoV-2 and rSARS-CoV-2-GFP (See e.g., page 9), which contains nucleic acids encoding S, N, M and E proteins. Although Thao does not specifically teach a kit, the concept of packaging components into a kit is well known and routine in the art. As described above, Thao teaches the nucleic acids and plasmid as claimed. It would have been obvious to one of ordinary skill in the art at the time the invention was made to package components into a kit. One would be motivated to do this for commercial exploitation of the invention by providing convenience for the end user. Thus, the claimed invention is obvious over Thao’s researches. According to MPEP § 2112.01(III), “Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. In re Ngai, 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004) (Claim at issue was a kit requiring instructions and a buffer agent. The Federal Circuit held that the claim was anticipated by a prior art reference that taught a kit that included instructions and a buffer agent, even though the content of the instructions differed.). See also In re Gulack, 703 F.2d 1381, 1385-86, 217 USPQ 401, 404 (Fed. Cir. 1983) ( "Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability….[T]he critical question is whether there exists any new and unobvious functional relationship between the printed matter and the substrate." ).”
(New Rejection-necessitated by amendment) Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of Dong et al. (CN111139241A, publication, May 12, 2020, hereinafter “Dong”).
Claim 6 requires that the nucleic acid comprises an ORF8 sequence defined by the SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
The relevance of Thao is set forth above. The reference is silent on SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
Dong teaches a sequence, SEQ ID NO: 221, shows 98.3% identical to the claimed SEQ ID NO: 55, where SEQ ID NO: 221 of Dong is the ORF8 of SARS-COV-2 (See page 3; Table 3, page 20 and Table A below), where the SEQ ID NO: 221 is an artificial sequence.
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Dong to arrive at an invention as claimed. One of skill in the art would have been motivated to do so to use the known ORF8 sequence of the SEQ ID NO: 221 of Dong to substitute the sequence of the ORF8 of SARS-COV-2 and then synthesize the cDNA fragment (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize such a nucleic acid comprising the at least 90% sequence identity to SEQ ID NO: 55 as claimed based on the techniques taught by Thao and Dong.
PNG
media_image4.png
870
925
media_image4.png
Greyscale
(New Rejection-necessitated by amendment) Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of Coley et al. (J Virol. 2005 Mar;79(5):3097-106, hereinafter “Coley” ).
Claim 7 requires a sequence at a) a sequence of SEO ID NO: 9 or a sequence having at least 97.2% sequence identity to the sequence of SEO ID NO: 9; or
b) a sequence of SEO ID NO: 11 or a sequence having at least 90% sequence identity to the sequence of SEO ID NO: 11.
The relevance of Thao is set forth above. It is silent on a sequence as defined in SEQ ID NO: 9 or SEQ ID NO: 11 or a sequence having at least at least 97.2% sequence identity to the sequence as defined in SEQ ID NO: 9 or 90% sequence identity to the sequence as defined in SEQ ID NO: 11.
Coley describes the recombinant mouse hepatitis virus (MHV) strain A59 from cloned, full-length cDNA replicates to high titers in vitro and is fully pathogenic in vivo (See Abstract), and teaches a nucleotide sequence accession number AY700211 that matches with the claimed SEQ ID NO: 11 at 99% (See Table B below), where the nucleic acid region of 28969...29655 of AY700211 encode the M protein of Sequence part C as claimed.
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Coley to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known M sequence of Coley to substitute the sequence of the M for the constructs in Thao, such as applying in the constructs of MHV-GFP, rSARS-CoV-2, rSARS-CoV-2-GFP and MERS-CoV (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid sequence based on the GenBank number of Coley and the synthesis’s method of Thao.
PNG
media_image5.png
884
662
media_image5.png
Greyscale
(New Rejection-necessitated by amendment) Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of Cheynet-Sauvion et al. (US 2002/0119449 A1, published on Aug. 29, 2002, hereinafter “Cheynet-Sauvion”).
Claim 12 requires that the nucleic acid additionally comprises SEQ ID NO: 28, SEQ ID NO: 29, or both SEQ ID NOS: 28 and 29, or a corresponding ribonucleic acid sequence of any thereof.
The relevance of Thao is set forth above. It is silent on a sequence comprising SEQ ID NO: 28, SEQ ID NO: 29 or both.
Cheynet-Sauvion teaches a process for transcribing RNA using a nucleotide reagent as the promoter. The invention can be applied notably to the detection, synthesis or quantification of RNA (Abstract). Cheynet-Sauvion discloses that the single-stranded DNA transcription system comprises a template strand (a) of 50 bases having the sequence 3'ATTATGCTGAGTGATATCCCAACCGGCGTCACAAGTGAGTACCAATACCG5' and hybridized from positions -17 to + 1 with the non-template promoter strand (b) having the sequence 5'TAATACGACTCACTATAG 3' (blocked at its 3' end) (See [0107]), where the non-template promoter strand sequence is identical to the SEQ ID NO: 28 as claimed (See Table C below).
PNG
media_image6.png
551
1016
media_image6.png
Greyscale
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Cheynet-Sauvion to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known sequence of Cheynet-Sauvion to substitute the promoter sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid sequence based on the sequence disclosed in Cheynet-Sauvion and the synthesis’s method of Thao.
(New Rejection-necessitated by amendment) Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of CP035535-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/CP035535) and KF192692-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/KF192692).
Claim 15 requires the vector comprises the sequences comprising SEQ ID NO: 46 and SEQ ID NO: 47.
The relevance of Thao is set forth above. It is silent on a vector sequence comprising SEQ ID NOs: 46-47.
CP035535-BLAST teaches a caulobacter ethensis 2.0 (C.ETH-2.0) genome ssembled from chemically synthesized oligonucleotides using de novo DNA synthesis (See page 1) that shows comprising an identical sequence to the claimed SEQ ID NO: 46 (See Table D below).
KF192692-BLAST teaches a Yeast shuttle vector pJHU2, complete sequence. The vector sequences comprise an identical sequence to the claimed SEQ ID NO: 47 (See Table E below).
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao, CP035535-BLAST and KF192692-BLAST to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known sequence of CP035535-BLAST and KF192692-BLAST to substitute the vector sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid based on the sequence disclosed in CP035535-BLAST and KF192692-BLAST, and the synthesis method of Thao.
PNG
media_image7.png
672
687
media_image7.png
Greyscale
PNG
media_image8.png
457
622
media_image8.png
Greyscale
(New Rejection-necessitated by amendment) Claims 16 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of Regla-Nava et al. (J Virol. 2015 Apr;89(7):3870-87, hereinafter “Regla-Nava”).
Claim 16 requires that the vector does not comprise sequence part B, and wherein regulation of sequence part A does not comprise an accessory protein.
The relevance of Thao is set forth above. It is silent on the exclusion of an envelope protein E of a coronavirus (sequence part B).
Regla-Nava describes the severe acute respiratory syndrome coronaviruses with mutations in the E protein are attenuated and promising vaccine candidates, and teaches that a mouse adapted SARS-CoV (SARS-CoV-MA15) lacking the envelope (E) protein (rSARS-CoV-MA15-ΔE) is attenuated in vivo. Their results suggested that the reduction in lung inflammation together with a more robust antiviral T cell response contributed to rSARS-CoV-MA15-E* attenuation. The attenuated viruses completely protected mice against challenge with the lethal parental virus, indicating that these viruses are promising vaccine candidates (Abstract).
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Regla-Nava to arrive at an invention as claimed. One of skill in the art would have been motivated to do so because Regla-Nava teaches the rSARS-CoV-MA15-E* is stable and increase the half- life compared to the wild-type virus. Moreover, the Δ3 deletion introduced within the E protein maintained the interaction between E and M proteins. SARS-CoV attenuation correlated with limited lung pathology, mediated by decreased proinflammatory cytokine expression, increased anti-inflammatory cytokine levels, and reduced neutrophil accumulation in the lungs (See bridging pages 3884-3885). There would be a reasonable expectation of success to construct such a vector with E protein deletion/modification.
As for the limitation “wherein regulation of sequence part A does not comprise an accessory protein” claimed in claim 16, Thao teaches the GenScript perform the chemical synthesis of the nucleocapsid protein N (Sequence part A) for the viruses such as MHV-GFP, MERS-COV, and discloses that the overlapping cDNA fragments are cloned into the TAR vector under the T7 RNA polymerase promoter (See page 19). There is no evidence in Thao’s study to indicate that the sequence part A is regulated by accessory proteins.
(New Rejection-necessitated by amendment) Claims 21, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 1-5, 8-10, 13-14 and 17-18 above, and further in view of Georges et al. (WO2021163536A2, published on Aug. 19, 2021, international Filing date: Feb. 12, 2021) and Jarvis et al. (WO2021255288A2, published on Dec. 23, 2021, priority date: June 19, 2020 and Sep. 18, 2020).
Claim 21 is directed to a vaccine against coronavirus SARS-CoV-2 comprising at least one nucleic acid according to claim 1 and products obtainable by gene expression using at least one nucleic acid in a production organism, wherein the products comprise at least one of a virus envelope, a fragment of a virus envelope, or a virus envelope protein that packages the at least one nucleic acid.
Thao teaches that they selected two clones for each construct for rescuing recombinant rSARS-CoV-2 and rSARS-CoV-2-GFP. The supernatants transferred to fresh VeroE6 cells contained infectious recombinant viruses for almost all recombinant rSARS-CoV-2 and rSARS-CoV-GFP constructs (See page 9, lines 182-197), which indicates that an infectious viral particle is formed. Because the constructs of rSARS-CoV-2 and rSARS-CoV-2-GFP comprises the structural proteins of Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N) include the E protein (See Fig. 3 above), it would be obvious that the virus envelope protein, Envelope (E), package the nucleic acid as claimed for the infectious particles of rSARS-CoV-2 and rSARS-CoV-2-GFP, and wherein the envelope proteins of SARS-COV-2 can be a vaccine candidate for against coronavirus SARS-CoV-2.
Nevertheless, Georges teaches an invention related to an immunogenic composition (e.g., vaccine) comprising an adenoviral vector encoding at least one 2019 novel coronavirus SARS-CoV-2 antigen(s) ("a SARS-Cov-2 transgene"), compositions comprising the same, and the use thereof for inducing a protective immune response against SARS-CoV-2 (See [00114]), and the SARS-CoV-2 antigen can be a spike (S) antigen or other SARS-Co V-2 antigen as disclosed in their invention (See [00116]). In Table 4, Georges teaches an HLA class I and/or HLA class II motifs across the SRAS-CoV-2 proteome (SEQ ID NO. 410) (See [00184]) and Table 4), where the SEQ ID NO: 410 contains sequence that has 99% identity to the instant SEQ ID NO: 10 as claimed in the claim 22 (See Table F below).
PNG
media_image9.png
385
836
media_image9.png
Greyscale
Jarvis teaches a vaccine vectors providing for prevention of SARS-CoV-2 infection and thereby control of coronavirus disease 2019 (COVID-19) and which ameliorates disease conditions caused thereby (See column 1, lines 24-25). Jarvis teaches that in some embodiments providing a BoHV-4 based vector expressing a SARS-CoV-2 spike protein or a partial sequence/fragment for vaccine antigen (See page 2, lines 7-8), and the vector expressing one or more SEQ ID NO: 1-9 (See page 4, lines 12), where the SEQ ID NO: 1 contain sequences that is 99.9% identical the SEQ ID NO:14 (See Table G below) as claimed in the claim 22 and claim 24.
PNG
media_image10.png
357
927
media_image10.png
Greyscale
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao, Georges and Jarvis to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known sequence of Georges and Jarvis to substitute a nucleic acid coding for at least one or two of protein components for vaccine development (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to producing a vaccine using one or two protein components of SEQ ID NOs 10 and 14 against coronavirus SARS-CoV-2 as claimed in claims 22 and 24.
Allowable Subject Matter
The SEQ ID NOs: 13 or a sequence having at least 98.5% sequence identity to the sequence as defined in SEQ ID NO: 13 are free of art.
The SEQ ID NOs: 49 or a sequence having at least 97.2% sequence identity to the sequence as defined in SEQ ID NO: 49 are free of art.
Accordingly, claims 26 and 27 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUIXUE WANG whose telephone number is (571)272-7960. The examiner can normally be reached Monday-Friday 8:00 am-5:00 pm, EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached on (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUIXUE WANG/ Examiner, Art Unit 1672
/THOMAS J. VISONE/ Supervisory Patent Examiner, Art Unit 1672