Prosecution Insights
Last updated: April 19, 2026
Application No. 18/281,304

DOUBLE AND SINGLE MUTATED PLANT HAVING INCREASED DEFENSE RESPONSE AND REDUCED DISEASE LEVELS, AND METHODS TO GENERATE SAME

Final Rejection §112
Filed
Sep 10, 2023
Examiner
FAN, WEIHUA
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ramot AT Tel Aviv University Ltd.
OA Round
2 (Final)
83%
Grant Probability
Favorable
3-4
OA Rounds
2y 9m
To Grant
96%
With Interview

Examiner Intelligence

Grants 83% — above average
83%
Career Allow Rate
527 granted / 634 resolved
+23.1% vs TC avg
Moderate +13% lift
Without
With
+12.9%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
36 currently pending
Career history
670
Total Applications
across all art units

Statute-Specific Performance

§101
9.2%
-30.8% vs TC avg
§103
21.0%
-19.0% vs TC avg
§102
15.3%
-24.7% vs TC avg
§112
38.4%
-1.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 634 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This is a Final Office Action in response to amendment filed on February 18, 2026. Claims 73, 76, 77, 79, 86, and 89 have been amended. Claims 74, 75, 78, 83, 88, and 89 have been cancelled. Claims 93-95 have been added as new claims. Claims 73, 76-77, 79-82, 84-87, 89, and 91-95 are now pending and examined herein. Response to Amendment The objections to the disclosure under Sequence Rule, and the Specification for failing to include sequence identifiers, are withdrawn in view of the amendment to the claims and the submission of Sequence Listing. The rejections of Claims 73-83, and 86-90 under 35 U.S.C. 103 as being unpatentable over Leibman‐Markus (Plant, cell & environment 41.10 (2018): 2313-2327) and Claims 84-85 and 91-92 over Leibman‐Markus in view of Siddiqui (Biology and Fertility of soils 36 (2002): 260-268.) are withdrawn in view of amendment to the claims Drawings The drawings remain objected to under 37 CFR 1.83(a) because they fail to show the sequence information as described in the specification. Specifically, the Specification states that FIG. 1 depicting a schematic presentation of the DNA and amino acid sequences of several mutants of the present invention; and FIG. 2 depicting a schematic presentation of the DNA and amino acid sequences of a double mutant of the present invention. However, Fig.1 and Fig.2 are not illegible. It is impossible to discern the sequences from the figures. Furthermore, the biological sequences should be properly submitted as according to the Sequence Rules if it is essential to the claimed invention or would be helpful in determining the patentability of the claimed invention. Any structural detail that is essential for a proper understanding of the disclosed invention should be shown in the drawing. MPEP § 608.02(d). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 73, 76-77, 79-82, 84-87, 89, and 92 remain, and new claims 93-95 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 73, 86, 89, and 93-95 (and their dependent claims) are rejected as being indefinite for the recitation of the terms “NRC4a” or “NRC4b” since these are arbitrary terms and are not definitive in the broad context of any plant species encompassed by the claims. In the instant claims, the claimed plant or method encompass plants of any species. The claims require the plant to have a double mutation in either of both “NRC4a” and “NRC4b”. However, the terms “NRC4a” or “NRC4b” appear to be arbitrary and it is not clear 1) if all plants have both “NRC4a” or “NRC4b” genes; and if not, then what plants have or not either or both of “NRC4a” or “NRC4b”; 2) what genes in each of the plant species should be categorized as “NRC4a” or “NRC4b”; or 3) more particularly, if there were a pair of genes which one should be name “NRC4a” or “NRC4b”; and 4) what are the criteria for naming any gene as “NRC4a” or “NRC4b”. MPEP states that “claims must be given their broadest reasonable interpretation in light of the specification”; that “During patent examination, the pending claims must be "given their broadest reasonable interpretation consistent with the specification." The Federal Circuit’s en banc decision in Phillips v. AWH Corp., 415 F.3d 1303, 1316, 75 USPQ2d 1321, 1329 (Fed. Cir. 2005)” (MPEP 2113). In the instant case, the Specification has not defined the terms “NRC4a” or “NRC4b”. The Specification states “In Solanaceae, a subfamily of NLRs termed NLR required for cell death (NRC) emerges as a key family of NLRs (Wu et al., 2017). The tomato NLR-NRC4a functions as an h-NLR and is required for defense signaling mediated by the xylanase receptor LeEIX2 (Leibman-Markus et al.,2018).” (p. 2, para. 1). Also in working examples, the Specification recites tomato NRC4a and NRC4b genes “SlNRC4b and SlNRC4Ab”. However, it should be pointed out that since the Specification is defective in providing any nucleotide or amino acid sequences, or even sequence identifiers (such GenBank accession numbers) regarding the “SlNRC4b and SlNRC4Ab”, it is not even clear whether –and how--the “SlNRC4b and SlNRC4Ab” in the working examples correspond to the “Solanaceae subfamily of NLRs termed NLR required for cell death (NRC) emerges as a key family of NLRs” in Wu et al., 2017. The state of the art, as referenced in the Specification, have not provided any unambiguous definition of the terms. For example, even when Wu et al., 2017 analyzed a “supareclade” of NRC family genes (“NRC superclade emerged from an NLR pair over 100 Mya. (A) Phylogeny of CNL (CC-NLR) identified from asterids (kiwifruit, coffee, monkey flower, ash tree, and tomato) and caryophyllales (sugar beet).” (Fig 4) the art does not provide any nomenclature standard that applicable to any plant species in order to discern which gene is NRC4a and which is NRC4b. In fact, even when Wu teaches “NRC4a” or “NRC4b” in Nicotiana benthamiana, there is no evidence or teaching regarding “NRC4a” or “NRC4b” in N. tabacum, a very closely related plant species and of a Solanaceae. This point is particularly relevant to claim 79. The claims are amended to limit the “double mutant plant line” to “being a member of the Solanaceae family and having endogenous expression of said NRC4a and NRC4b gene”. However, this amendment is not sufficient to resolve the indefiniteness, since the family Solanaceae encompass a huge number of diverse plant species, e.g., Nicotiana, as discussed above. Therefore, the metes and bounds of the claims are not clear. Dependent claims are included in this rejection for their failure to correct the deficiency of the base claims. Claims 93 and 94 are rejected as being indefinite for the recitation of “mutation in NRC4a is a mutation in the nucleic acid sequence GACACACAAATAGTGAGCAG (SEQ ID NO: 9)” or “mutation in NRC4b is a mutation in the nucleic acid sequence GAGCAGTTTATGGGATCTAT (SEQ ID NO: 10)”. It is not clear whether the nucleic acid sequences SEQ ID NO: 9 or 10 actually represent a mutation, or indicate where the mutation is located. For example, entire SEQ ID NO: 9 could be interpreted as an inserted mutation sequence into whatever the wild type “NRC4a” is. This issue is especially exacerbated by the indefiniteness associated with the terms “NRC4a” and “NRC4b” as discussed above Response to Applicant’s Remarks: Applicant argued for the withdrawn of the rejection based on the compliant ST.26 Sequence Listing and the amended the Specification with sequence identifiers “corresponding to the disclosed exemplary embodiments”. Applicant argued that these amendments remove ambiguity in the disclosure as to the sequences discussed in the working examples and further support claim interpretation, while independent claim 73 remains defined by the recited biological context (Solanaceae/endogenous expression). These arguments have been fully considered but not deemed persuasive. Firstly, the Specification as amended, does not indicate anywhere which of the SEQ ID Nos is actually the SlNRC4a or SlNRC4b. One has to make a guess, based on the claims 93-94 regarding SEQ ID NO: 9 and 10 and the alignment of SEQ ID NO: 9 or 10 with SEQ ID NO: 1 and 2, to assume that SEQ ID NO: 1 represent tomato (Solanum lycopersicum) SlNRC4a and SEQ ID NO: 2 NRC4b. Thus, Applicant’s assertion “amended the Specification with sequence identifiers corresponding to the disclosed exemplary embodiments” is not all that compelling since the amendment stops well short of clearly linking the exemplary embodiment with Sequence Identifiers. Moreover, as discussed above, it is still not clear, after considering the amendment to the claims and the Specification, what are the “NRC4a” and “NRC4b” genes in other plants in the Solanaceae family. For example, a BLASTN search of N. tabacum genome database against “K326” cDNA using the instant SEQ ID NO: 1 or 2 as query yield the following hits (only top 2 listed for brevity). How can one decide which one should be assigned as “NRC4a” or “NRC4b”, without being 1) arbitrary or 2) contradictory from Applicant’s intention, whatever it might be? A brief blast search of the eggplant genome database indicates an even trickier situation to decipher which genes should be called “NRC4a” or “NRC4b” (data not shown). Therefore, even if the claims are amended to exclusively limit the “NRC4a” or “NRC4b” to tomato, the Specification is not sufficiently clear as to what the genes “NRC4a” or “NRC4b” are actually referring to. Limiting to the huge Solanaceae family is far from sufficient to correct the deficiency. Alignment with SEQ ID NO: 1 against K326 tobacco cDNA >mRNA_144635_cds mRNA_144635 gene_85036|id=AT1G53350.1:evalue=7e-79:annot='Disease resistance protein (CC-NBS-LRR class) family';id=Solyc04g007070.2.1:evalue=0.0:annot='Cc-nbs-lrr, resistance protein'Length=2643 Score = 2085 bits (1129), Expect = 0.0 Identities = 2144/2638 (81%), Gaps = 53/2638 (2%) Strand=Plus/Plus >mRNA_116910_cds mRNA_116910 gene_69101|id=AT5G35450.1:evalue=6e-47:annot='Disease resistance protein (CC-NBS-LRR class) family';id=Solyc04g007070.2.1:evalue=0.0:annot='Cc-nbs-lrr, resistance protein'Length=1776 Score = 1615 bits (874), Expect = 0.0 Identities = 1479/1773 (83%), Gaps = 34/1773 (2%) Strand=Plus/Plus SEQ ID NO:2 vs K326 >mRNA_144635_cds mRNA_144635 gene_85036|id=AT1G53350.1:evalue=7e-79:annot='Disease resistance protein (CC-NBS-LRR class) family';id=Solyc04g007070.2.1:evalue=0.0:annot='Cc-nbs-lrr, resistance protein'Length=2643 Score = 1908 bits (1033), Expect = 0.0 Identities = 2132/2666 (80%), Gaps = 61/2666 (2%) Strand=Plus/Plus >mRNA_124981_cds mRNA_124981 gene_73710|id=AT5G35450.1:evalue=2e-60:annot='Disease resistance protein (CC-NBS-LRR class) family';id=Solyc04g007060.2.1:evalue=0.0:annot='Cc-nbs-lrr, resistance protein'Length=2079 Score = 1796 bits (972), Expect = 0.0 Identities = 1723/2088 (83%), Gaps = 42/2088 (2%) Strand=Plus/Plus Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 73, 76-77, 79-82, 84-87, 89, and 92 remain, and new claims 93-95 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The Federal Circuit has clarified the application of the written description requirement. The court stated that a written description of an invention "requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials". University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). The court also concluded that "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not description of that material". Id. Further, the court held that to adequately describe a claimed genus, Patent Owner must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to "visualize or recognize the identity of the members of the genus". Id. The claims are broad in scope in the following aspects: I. the claims are broad in scope in the plants encompassed. The claims encompass any plant species, e.g., any dicot or monocot plant, any crop or non-crop plant, any land plant, or even green algae. Even claim 79, which lists Solanum lycopersicum, Nicotiana tabacum, etc., also encompasses “NRC4a and/or NRC4b genes expressing plant, a NRC4a and/or NRC4b ortholog gene expressing plant” which could be any plant species that express either endogenous or heterologous (foreign, as in transgenic plant) “NRC4a and/or NRC4b” genes, the ambiguity of the terms notwithstanding. II. As discussed above in the “Indefiniteness” Section, the terms “NRC4a” and “NRC4b” have not been clearly defined in either the Specification or the art. As such, the terms are broadly interpreted as any NLR (nucleotide-binding domain and leucine-rich repeat-containing) proteins. III. Thirdly, the claims are broad in the scope of mutations in the “NRC4a” and “NRC4b”. As understood in the art, mutations could be any insertions, deletions, substitutions and/or additions at any position in any combination thereof. The claims require the broad genera of “NRC4a” and “NRC4b” genes to have the function of conferring increased disease resistance to any pathogen of any kind in any plant species when either or both “NRC4a” and “NRC4b” have homozygous mutation. In contrast to the broad scope, Applicant has only described CRISPR-mediated SlNRC4b single and SlNRC4Ab double mutant tomato plant (Example 1) wherein the slnrc4ab9-1 double mutant harbors the slnrc4bl-2 in NRC4b (a four-base deletion resulting in a frame shift and an early stop codon, resulting in a 61 aa truncated protein), and a single base deletion in SlNRC4a (a frame shift producing 35 mutated aa followed by an early stop codon, resulting in a 91 aa truncated protein) (Example 1); and that a double NRC4ab #9 line is significantly more resistant against Botrytis cinerea (Bc16) or X. euvesicatoria, C. fulvum, A. alternata or O. neolycopersici (Example 4, 5 and 6). However, Applicant has not described any double mutant of both “NRC4a” and “NRC4b” in any plant other than tomato; or the “NRC4a” and “NRC4b” genes in any other plant. In fact, even for the tomato plant, Applicant has not adequately described the identity of either “NRC4a” and “NRC4b” since the sequences provided in Fig. 1 are illegible and the Specification has not included any sequence listing or even positively link the terms with any sequence entry in the prior art. Furthermore, as discussed above in the 112(b) section, Applicant has not defined or described what “NRC4a” and “NRC4b” are referencing to in any of the broadly encompassed plant species. Applicant has not adequately described the structural features that are required to be retained by members of the claimed genus as to establish a structure-function relationship, or the structural features required to distinguish members of the claimed genera of “NRC4a” and “NRC4b” from other NLR genes. As understood in the art, NLR proteins share the structural features of having a nucleotide-binding domain and leucine-rich repeats domain. NLRs are broadly categorized into three subclasses, based on their N-terminal domains. (Ahn, The EMBO Journal 42: e111484 | 2023). However, there is no adequate description from either the prior art or the instant Specification regarding the structural features required for the identification of an NLR protein to be a “NRC4a” or “NRC4b”. Wu (2017) teaches phylogenetic analyses of the “NRC superclade” and that the NRC superclade is missing in rosids but present in the examined representatives of caryophyllales (sugar beet) and asterids (kiwifruit, coffee, monkey flower, ash tree, and Solanaceae species), and however, sugar beet and kiwifruit have only a single protein that groups with the NRC family (referred to as NRC-H), along with two and four NLRs, respectively, that cluster with the NRC-dependent NLRs (referred to as NRC-S). However, while Wu teaches an “NRC4” from Nicotiana benthamiana, there is no teaching of identifying a “NRC4a” or “NRC4b” in any given plant species. Furthermore, neither the Specification nor the prior art has adequately described the structural features of mutated “NRC4a” and/or “NRC4b” that would result in “an increased defense response” and a “reduction in disease level” (i.e., increased disease resistance). The Specification, as discussed above, has provided two truncated proteins with 61 and 91 N-terminal amino acids as the example of NRC4a/b double mutant in tomato for increased disease resistance. However, Wu (2017) teaches that silencing of NRC4 in N. benthamiana compromised Rpi-blb2 resistance to P. infestans (Fig. 1A) and hypersensitive cell death to the P. infestans effector AVRblb2. This indicated that NRC4 Is Required for Rpi-blb2–Mediated Immunity (p. 8114). Similarly, Wu also teaches that CRISPR/Cas9 mediated 53 kb deletion of the NRC4 gene cluster of tomato does not affect bacterial flagellin-triggered immunity. It is unclear which mutations of the protein required for immunity would increase the immunity. As Wu has shown, complete abolishment—of NRC4a/b does not result in increased immunity. Similarly, Adachi (Elife 8 (2019): e49956) teaches generation of N. benthamiana nrc4a/b double mutants using the CRISPR/Cas9 technology (p. 23). The nrc4a/b mutants are early stop codon mutants resulting in truncated proteins having 77 or 123 N-terminal amino acids, respectively for NbNRC4a and 4b (mutant 9.1.3) or 77 and 107 aa respectively (mutant 1.2.1) (Fig 2 supplemental fig. 1). However, Adachi teaches that the Rpi-blb2-mediated HR cell death was compromised in the (NRC4 knockout lines) N. benthamiana nrc4a/b double mutants, and the double mutant plants have at least, a reduced disease resistance mediated by Rpi-blb2. In contrast, the instantly disclosed working example of tomato NRC4a/b mutant have truncated proteins with 61 and 91 N-terminal amino acids. This suggest that even for highly similar mutants, their phenotype in disease resistance levels and spectrums are not adequately described. It is even less adequately described regarding the broadly claimed mutations of any kind in any positions and any combinations. Therefore, the Specification has not provided an adequate description of the broadly claimed genera of structures so as to establish a structure-function relationship, regarding the required functions of conferring increased disease resistance by the homozygous mutations in “NRC4a” and/or “NRC4b”. The analysis will now turn to the second element of the court’s decision in Eli Lilly; namely, the description of a representative number of species. Firstly, the number of NLR proteins having the CC-NBS-LRR domain structures is enormous across the plant kingdom and in each plant species, as evidenced by ample amount of prior art. As discussed above, the number of potential candidates for being possibly characterized (or arbitrarily named) as “NRC4a” or “NRC4b” in any given plant species could also be large given the lack of description or definition for those terms. Secondly, even, arguendo, only the tomato or N. benthamiana NRC4a/b is discussed as example, the potential number of mutants of either one of the NRC4a or NRC4b is enormous. Given the virtually infinite structural variable associated with these embodiments, the claims read on an extremely broad and highly diverse structures. Thus, in view of the analysis presented above, a skilled artisan would appreciate that the claims are directed to extremely broad and highly diverge genus of variants that are required to have the specific function of providing a plant with increased disease resistance. Given the large size and structural diversity associated with the claimed genus, Applicant’s disclosure is not representative of the claimed genus as a whole. This point is particularly relevant because, as discussed above, the prior art speaks to the disconnection between the structure of the broadly claimed variants and the recited specific function. Thus, based on the analysis above, Applicant has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly. As a result, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed. Enablement Claims 73-92 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. An “analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.” MPEP 2164.01. “A conclusion of lack of enablement means that. . . the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention [i.e. commensurate scope] without undue experimentation.” In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); MPEP 2164.01. In In re Wands, 858 F.2d 731,8 USPQ2d 1400 (Fed. Cir. 1988), several factors implicated in determination of whether a disclosure satisfies the enablement requirement and whether any necessary experimentation is “undue” are identified. These factors include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731,737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). No single factor is independently determinative of enablement; rather “[i]t is improper to conclude that a disclosure is not enabling based on an analysis of only one of the above factors while ignoring one or more of the others.” MPEP 2164.01. Likewise, all factors may not be relevant to the enablement analysis of any individual claim. The claims are broad in scope in the following aspects: I. the claims are broad in scope in the plants encompassed. The claims encompass any plant species, e.g., any dicot or monocot plant, any crop or non-crop plant, any land plant, or even green algae. Even claim 79, which lists Solanum lycopersicum, Nicotiana tabacum, etc., also encompasses “NRC4a and/or NRC4b genes expressing plant, a NRC4a and/or NRC4b ortholog gene expressing plant” which could be any plant species that express either endogenous or heterologous (foreign, as in transgenic plant) “NRC4a and/or NRC4b” genes, the ambiguity of the terms notwithstanding. II. As discussed above in the “Indefiniteness” Section, the terms “NRC4a” and “NRC4b” have not been clearly defined in either the Specification or the art. As such, the terms are broadly interpreted as any NLR (nucleotide-binding domain and leucine-rich repeat-containing) proteins. III. Thirdly, the claims are broad in the scope of mutations of the “NRC4a” and “NRC4b”. As understood in the art, mutations could be any insertions, deletions, substitutions and/or additions at any position in any combination thereof. The claims require the broad genera of “NRC4a” and “NRC4b” genes to have the function of conferring increased disease resistance to any pathogen of any kind in any plant species when either or both “NRC4a” and “NRC4b” have homozygous mutations. In contrast to the broad scope, Applicant has only provided enabling guidance for CRISPR-mediated SlNRC4b single and SlNRC4Ab double mutant tomato plant (Example 1) wherein the slnrc4ab9-1 double mutant harbors the slnrc4bl-2 in NRC4b (a four-base deletion resulting in a frame shift and an early stop codon, resulting in a 61 aa truncated protein), and a single base deletion in SlNRC4a (a frame shift producing 35 mutated aa followed by an early stop codon, resulting in a 91 aa truncated protein) (Example 1); and that a double NRC4ab #9 line is significantly more resistant against Botrytis cinerea (Bc16) or X. euvesicatoria, C. fulvum, A. alternata or O. neolycopersici (Example 4, 5 and 6). However, Applicant has not provided enabling guidance for any double mutant of both “NRC4a” and “NRC4b” in any plant other than tomato; or the “NRC4a” and “NRC4b” genes in any other plant. In fact, even for the tomota plant, Applicant has not taught the identity of either “NRC4a” and “NRC4b” since the sequences provided in Fig. 1 are illegible and the Specification has not included any sequence listing or even positively link the terms with any sequence entry in the prior art. Furthermore, as discussed above in the 112(b) section, Applicant has not taught what “NRC4a” and “NRC4b” are referencing to in any of the broadly encompassed plant species. As understood in the art, NLR proteins share the structural features of having a nucleotide-binding domain and leucine-rich repeats domain. NLRs are broadly categorized into three subclasses, based on their N-terminal domains. (Ahn, The EMBO Journal 42: e111484 | 2023). However, there is no adequate guidance from either the prior art or the instant Specification for the identification of an NLR protein to be a “NRC4a” or “NRC4b”. Wu teaches phylogenetic analyses of the “NRC superclade” and that the NRC superclade is missing in rosids but present in the examined representatives of caryophyllales (sugar beet) and asterids (kiwifruit, coffee, monkey flower, ash tree, and Solanaceae species), and however, sugar beet and kiwifruit have only a single protein that groups with the NRC family (referred to as NRC-H), along with two and four NLRs, respectively, that cluster with the NRC-dependent NLRs (referred to as NRC-S). However, while Wu teaches an “NRC4” from Nicotiana benthamiana, there is no teaching of identifying a “NRC4a” or “NRC4b” in any given plant species. Furthermore, neither the Specification nor the prior art has adequately taught the phenotypic outcome of mutated “NRC4a” and/or “NRC4b” that would predictably result in “an increased defense response” and a “reduction in disease level” (i.e., increased disease resistance). The Specification, as discussed above, has provided two truncated proteins with 61 and 91 N-terminal amino acids as the example of NRC4a/b double mutant in tomato for increased disease resistance. However, Wu teaches that silencing of NRC4 in N. benthamiana compromised Rpi-blb2 resistance to P. infestans (Fig. 1A) and hypersensitive cell death to the P. infestans effector AVRblb2. This indicated that NRC4 Is Required for Rpi-blb2–Mediated Immunity (p. 8114). Similarly, Wu also teaches that CRISPR/Cas9 mediated 53 kb deletion of the NRC4 gene cluster of tomato does not affect bacterial flagellin-triggered immunity. It is unclear what kind of mutations of the protein are sufficient for increasing the immunity. As Wu has shown, complete abolishment—of NRC4a/b does not result in increased immunity. Similarly, Adachi (Elife 8 (2019): e49956) teaches generation of N. benthamiana nrc4a/b double mutants using the CRISPR/Cas9 technology (p. 23). The nrc4a/b mutants are early stop codon mutants resulting in truncated proteins having 77 or 123 N-terminal amino acids, respectively for NbNRC4a and 4b (mutant 9.1.3) or 77 and 107 aa respectively (mutant 1.2.1) (Fig 2 supplemental fig. 1). However, Adachi teaches that the Rpi-blb2-mediated HR cell death was compromised in the (NRC4 knockout lines) N. benthamiana nrc4a/b double mutants, and the double mutant plants have at least, a reduced disease resistance mediated by Rpi-blb2. In contrast, the instantly disclosed working example of tomato NRC4a/b mutant have truncated proteins with 61 and 91 N-terminal amino acids. This suggest that even for highly similar mutants, their phenotype in disease resistance levels and spectrums are not adequately taught. It is even less adequately described regarding the broadly claimed mutations of any kind in any positions and any combinations. At a finer detail, the effects of multiple amino acid substitutions are not readily predictable from the effect of single substitutions. For example, the combinatorial mutations may have profound effects on protein stability, besides the enzymatic activity. Skinner et al (1996, Proc. Natl. Acad. Sci. USA Vol. 93, pp. 10753-10757) teaches that substitution of one or several amino acid residues in a protein will often lead to substantial changes in properties such as thermodynamic stability, catalytic activity, or binding affinity. When several amino acid substitutions are made at well-separated locations in a single protein, their effects are generally additive. However, if the substituted amino acids are near to or in direct contact with each other, the effects are often highly non-additive, because each mutation affects the environment of the other (p. 10753, left, paragraph 2). Taken together, the phenotypic effects of mutations on either or both “NRC4a” and “NRC4b” are not readily predictable, in view of the broad range of pathogens, host plant species, the diverse nature of mutations, and the lack of adequate guidance. In the absence of guidance from either the instant disclosure or the art, it would require trial and error experimentation for a skilled artisan to identify the combinatorial mutants with increased disease resistance. Even the knowledge of the effect of the truncation mutant of the instant working example would not be sufficient, since the highly similar truncation mutant of Wu and Adachi has different or opposite effects in disease resistance levels and/or spectrum. Thus, in view of the unpredictability associated with combinatorial mutations in the “NRC4a” and “NRC4b” proteins, the lack of enabling guidance from either the instant disclosure or the art, and breath and diversity of the embodiments encompassed by the claimed genus, the lack of sufficient working examples, and the level of the art at the time of the invention, one of ordinary skill in the art must rely on undue trial and error experimentation to make and test the numerous polypeptides having any mutations, in order to make and/or use the invention within the full scope of these Claims. For at least this reason, the Specification does not teach a person with skill in the art how to make and/or use the subject matter within the full scope of these Claims. Response to Applicant Remarks: Applicant alleged that the amendment to the claims has satisfied the requirements under 112(a). As discussed above, and in 112(b) sections, the amended claims in view of the amended Specification, are still not sufficient to overcome the rejections above. The rejections are maintained. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to WEIHUA FAN whose telephone number is (571)270-0398. The examiner can normally be reached Monday-Friday, 9-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. WEIHUA . FAN Primary Examiner Art Unit 1663 /WEIHUA FAN/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Sep 10, 2023
Application Filed
May 29, 2025
Non-Final Rejection — §112
Feb 01, 2026
Response after Non-Final Action
Feb 18, 2026
Response Filed
Mar 03, 2026
Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599071
METHODS FOR INCREASING CHROMIUM IN WHITE KIDNEY BEANS
2y 5m to grant Granted Apr 14, 2026
Patent 12599073
NOVEL WHEAT CENH3 ALLELES
2y 5m to grant Granted Apr 14, 2026
Patent 12599101
HYBRID TOMATO VARIETY 72-CK0619 RZ
2y 5m to grant Granted Apr 14, 2026
Patent 12593768
WATERMELON GENE CONFERRING A HIGH NUMBER OF MALE FLOWERS
2y 5m to grant Granted Apr 07, 2026
Patent 12588611
FERTILIZER MANAGEMENT
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
83%
Grant Probability
96%
With Interview (+12.9%)
2y 9m
Median Time to Grant
Moderate
PTA Risk
Based on 634 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month