Prosecution Insights
Last updated: July 17, 2026
Application No. 18/280,699

MINIMAL NEPHRIN PROMOTER

Non-Final OA §102§103§112
Filed
Sep 07, 2023
Priority
Mar 12, 2021 — GB 2103470.7 +3 more
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Syncona Ip Holdco (3) Limited
OA Round
1 (Non-Final)
75%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allowance Rate
1089 granted / 1451 resolved
+15.1% vs TC avg
Moderate +11% lift
Without
With
+11.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
70 currently pending
Career history
1509
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
47.9%
+7.9% vs TC avg
§102
8.3%
-31.7% vs TC avg
§112
20.1%
-19.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1451 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Sequence Compliance This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 because there are sequences in claim 16 and in the specification on pages 6 and 98, for example, that do not contain a SEQ ID NO. A complete response to this office action must correct the defects cited above regarding compliance with the sequence rules and a response to the action on the merits which follows. The aforementioned instance of failure to comply is not intended as an exhaustive list of all such potential failures to comply in the instant application. Applicants are encouraged to thoroughly review the application to ensure that the entire application is in full compliance with all sequence rules. This requirement will not be held in abeyance. Drawings The drawings filed on 9/7/23 are objected to because they are not fully legible. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-5, 8-11, 16, 30-37, 42, 44-49, 52-61 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 is directed to aa promoter that “has a length of about 1.1 kb or less”. The claim language is indefinite because it is unclear what length limitation is intended. The language “has a length” is open language, consistent with “comprising” and therefore can have the length and more. The language “about 1.1 kb” appears to intend to limit the length to a range in proximity to 1.1 kb, which conflicts with the open language of “has a length”. Additionally, it is not clear whether “or less” is in relation to the “about” language (less than 1.1 kb but still about 1.1 kb) or if it is to be interpreted as about 1.1 kb or any number less (i.e. 50 nt which is less but not about 1.1 kb). Claim 10 requires for the promoter of claim 1 to have a length from 265 to 500 nucleotides, which recites open language but demonstrates that applicant intends from the claim language of claim 1 to encompass sequences much shorter than 1.1. kb and for the “less” to mean anywhere from 1 to about 1.1 kb or more (open language). Claims 2-5, 8-11, 16, 30-37, 42, 44-49, and 52-61 recite “according” to, which is indefinite because it is not clear what specific structural relationship is required for the promoter to be “according” to the recited claim. For claim 2, for example, recitation of “A promoter comprising or consisting of the nucleotide sequence of SEQ ID NO: 1…”, would obviate this rejection. For claim 3. For example, recitation of “The promoter of claim 2, wherein…”, would obviate this rejection. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-5, 8-11, 16, 29-33, 35-37, 42, 44-49, 52-61 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Instant claim 1 is directed to any promoter of any length up to about 1,100 nucleotides or less (i.e. 1,000 nt) that comprises a nucleotide sequence of any length (i.e. 4 nt) having at least 70% identity to SEQ ID NO: 4 or 17 (each consist of 77 nt) and wherein the promoter has a length of about 1.1 kb or less (1,100 nucleotides). The specification discloses SEQ ID NO: 1 as a functional nephrin promoter. The single species is not representative of the entire claimed genus. The specification does not adequately describe the structure required for the function. The claim language encompasses an enormous genus of possible sequences that would not likely have the required structure to function as a nephrin promoter. A functional promoter is a DNA region that initiates transcription and orchestrates gene expression by recruiting RNA polymerase and transcription factors. Its activity depends on specific cis-regulatory sequence elements arranged in a spatially defined manner (transcription start site (TSS), Initiator sequence, etc.). For example, Haberle et al. (Nature Reviews, Molecule Cell Biology, 19, 2018, 621-637) reviews elements required for promoter function (i.e. core promoter motifs and consensus sequences of Table 1), wherein the instant genus encompasses sequences of varying lengths that would not necessarily comprise each of the required structural elements for promoter function. Instant claim 2 is directed to any promoter of any length (i.e. thousands of nucleotides) which comprises a nucleotide sequence of any length “according to” SEQ ID NO: 1 but wherein:(i) position 1 to position n1 of SEQ ID NO: 1 is deleted, wherein n1 is an integer from 100 to 430; and/or (ii) position n2 to position n3 of SEQ ID NO: 1 is deleted, wherein n3 = n2, n2 is an integer from 508 to 1061, and n3 is an integer from 508 to 1061; or a nucleotide sequence of any length (i.e. thousands of nucleotides) with at least 70% identity thereto. The specification discloses SEQ ID NO: 1 as a functional nephrin promoter. The single species is not representative of the entire claimed genus. The specification does not adequately describe the structure required for the function. The claim language encompasses an enormous genus of possible sequences that would not likely have the required structure to function as a nephrin promoter. Additionally, the claim part (ii) is comparing two positions, n2 and n3, that have no specific placement in SEQ ID NO: 1 relative to position 1. Part (i) of the claim defines position n1 in relation to position 1, but part (ii) has no recitation with regards to position 1. The claim requires very large deletions from SEQ ID NO: 1 wherein the sequence can be of any length and be as little as 70% identical which encompasses additional deletions, a genus of which the specification does not adequately describe. Instant claim 3 is directed to the promoter according to claim 2, wherein:(iii) the position corresponding to position 493 of SEQ ID NO: 1 is G, the position corresponding to position 1080 of SEQ ID NO: 1 is T, the position corresponding to position 1169 of SEQ ID NO: 1 is C, and the position corresponding to position 1249 of SEQ ID NO: 1 is G. The specification discloses SEQ ID NO: 1 as a functional nephrin promoter. The single species is not representative of the entire claimed genus. The specification does not adequately describe the structure required for the function. The claim language encompasses an enormous genus of possible sequences that would not likely have the required structure to function as a nephrin promoter. The specification does not adequately describe the genus of sequences encompassed by the instant claim language having the minimal sequence requirements of claim 3. Instant claim 4 is directed to the promoter of claim 2, wherein the promoter comprises (i) a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 4 or 17 and/or wherein the promoter has a length of about 1.1 kb or less. Instant SEQ ID NOs: 4 and 17 are 77 nt in length and is disclosed as proximal promoter regions. The claim is directed to any promoter of claim 2 (i.e. any nucleotide sequence of any length having 70% identity to any sequence of parts (i) or (ii) of claim 2) that comprises a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 4 or 17 (70% identity to a 77-mer). The specification does not adequately describe this genus and does not adequately describe the structure required for the promoter to be functional. Instant claim 8 is directed to the promoter of claim 1, wherein the promoter comprises from 5' to 3': (i) a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 4 or 17; (iii) optionally a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 8, or one or more fragments thereof; and (ii) a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 5 or 18, a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 6 or 19, and/or a nucleotide sequence of any length having at least 70% identity to SEQ ID NO: 7 or 20. The specification does not disclose adequate species with as little as 70% identity to each of the instantly recited sequences within the constructs of claim 1 that function as required. The specification does not adequately describe the structure required for the function. Additionally, the specification does not define or describe what structure is required for the fragment that function as required. A fragment can be 2 nt. Claim 9 requires for the promoter of claim 1 to have a length of 700 nucleotides or less. Claim 10 requires for the promoter of claim 1 to have a length from 265 to 500 nucleotides. These claims further demonstrate that the claims encompass an enormous possible genus of sequences of varying lengths that are not adequately described by the specification. Claim 16 is directed to the promoter “according” to claim 1 wherein one or more of the following nucleotide sequences is present in the nucleotide sequence having at least 70% identity to SEQ ID NO: 4 or 17:(a) GGGGTCA at a position corresponding to position 7 to position 13 of SEQ ID NO: 4 or 17; (b) CGGAGGCTGGGGAGGCA at a position corresponding to position 14 to position 30 of SEQ ID NO: 4 or 17; and (c) ATGTG at a position corresponding to position 49 to position 53 of SEQ ID NO: 4 or 17. The claim introduces additional variation into the enormous genus of possible sequences and fragments. Although claim 29 requires for the promoter to consist of a nucleotide sequence having at least 70% identity to SEQ ID NO: 47, the sequence that is 70% identical to SEQ ID NO: 47 can be missing necessary sequences for the promoter to have the required function. Additionally, the claim does not require for the sequence that consists of a sequence that is at least 70% identical to SEQ ID NO: 47 to have any specific length and therefore encompasses a sequence of 4-nt, for example. Although claim 30 requires for the promoter to consist of a nucleotide sequence having at least 90% identity to SEQ ID NO: 47, the sequence that is 90% identical to SEQ ID NO: 47 can be missing necessary sequences for the promoter to have the required function. Additionally, the claim does not require for the sequence that consists of a sequence that is at least 90% identical to SEQ ID NO: 47 to have any specific length and therefore encompasses a sequence of 4-nt, for example. Although claim 31 requires for the promoter to consist of a nucleotide sequence having at least 95% identity to SEQ ID NO: 47, the sequence that is 95% identical to SEQ ID NO: 47 can be missing necessary sequences for the promoter to have the required function. Additionally, the claim does not require for the sequence that consists of a sequence that is at least 95% identical to SEQ ID NO: 47 to have any specific length and therefore encompasses a sequence of 4-nt, for example. Although claim 32 requires for the promoter to consist of a nucleotide sequence having at least 98% identity to SEQ ID NO: 47, the sequence that is 98% identical to SEQ ID NO: 47 can be missing necessary sequences for the promoter to have the required function. Additionally, the claim does not require for the sequence that consists of a sequence that is at least 98% identical to SEQ ID NO: 47 to have any specific length and therefore encompasses a sequence of 4-nt, for example. Although claim 33 requires for the promoter to consist of a nucleotide sequence having at least 99% identity to SEQ ID NO: 47, the sequence that is 99% identical to SEQ ID NO: 47 can be missing necessary sequences for the promoter to have the required function. Additionally, the claim does not require for the sequence that consists of a sequence that is at least 99% identical to SEQ ID NO: 47 to have any specific length and therefore encompasses a sequence of 4-nt, for example. Claim 35 is directed to a polynucleotide of any length (i.e. 10,000 nt) comprising the promoter according to claim 1. The specification does not adequately describe sequences of any possible length comprising any of the possible sequences of claim 1. Claim 37 is directed to the polynucleotide according to claim 35, wherein the promoter is operably linked to a protein coding sequence encoding NPHS2 or a fragment and/or variant thereof; a COL4A3, COL4A4 or COL4A5 polypeptide, or a fragment or derivative thereof; or CFI, CFH or FHL-1, a fragment and/or variant thereof. The specification does not define or disclose even a single species of fragments or variants of any of the recited protein coding sequences or polypeptides. Without further description of the genus, one would not be able to readily envision which fragments or which sequences of what level of variation would function as required. Claim 52 is directed to a polynucleotide of any length (i.e. 10,000 nt) comprising the promoter according to claim 29. The specification does not adequately describe sequences of any possible length comprising any of the possible sequences of claim 29. Claim 54 is directed to the polynucleotide according to claim 52, wherein the promoter is operably linked to a protein coding sequence encoding NPHS2 or a fragment and/or variant thereof; a COL4A3, COL4A4 or COL4A5 polypeptide, or a fragment or derivative thereof; or CFI, CFH or FHL-1, or a fragment and/or variant thereof. The specification does not define or disclose even a single species of fragments or variants of any of the recited protein coding sequences or polypeptides. Without further description of the genus, one would not be able to readily envision which fragments or which sequences of what level of variation would function as required. The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being double stranded RNAi agents of any length that comprise 15 contiguous nucleotides of instant SEQ ID NO: 669 in the antisense strand in the same or a different portion than the double-stranded region and have no other sequence specificity to any specific HAO1 target sequence and function by inhibiting the expression of HAO1. The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing. Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for sequences within the instant enormous genus that have the required function. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed. Claims 49 and 61 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of delivering the instantly recited sequences, does not reasonably provide enablement for a method of preventing or treating any glomerular disease comprising administration via any means of any sequence within the instantly recited genus. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in a determination of lack of enablement include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988) The claims are directed a method of absolute prevention or treating any glomerular disease comprising administration via any means of any sequence within the instantly recited genus, which encompasses delivery of a sequence of any length that has at least 70% identity to instant SEQ ID NO: 4 or 17 within a larger sequence of any length. The specification demonstrates delivery of specific promoter sequences to glomerular endothelial cells via transducing the cells with a lentiviral vector comprising the construct; and AAV transfer plasmids comprising COL4A3, COL4A4, or COL4A5 coupled to a specific nephrin promoter sequence in vitro; and delivery via tail vein IV injection of AAV expressing a CFH transgene under control of a specific nephrin promoter sequence. The specification does not draw an adequate nexus between delivery of any possible sequence of the instantly recited genus naked via any mode of administration and the predictable outcome of the absolute prevention or treating any glomerular disease. Even with regards to delivery of nucleotide sequences consisting of the instantly recited sequences, the specification does not draw an adequate nexus between delivery of the promoter alone without any specific coding sequence and the predictable outcome of the absolute prevention or treating any glomerular disease. A functional promoter is a DNA region that initiates transcription and orchestrates gene expression by recruiting RNA polymerase and transcription factors. Its activity depends on specific cis-regulatory sequence elements arranged in a spatially defined manner (transcription start site (TSS), Initiator sequence, etc.). For example, Haberle et al. (Nature Reviews, Molecule Cell Biology, 19, 2018, 621-637) reviews elements required for promoter function (i.e. core promoter motifs and consensus sequences of Table 1), wherein the instant genus encompasses sequences of varying lengths that would not necessarily comprise each of the required structural elements for promoter function. The instant claims encompass delivery of a large genus of sequences that differ from the recited sequences greatly and would not predictably function as claimed. The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of delivering an enormous possible genus of sequences that differ greatly from the recited sequences via any mode of administration without any specific coding sequence encompassing in vivo effects. MPEP 2164.01 Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention. Also, MPEP 2164.01(a) A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993). Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any sequence of the instant genus in vivo by the broadly disclosed methodologies of the instantly claimed invention, would result in successful prevention or treatment of any glomerular disease. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention. A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1, 8-10, 35, 36, 42, and 44-48 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Wu et al. (US 7,750,207 B2). Wu et al. teach a promoter sequence that comprises a sequence that has at least 70% identity to instant SEQ ID NO: 4 (SEQ ID NO: 6124 of Wu et al. is 2477 nt and comprises a sequence (fragment) that is 100% identical to SEQ ID NO: 4 (see first underlined portion below)). The promoter has a length (comprises) about 1.1 kb (2477 nt) (instant claims 1, 9, and 10). The longer sequence of Wu et al. is a polynucleotide comprising the promoter (instant claim 35). See the PE2E search file titled “us-18-280-699a-4.rni” as follows:RESULT 176 US-11-514-704-6124 Sequence 6124, US/11514704 Patent No. 7750207 GENERAL INFORMATION APPLICANT: MONSANTO TECHNOLOGY, LLC APPLICANT: Wu, Kunsheng APPLICANT: Dasgupta, Santanu APPLICANT: Cherian, Shoba APPLICANT: Jayaprakash, Targolli L TITLE OF INVENTION: Zea mays Ribulose Bisphosphate Carboxylase TITLE OF INVENTION: Activase Promoter FILE REFERENCE: 38-21(53660)C CURRENT APPLICATION NUMBER: US/11/514,704 CURRENT FILING DATE: 2006-09-01 NUMBER OF SEQ ID NOS: 25043 SEQ ID NO 6124 LENGTH: 2477 TYPE: DNA ORGANISM: Zea mays FEATURE: NAME/KEY: misc_feature LOCATION: (2420)..(2420) OTHER INFORMATION: n is a, c, g, or t Query Match 33.2%; Score 25.6; Length 2477; Best Local Similarity 70.8%; Matches 34; Conservative 0; Mismatches 14; Indels 0; Gaps 0; Qy 1 GGCCCTGGGGTCACGGAGGCTGGGGAGGCACCGAGGAACGCGCCTGGC 48 || ||||| ||||||||||| |||| | || ||| ||| ||| Db 68 GGAGGTGGGGCGTCGGAGGCTGGGAAGGCCGCATGGGACGGGCCCGGC 21 The second underlined portion is a nucleotide sequence having at least 70% identity to instant SEQ ID NO: 5 located 3’ to the first nucleotide sequence having 100% identity to SEQ ID NO: 4 (instant claim 8). Wu et al. teach that the promoter is operably linked to a protein coding sequence (column 3) (instant claim 36). Wu et al. teach a vector comprising the polynucleotide (column 17) (instant claim 42). Wu et al. teach that the vector is a viral vector (column 31) (instant claims 44 and 45). The present invention provides gene regulatory element polynucleotide molecules, including a promoter and a leader, identified from the ribulose bisphosphate carboxylase activase (RUA) Zea mays gene, useful for expressing transgenes in plants. The invention further discloses compositions, polynucleotide constructs, transformed host cells, transgenic plants and seeds comprising the Zea mays gene regulatory molecules, and methods for preparing and using the same (abstract) (instant claims 47 and 48). Therefore, the claims are anticipated by Wu et al. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 46 is/are rejected under 35 U.S.C. 103 as being unpatentable over Wu et al. (US 7,750,207 B2) as applied to claims 1, 8-10, 35, 36, 42, and 44-48 above, and further in view of Li et al. (Molecular Therapy, vol. 23, no. 12, 1867–1876, 2015). Wu et al. does not teach that the vector is encapsidated by AAV3B capsid proteins. However, this would have been obvious because Li et al. teach efficient and targeted transduction of liver with systemically delivered optimized AAV3B vectors (title) with successful delivery and no apparent vector-related toxicity (page 1867). Therefore, one would have been motivated to encapsidate the vector of Wu et al. with AAV3B capsid proteins with the expectation of the benefits taught by Li et al. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Sep 07, 2023
Application Filed
May 26, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680102
miRNAS FOR REDUCING VENTRICLE ENLARGEMENT
4y 5m to grant Granted Jul 14, 2026
Patent 12680099
COMPLEMENT COMPONENT C3 iRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING COMPLEMENT COMPONENT C3-ASSOCIATED DISEASES
3y 10m to grant Granted Jul 14, 2026
Patent 12668797
COMPOSITIONS AND METHODS FOR TREATING CHRONIC MYELOMONOCYTIC LEUKEMIA
3y 11m to grant Granted Jun 30, 2026
Patent 12668798
ANTISENSE NUCLEIC ACID TARGETING APOC3
3y 9m to grant Granted Jun 30, 2026
Patent 12668819
CRISPR-AID USING CATALYTICALLY INACTIVE RNA-GUIDED ENDONUCLEASE
3y 9m to grant Granted Jun 30, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.2%)
2y 5m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1451 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month