DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 09/08/2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Status of Claims
This office action is in response to an amendment filed on March 20, 2026.
Claims 1-14 were previously pending and subject to restriction and election requirement. Applicant amended claim 14; added new claim 15.
Claims 1-15 are currently pending, with claims 10-15 withdrawn.
Claims 1-9 are under consideration. This is the first action on the merits.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-9) in the reply filed on March 20, 2026 is acknowledged 1.
Claims 10-15 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1-9.
Priority
The effective filling date of the instant claims 1-9 is 09/08/2023, the filling date of the instant U.S. nonprovisional application.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Specifically, Applicant's claim to domestic priority is acknowledged as a 371 national stage entry of PCT/CN2022/111610. Applicant's claim to foreign priority to CHINA Application 202210530059.6 is also acknowledged. However, neither of the submitted document is in English, and English translations have not been submitted.
The domestic benefit date may be the effective filing date of the claimed invention if:
• the earlier application to which domestic benefit is claimed supports the claimed invention under 35 U.S.C. 112(a).
The foreign priority date may be the effective filing date of the claimed invention if:
• the foreign application supports the claimed invention under 35 U.S.C. 112(a), AND
• the applicant has perfected the right of priority by providing a certified copy of the priority application, and a translation of the certified copy (if not in English) along with a statement that the translation of the certified copy is accurate.
See MPEP 213.04 and 216; See also MPEP 2304.01(c)
In this instant case, the priority documents submitted are not in English, without a translation; without a English translation, the examiner is unable to verify whether the earlier applications provide written description support for the claimed invention under 35 U.S.C. 112(a). Thus, since an English translation of the priority application has not been filed, the effective filing date (EFD) of the claimed invention is the filing date of the US nonprovisional application.
However, if applicant perfects the right of priority by providing an certified English translation of the priority application that supports the claimed invention under 35 U.S.C. 112(a), the effective filing date will be the filing date of the foreign application.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purpose of applying prior art, claim 1 recites:
A probe for nucleic acid capture and enrichment, comprising:
(1) a probe binding sequence complementarily pairing with another probe, and
(2) a target specific sequence complementarily pairing with a nucleic acid target sequence.
Here, it is noted that the intended use in the claim's preamble "for nucleic acid capture and enrichment" does not differentiate the claimed product from a prior art product comprising the same structural limitations as claimed, see MPEP 2114II.
See also in MPEP §2111.02:
"If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction."
In this instant case, the descriptive language "for nucleic acid capture and enrichment" merely state the intended use of the probe, rather than defining a structural limitation.
Thus this intended use does not limit the claimed invention
Regarding claim 1, it recites a probe comprising a "probe binding sequence complementarily pairing with another probe" and a "target specific sequence complementarily pairing with a nucleic acid target sequence."
The specification does not expressly define the terms "probe binding sequence" and "target specific sequence" with any structural features. As recited, these terms are defined only by their complementarily to "another probe" and a "target sequence," respectively. However, neither of "another probe" or "target sequence" is structurally defined or required by the claim.
Further, the application does not define "complementarily pairing" with any specific parameters, such as the number of nucleotides required for pairing, the length of contiguous complementary regions, or the number of permissible mismatches, etc. The term is therefore given its ordinary meaning, which broadly encompasses base pairing between two nucleotides 2. Under this interpretation, even minimal complementarity (e.g., a single G pairing with a C) would satisfy the recited limitation.
Accordingly, under BRI, the terms "probe binding sequence" and "target specific sequence" encompass any nucleotide sequences, as any sequence can be complementary to some undefined sequence.
Regarding all claims, terms such as "first" and "second" are interpreted as adjectives for identification purposes to distinguish between repeated instances of an element or limitation, and do not impose any additional features, such as any specific temporal limitation, any sequential order of steps, or any structural or composition differences.
See 3M Innovative Props. Co. v. Avery Dennison Corp., 350 F.3d 1365 (Fed. Cir. 2003) 3.
For the purpose of applying prior art, claim 9 recites:
"wherein the annealing temperature between the probe and the nucleic acid target sequence is greater than the annealing temperature between probes. "
This wherein clause is interpreted as descriptive language that does not further limit the claimed probe, as it lacks any corresponding structural features.
The specification does not provide an express definition of "annealing temperature." In the field of life science and molecular biology, "annealing temperature" is commonly understood as an adjustable reaction condition that can be selected and optimized by the user during processes such as PCR 4. Although the selection of annealing temperature may take into account the melting temperature (Tm) of a polynucleotide sequence, and Tm depends on factors including sequence length and composition, these structural features are absent in the claim. While a Tm can be calculated from a given sequence, the reverse is not true ꟷ neither an annealing temperature nor a Tm can define a specific polynucleotide sequence or structure.
The issue boils down to the fact that both melting temperature5 and annealing temperature depend on numerous factors, including structural features of the nucleic acid itself (e.g., sequence composition, length, and chemical modifications) as well as environmental conditions (e.g., salt concentration, additives such as denaturing or crowding agents, and concentrations of each composition). Without specifying these conditions or the sequences involved in annealing, the claimed sequence is not structurally defined and may encompass any sequence.
Accordingly, claim 9 merely describes conditions under which an annealing process may take place, rather than reciting any structural characteristic of the probe itself. Therefore, the limitation in claim 9 does not distinguish the claimed probe from probes in the prior art.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 3 and 6-8 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A) Regarding claim 3, it recites:
"wherein a 5' end of the probe has a first probe binding sequence complementarily pairing with a 3' end of another probe, and a 3' end of the probe has a second probe binding sequence complementarily pairing with a 5' end of another probe."
This claim language is indefinite because it is unclear whether the term "another probe" refer to the same probe as complementary pairing partner to the claimed probe in both instances, or "another probe" refer to two separate probes. In other words, it is unclear how many probes the claimed probe is intended to pair with ꟷ one probe at both ends, or two different probes, each binding at a respective end. It is also unclear whether the claim is intended to encompass both scenarios.
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, this wherein clause is interpreted to encompass both scenarios.
Claim 6 is rejected for depending from claim 3 and not remedying the indefiniteness.
B) Regarding claim 7, it recites "a 3' end or a 5' end of the probe has a biomarker."
This claim language is indefinite because the term "biomarker" in the claim and the entire disclosure is used in a manner inconsistent with its ordinary and customary meaning in the art.
A "biomarker" is commonly understood as follows:
"A biological molecule found in blood, other body fluids, or tissues that is a sign of a normal or abnormal process, or of a condition or disease. A biomarker may be used to see how well the body responds to a treatment for a disease or condition. Also called molecular marker and signature molecule." 6
Thus, a biomarker is generally understood as a biological molecule naturally present in a biological sample that indicates a disease or condition.
The specification does not provide an express definition of "biomarker," and mentions the term only once, indicating that it is preferably biotin:
"[017] Preferably, the 3' end or the 5' end of the probe has a biomarker.
[018] More preferably, the biomarker is biotin."
Thus, the only disclosed species of a "biomarker" is biotin. However, the disclosure describes the use of biotin as a labeling moiety for probes to enable enrichment of targets via affinity capture (e.g., using streptavidin beads), for example in the following sections:
"[003] Targeted enrichment is mainly divided into multiplex PCR amplification and targeted capture based on different enrichment principles. The latter is a probe-based liquid-phase hybrid capture technology, is a mainstream at present, and has the advantages of low probe design difficulty and high probe fault tolerance. The liquid-phase hybrid capture technology is that a biotin-labeled probe specifically binds to a target region in a solution, and target fragments captured by the probe are enriched by streptavidin magnetic beads. During this process, the probe labeled with biotin and liquid phase reaction conditions of hybrid capture have a significant impact on the capture efficiency of this system. " [emphasis added]
"[047] The present disclosure provides a set of probes for nucleic acid capture, wherein the probes are designed separately for a positive sense strand and a negative sense strand of a target region, the probes for the positive sense strand and the probes for the negative sense strand are arranged in a non-overlapping arrangement, and a 3′ or 5′ end of each probe is modified with biotin which can bind to streptavidin magnetic beads." [emphasis added]
The use of the "biomarker" biotin as a labeling moiety on probes for affinity capture is distinct from the ordinary meaning of a biomarker as a naturally occurring indicator of a biological condition. Accordingly, it is unclear what is encompassed by the term "biomarker" within the context of the claimed invention.
As the applicant acts as their own lexicographer by using "biomarker" to refer to a labeling moiety on probes for affinity capture, and the specification fails to provide a clear and specific re-definition when the term is used in a manner divergent from it commonly understood meaning in the art, the claim is indefinite because it does not allow a skilled artisan to ascertain of the scope of the invention with reasonable certainty. See MPEP § 2111.01(IV) (“The only exceptions to giving the words in a claim their ordinary and customary meaning in the art are (1) when the applicant acts as their own lexicographer. . . .¶ An applicant is entitled to be their own lexicographer and may rebut the presumption that claim terms are to be given their ordinary and customary meaning by clearly setting forth a definition of the term that is different from its ordinary and customary meaning(s) in the specification at the relevant time”).
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, the term "biomarker" is interpreted under BRI as any moiety capable of supporting affinity binding in molecular biology.
Claim 8 is rejected for depending from claim 7 and not remedying the indefiniteness.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-7 and 9 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Regarding claim 1, it recites a single probe comprising a "probe binding sequence" and a "target specific sequence," which are nucleic acid sequences having any sequence structure and length.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a probe, therefore to one of the of statutory categories.
Step 2A
According to MPEP § 2106, Step 2A is a two-prong inquiry, in which examiners determine in Prong One whether a claim recites a judicial exception, and if so, then determine in Prong Two if the recited judicial exception is integrated into a practical application of that exception. Together, these prongs represent the first part of the Alice/Mayo test, which determines whether a claim is directed to a judicial exception.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes.
The claims recite one probe without specifying any unique, markedly different characteristics compared to what occurs in nature. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature.
The courts have identified that "short, synthetic, single-stranded DNA molecule[s] that bind specifically to … intended targets nucleotide sequence[s]" are products of nature because they claim the same nucleotide sequence as naturally occurring DNA. See University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014). See also MPEP 2106.
Thus, the claimed probe comprising undefined nucleotide sequences is classified as nature-based product because it is not recited with any structural feature that can clearly distinguish the nucleic acid probe from the nucleic acids in nature, thus they could be either naturally occurring or they do not have markedly different characteristics compared to what occurs in nature.
In conclusion, the claims recite nature-based products.
Step 2A Prong 2 - Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim as a whole do not integrate the exception into a practical application of that exception.
For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
In this instant case, the claim does not recite any additional elements other than the judicial exception, that can transform the claimed nature-based products to something that are markedly different than their naturally occurring counterparts in their natural state.
Although the claim recites the intended use "for nucleic acid capture and enrichment," this merely presents a general linkage of the judicial exception to a field of use, which is insufficient to integrate the judicial exception into a practical application. See MPEP 2106.04(d).
Step 2B - Whether a Claim Amounts to Significantly More: No.
According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (citing Mayo Collaborative Servs. v. Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966).
In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify the naturally occurring nucleic acid in a manner that is not naturally occurring.
Since Applicant does not claim any specific sequences or modifications in claim 1, the nucleic acid fragment of the instant claims are equivalents of products of nature. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception.
The claim recites an intended use "for nucleic acid capture and enrichment." However, according to the application's disclosure, probe-based hybrid capture for target enrichment is well-known and routine in the art, described as the "mainstream at present" :
"[003] Targeted enrichment is mainly divided into multiplex PCR amplification and targeted capture based on different enrichment principles. The latter is a probe-based liquid-phase hybrid capture technology, is a mainstream at present, and has the advantages of low probe design difficulty and high probe fault tolerance. The liquid-phase hybrid capture technology is that a biotin-labeled probe specifically binds to a target region in a solution, and target fragments captured by the probe are enriched by streptavidin magnetic beads. During this process, the probe labeled with biotin and liquid phase reaction conditions of hybrid capture have a significant impact on the capture efficiency of this system. "
Therefore, the recited intended use cannot be the inventive concept.
Furthermore, the courts have said that for a probe sequence that merely performs its natural function of hybridizing to a complementary strand; in other words, without any structural change to the probe sequence, the resulting hybridization is a natural phenomenon. See, e.g., Roche Molecular Sys., Inc. v. Cepheid, No. 2017-1690, 2018 WL 4868033 (Fed. Cir. Oct. 9, 2018).
Therefore, this intended use of hybridizing probe to its target for nucleic acid capture and enrichment is not an inventive concept and is insufficient to render the claims to significantly more than the judicial exception itself.
The dependent claims 2-7 and 9 do not recite additional elements that amount to significantly more than the judicial exception.
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
However, if claim 1 is amended to specifically recite biotin-labeled probe (see [003], [[047] in specification for examples), that would be sufficient to overcome the 101 rejection.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-7 and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Liu (Liu et al. Catalytic hairpin assembly-based double-end DNAzyme cascade-feedback amplification for sensitive fluorescence detection of HIV-1 DNA. Anal Chim Acta. 2020 Feb 1;1096:159-165. doi: 10.1016/j.aca.2019.10.051. Epub 2019 Oct 23. PMID: 31883582).
PNG
media_image1.png
516
568
media_image1.png
Greyscale
Regarding claim 1, Liu teaches A probe (Scheme 1, H1 probe) comprising (1) a probe binding sequence complementarily pairing with another probe (Scheme 1, H1 probe, domains II, I, IV), and (2) a target specific sequence complementarily pairing with a nucleic acid target sequence (Scheme 1, H1 probe, domain III; page 161, right-hand col, lines 1-3, “T opens hairpin H1 (domain III) via a toehold mediated strand displacement reaction, leading to the formation of T-H1 hybrid complexes.”).
Regarding claim 2, Liu teaches wherein the probe binding sequence comprises a first probe binding sequence (Scheme 1, H1 probe, domain I) and a second probe binding sequence (Scheme 1, H1 probe, domain IV).
Regarding claim 3, Liu teaches a 5' end of the probe has a first probe binding sequence complementarily pairing with a 3' end of another probe (Scheme 1, H1 probe, domain I complementary to the 3’ end of cleaved portion of H3 probe comprising DABCYL quencher; see also page 161, section “3.1. Principle of the cascade-feedback amplification strategy” ), and a 3' end of the probe has a second probe binding sequence complementarily pairing with a 5' end of another probe (Scheme 1, H1 probe, domain IV complementary to the 5’ end of cleaved portion of H3 probe comprising FAM fluorophore; see also page 161, section “3.1. Principle of the cascade-feedback amplification strategy”)
Regarding claim 4, Liu teaches the probe binding sequence is 8-30 nt in length (Table S1, H1 probe comprising domain I, which is 13 nt in length).
Regarding claim 5, Liu teaches the target specific sequence is 20-80 nt in length (Table S1, H1 probe domain III sequence “ATGTGGAAAATCTCTAGCAGT” complementary to target is 21 nt in length).
Regarding claim 6, Liu teaches the first probe binding sequence complementarily pairing with another probe at the 5' end of the probe is 8-30 nt in length (Table S1, H1 probe comprising domain I “GTAAGTCAGCGAT”, which is 13nt in length) , and the second probe binding sequence complementarily pairing with another probe at the 3' end of the probe is 8-30 nt in length (Table S1, H1 probe comprising domain IV, “CACCCATGTAAGTTG,” which is 15nt in length).
Regarding claim 7, Liu teaches a 3' end or a 5' end of the probe has a biomarker (Scheme 1, H1 probe, domains I, IV comprise sequences that are targets for affinity binding of probe H3).
Regarding claim 9, it is anticipated by Liu because it does not recite any structural features applicable to the claimed probe. See "Claim Interpretation" for detailed discussion.
Claims 1-9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Thrippleton (WO2020249982A1 - In-situ concatenation of oligo-nucleotide probes for target detection; Published : 2020-12-17).
PNG
media_image2.png
454
520
media_image2.png
Greyscale
Regarding claim 1, Thrippleton teaches a probe (Figure 3, probe #2 for example) comprising:
(1) a probe binding sequence complementarily pairing with another probe (Figure 3; see also page 16, lines 28-31 to page 17, lines 1-9; page 3, lines 8-14; page 3, lines 21-31 to page 4, lines 1-5), and
(2) a target specific sequence complementarily pairing with a nucleic acid target sequence (Figure 3).
Regarding claim 2, Thrippleton teaches probe binding sequence comprises a first probe binding sequence and a second probe binding sequence (Figure 3, probe portions that bind to adjacent probes).
Regarding claim 3, Thrippleton teaches wherein a 5' end of the probe has a first probe binding sequence complementarily pairing with a 3' end of another probe, and a 3' end of the probe has a second probe binding sequence complementarily pairing with a 5' end of another probe (Figure 3; see also page 3, lines 11-13 “where each oligo-nucleotide's 5' and 3'
ends hold sequences designed to form helical stems in-situ with the neighbouring oligonucleotide in the presence of target sequences”; see also page 16, lines 28-31 to page 17, lines 1-9).
Regarding claim 4, Thrippleton teaches the probe binding sequence is 8-30 nt in length (page 10, lines 11-12, “The length of the flanking sequence may be chosen from between one and a plurality of nucleotides. The preferred length is between 5 and 15 nucleotides”).
Regarding claim 5, Thrippleton teaches the target specific sequence is 20-80 nt in length (Table 1, probe sequence 4 for example comprises sequence specific for target sequence 4, “TCCTGTGGGTCCTGAAACATTGCAGTTC,”which is 28 nt in length).
Regarding claim 6, Thrippleton teaches the first probe binding sequence complementarily pairing with another probe at the 5' end of the probe is 8-30 nt in length, and the second probe binding sequence complementarily pairing with another probe at the 3' end of the probe is 8-30 nt in length (page 10, lines 11-12, “The length of the flanking sequence may be chosen from between one and a plurality of nucleotides. The preferred length is between 5 and 15 nucleotides”).
Regarding claims 7-8, Thrippleton teaches a 3' end or a 5' end of the probe has a biotin (Fig 3 illustrating probes labeled at 3' and 5' end; page 5, lines 14-18, biotin-avidin labeling system can be used “in accordance with the invention.” Thus, a skilled artisan would understand that the disclosed invention also encompass embodiments where the probes’ 3’ or 5’ ends are labeled with biotin, to achieve FRET enabling conditions).
Regarding claim 9, it is anticipated by Thrippleton because it does not recite any structural features applicable to the claimed probe. See "Claim Interpretation" for detailed discussion.
Double Patenting- Obvious Type
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3 and 7 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3 of copending Application No. 18/280,967 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by the claims (Amended Claims - 09/08/2023) of the '967 application.
Instant claim 1 recites:
A probe for nucleic acid capture and enrichment (‘967 Application, claim 1), comprising:
(1) a probe binding sequence complementarily pairing with another probe(‘967 Application, claim 1), and
(2) a target specific sequence complementarily pairing with a nucleic acid target sequence (‘967 Application, claim 1).
Therefore, instant claims 1 and 7 are anticipated by claim 1 of the '967 application. Instant claims 2-3 are anticipated by claims 2-3 of the '967 application, respectively.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Prior Art
Below are relevant prior art not used in rejection but pertinent to the claims or disclosure.
Probes comprising both sequence complementary to a target nucleic acid, and sequence complementary to another probe, have been extensively taught in the prior art:
See Fig. 33 in US20200277663A1 - Methods for determining a location of a biological analyte in a biological sample; Published on: 2020-09-03;
See Fig. 5E in US20170220733A1 - Systems and methods for determining nucleic acids; published on 2017-08-03;
See Fig. 1 in US20210388424A1 - Methods for analyzing target nucleic acids and related compositions; Published on 2021-12-16;
See Figure 3B, Figure. 4 in Peng, Hanyong, et al. "Signal amplification in living cells: a review of microRNA detection and imaging." Analytical Chemistry 92.1 (2019): 292-308.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Claims 10-15 are withdrawn as being drawn to non-elected groups II-IV.
2 See Wikipedia (Complementarity (molecular biology) - Wikipedia; Archived March 17, 2020 on WaybackMachine).
"In molecular biology, complementarity describes a relationship between two structures each following the lock-and-key principle."
"Complementarity is achieved by distinct interactions between nucleobases: adenine, thymine (uracil in RNA), guanine and cytosine. Adenine and guanine are purines, while thymine, cytosine and uracil are pyrimidines. Purines are larger than pyrimidines. Both types of molecules complement each other and can only base pair with the opposing type of nucleobase. In nucleic acid, nucleobases are held together by hydrogen bonding, which only works efficiently between adenine and thymine and between guanine and cytosine."
3 holding that "first pattern" and "second pattern" is equivalent to "Pattern A" and "Pattern B": The use of the terms "first" and "second" is a common patent-law convention to distinguish between repeated instances of an element or limitation. See, e.g., Anchor Wall Sys., Inc. v. Rockwood Retaining Walls, Inc., 340 F.3d 1298, 1304 (Fed. Cir. 2003) ("first and second sidewall surfaces"); Springs Window Fashions LP v. Novo Indus., L.P., 323 F.3d 989, 992 (Fed. Cir. 2003) ("first and second opposed ends"). In the context of claim 1, the use of the terms "first . . . pattern" and "second . . . pattern" is equivalent to a reference to "pattern A" and "pattern B," and should not in and of itself impose a serial or temporal limitation onto claim 1." )
4 See "What is the difference between melting temperature and annealing temperature?"; Published June 22, 2020; www. aatbio.com/resources/faq-frequently-asked-questions/What-is-the-difference-between-melting-temperature-and-annealing-temperature;
"The melting temperature (Tm) is the temperature at which 50% of the double-stranded DNA is changed to single-stranded DNA. It relies directly on the length and composition of the DNA molecule. A longer strand and a higher guanine-cytosine (GC) content are favorable for a higher melting temperature.
The annealing temperature is the temperature used in the annealing step of a PCR reaction, which is highly dependent on the Tm of primers. The annealing temperature should be low enough to allow both forward and reverse primers to bind to the single-stranded DNA, but not so low as to enable the formation of undesired, non-specific duplexes or intramolecular hairpins. Thereby, the annealing temperature is usually set as a few degrees (3-6) lower than the lowest Tm of the primers.";
See also in Rychlik et al. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 1990 Nov 11;18(21):6409-12. doi: 10.1093/nar/18.21.6409. Erratum in: Nucleic Acids Res 1991 Feb 11;19(3):698. PMID: 2243783; PMCID: PMC332522.
5 It is well-established that melting temperature depends on multiple factors, including the exact sequence composition and base-pairing of both strands, GC content, duplex length, number and position of mismatches, hybridization type (e.g., DNA-DNA, DNA-RNA, RNA-RNA), DNA and salt concentrations, and nucleic acid modifications (See Dumousseau et al. MELTING, a flexible platform to predict the melting temperatures of nucleic acids. BMC Bioinformatics. 2012 May 16;13:101. doi: 10.1186/1471-2105-13-101. PMID: 22591039; PMCID: PMC3733425.)
6 see NCI Dictionary of Cancer Terms; www.cancer.gov/publications/dictionaries/cancer-terms/def/biomarker; Archived March 1, 2021 on WaybackMachine
Prosecution Insights