DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of invention Group V, claims 10 and 14, in the reply filed on 12/18/2025 is acknowledged. The amended claims of Group V (claims 10 and 14) are drawn to a method of treating diarrhea.
In Applicant’s reply, Applicant states that “the culture method for the Weissella confusa of group II is a process specially adapted for the manufacturing of a medicament for assisting digestion, feed, and medicament for treating diarrhea of groups III, IV and V, respectively”, and that “the Weissella confusa strain CGMCC
NO. 22697 of group I is a product specially adapted for the manufacturing of a medicament for assisting digestion, feed, and medicament for treating diarrhea of groups III, IV and V, respectively,” (remarks, pages 6-7). Applicant concludes that, therefore, inventions in groups II-V are so linked as to form a single general inventive concept, and inventions in groups I and III-V, are so linked as to form a single general inventive concept (remarks, page 7).
The Examiner responds that, as discussed in the Restriction/Election requirement, Weissella confusa WSG1, preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697, is the technical feature linking invention groups I-V, and is not a special technical feature as it does not make a contribution over the prior art.
Applicant describes that “Weissella confusa WSG1 separated from feces of puppies and preserved in the CGMCC on Jun. 11, 2021 with a preservation number of
CGMCC NO. 22697 is a special technical feature of independent claim 1 and makes a contribution over the prior art in view of the Lakra reference which teaches "... Weissella confusa MD 1 and Weissella cibaria MD2 isolated from a fermented batter. .. " (…) and does not disclose Weissella confusa WSG1” (remarks, page 7).
The Examiner responds that, as previously discussed, the instant strain and Lakra’s strain (Lakra et al., “Some probiotic potential of Weissella confusa MD1 and Weissella cibaria MD2 isolated from fermented batter”, published online on 03/09/2020, Food Science and Technology, Volume 125, 109261, pages 1-9) share multiple abilities, such as antimicrobial properties, survivability in gastro-intestinal conditions, susceptibility to commonly used antibiotics, and being non-hemolytic. It is therefore highly likely that Lakra’s strain is the recited instant strain. If there should be a slight variation between Lakra’s and the instant strain, the strains would be considered obvious variants since both strains share the same abilities.
Applicant states that “[r]egarding burden, a search of the invention of group 1, which is drawn to Weissella confusa WSG1 will significantly overlap with the search required for groups II-V because the processes and products of groups II-V are directed towards methods of using the Weissella confusa WSG 1 of group I, and that “[t]herefore, a search for the invention of groups II-V would necessarily be required in a search for group I” (remarks, page 7).
The Examiner responds that ‘search burden’ does not apply to unity of invention analysis (MPEP 1893.03(d)). The analysis used to determine whether the Office may require restriction differs in national stage applications submitted under 35 U.S.C. 371 (unity of invention analysis) as compared to national applications filed under 35 U.S.C. 111(a) (independent and distinct analysis). See MPEP 823.
In conclusion, Applicant’s arguments are not persuasive. The requirement is still
deemed proper and is therefore made FINAL.
Claim Status
The amendment of 12/18/2025 has been entered. Claims 1-14 are pending (claim set as filed on 12/18/2025). Claims 1-9, and 11-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the Restriction/Election requirement in the reply filed on 12/18/2025.
Claims 10 and 14 are currently under examination and were examined on their merits.
Priority
This application filed on 09/11/2023 claims priority to PCT application no. PCT/CN2022/078752, filed on 03/02/2022, and claims foreign priority to application no. CN202111145446.X, filed on 09/28/2021. Acknowledgment is made of Applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The Information Disclosure Statements (IDS) filed on 10/09/2025,
04/17/2025, and 09/18/2023, have been received and considered.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 10 and 14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claims contain subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The microorganism Weissella confusa WSG1, preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697, is recited in the claims and, thus, is essential to the claimed invention. Because the microorganism is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise readily available to the public. If the microorganism is not so obtainable or available, the requirements of 35 U.S.C. § 112 may be satisfied by a deposit of the biological materials.
The specification does not disclose a repeatable process to obtain the microorganism, and it is not apparent if the biological materials are readily available to the public. It is noted that applicant has deposited the organism (see, for example, specification page 17, paragraph 3), but there is no indication in the specification as to public availability.
If the deposit is made under the Budapest Treaty, then an affidavit or declaration by applicant, or a statement by an attorney of record over his or her signature and registration number, stating that the specific strain has been deposited under the Budapest Treaty and that the specific strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent, would satisfy the deposit requirement made herein.
If the deposit has not been made under the Budapest Treaty, then in order to certify that the deposit meets the criteria set forth in 37 C.F.R. §§ 1.801-1.809, applicant may provide assurance of compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number, showing that:
(a) during the pendency of this application, access to the invention will be afforded to the Commissioner upon request;
(b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent;
(c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer;
(d) a test of the viability of the biological material at the time of deposit will be made (see 37 C.F.R. §1.807); and
(e) the deposit will be replaced if it should ever become inviable.
Applicant’s attention is directed to M.P.E.P. § 2400 in general, and specifically to § 2411.05, as well as to 37 C.F.R. § 1.809(d), wherein it is set forth that “the specification shall contain the accession number for the deposit, the date of the deposit, the name and address of the depository, and a description of the deposited material sufficient to specifically identify it and to permit examination.” It is noted that the instant specification fails to provide any information about whether the deposit was made under the Budapest Treaty or whether the deposited organism is available to the public; the specification should be amended to include this information.
Claim Rejections - 35 USC § 112 (b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 14 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 14 recites “wherein a nucleotide sequence of 16S rRNA of the Weissella confusa is shown in SEQ ID NO: 1”, which renders the claim indefinite since it is unclear what the phrase “a nucleotide sequence … is shown in SEQ ID NO: 1” means. One of ordinary skill in the art would not be able to determine the metes and bounds of the claim, and thus, could not clearly determine how to avoid infringement of claim 14.
In the interest of compact prosecution, claim 14 is interpreted to the broadest embodiment claimed.
Claim Rejections - 35 USC § 102/103
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 10 is rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Beasley et al. (US 2012/0201796 A1, published on 08/09/2012), hereinafter ‘Beasley 1’.
Beasley 1’s general disclosure relates to “a probiotic preparation for preventing or treating gastrointestinal disorders in dogs.” (see entire document, including paragraph [0001]).
Regarding claim 10, pertaining to a method of treating diarrhea, Beasley 1 teaches a method of treating diarrhea (“probiotic preparation for preventing and treating canine gastrointestinal disorders”, “Preferred are treatment of the gastrointestinal tract, including treatment or prevention of diarrhoea”; paragraphs [0020], [0055]) comprising administering Weissella confusa to a subject in need thereof (“The probiotic preparation of the invention can be used for the prevention and treatment of canine gastrointestinal
disorders either as ….or formulated into more specific pharmaceutical formulations or dog food products e.g. for oral administration”, “the preparation may comprise additional
dog-specific strains of lactic acid bacteria, …, for example strains belonging to … or to genus Weissella, such as W. confusa and W. cibaria. Examples of preferable additional dog-specific strains of lactic acid bacteria other than Lactobacillus, are … W. confusa NCIMB 41639; paragraphs [0022], [0030]).
Additionally, Beasley 1 teaches wherein W. confusa NCIMB 41639 is a dog-specific strain (paragraph [0030]).
Beasley 1 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. The Examiner notes that the instantly recited assigned strain number, deposit location, date, and preservation number, are a label and do not further characterize the instant strain. The instant specification and claims describe that the claimed Weissella confusa strain was isolated from dog feces (see Example 1 on page 21), and is therefore a dog-specific strain. Based on Beasley 1’s teachings, it is highly likely that Beasley 1’s strain and Applicant’s strain are the same strain since both strains are dog-specific Weisella confusa strains (Beasley 1, paragraph [0030]; instant Specification, see Example 1, on page 21), and are used to treat diarrhea (Beasley, paragraphs [0020], [0022], [0030], [0055]; instant Specification, page 20, paragraph 3; instant claim 10).
However, Beasley 1 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. If there should be a slight variation between Beasley 1’s strain and the claimed strain, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have used the claimed strain to substitute Beasley 1’s strain in Beasley 1’s method to treat diarrhea, since both strains, the claimed strain and Beasley 1’s strain, are dog-specific Weisella confusa strains and are used to treat diarrhea.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 10 and 14 are rejected under 35 U.S.C. 103 as obvious over Beasley et al. (“Lactic acid bacteria isolated from canine faeces”, published in July 2006, J Appl Microbiol., Vol. 101, pages 131-138), hereinafter ‘Beasley 2’, as evidenced by Beasley et al. (“Weissella confusa partial 16S rRNA gene”; published on 10/02/2003, downloaded from https://www.ncbi.nlm.nih.gov/nuccore/AJ508722, NCBI, accession number AJ508722, pages 1-2), hereinafter ‘AJ508722’.
Beasley 2’s general disclosure relates to “host-specific LAB with antimicrobial activity isolated from canines that could serve as potential probiotics for canine use” (see entire document, including abstract).
Regarding claim 10, pertaining to a method of treating diarrhea, Beasley 2 teaches a method comprising administering Weissella confusa to a subject in need thereof (“…, Weissella confusa LAB10 were selected as candidate probiotic strains based on their frequency, quantity in faeces, growth density, acid tolerance and antimicrobial activity”, “need for probiotic bacteria for canine health”; “feed with these canine-origin LAB will be fed to canine”; page 131, right column, paragraph 1; page 136, right column, paragraph 1; see abstract).
Additionally, Beasley 2 teaches that “[s]elected probiotic bacteria have been reported to reduce diarrhoea in humans and animals” (page 131, left column, paragraph 1).
Regarding claim 14, please note the rejection under 35 USC § 112(b) above.
Claim 14 recites “a nucleotide sequence of 16S rRNA “ wherein ‘a nucleotide sequence’ is interpreted as having two or more nucleotides. Pertaining to a nucleotide sequence of 16S rRNA of the Weissella confusa strain, Beasley 2 teaches wherein the Weissella confusa LAB10 strain has a 16S rRNA gene sequence (“Out of 13 species identified with partial 16S rRNA gene sequencing, …, and Weissella confusa LAB10 were selected as candidate probiotic strains”, “Accession number … AJ508722”; see abstract and Table 1), wherein the complementary sequence comprises a nucleotide sequence of 16S rRNA shown in SEQ ID NO: 1. The alignment of instant SEQ ID NO: 1 with Beasley 2’s complementary 16S RNA nucleotide sequence, as shown below, indicates multiple shared nucleotide sequences, such as for example, positions 43-413 in Beasley 2’s 16S RNA nucleotide sequence, corresponding to positions 991-1361 in instant SEQ ID NO: 1 (see highlighted sequence in alignment below; please note that ‘Qy’ is instant SEQ ID NO:1 and ‘Db’ is the complementary sequence of Beasley 2’s nucleotide sequence AJ508722).
GenCore version 6.5.2
Copyright (c) 1993 - 2026 Biocceleration Ltd.
OM nucleic - nucleic search, using sw model
Run on: January 14, 2026, 13:54:33 ; Search time 1 Seconds
(without alignments)
2.461 Million cell updates/sec
Title: US-18-281-312-1
Perfect score: 1429
Sequence: 1 aggttaccccaccggctttg..........ccacaaagcgttcgactgca 1429
Scoring table: IDENTITY_NUC
Gapop 10.0 , Gapext 1.0
Searched: 1 seqs, 861 residues
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 0
Maximum DB seq length: inf
Post-processing: Minimum Match 0%
Maximum Match 100%
Listing first 2 summaries
Database : NASEQ2_01142026_135430.seq:*
SUMMARIES
%
Result Query
No. Score Match Length DB ID Description
----------------------------------------------------------------------------
c 1 673.6 47.1 861 1 NASEQ2_01142026_135430
2 25.4 1.8 861 1 NASEQ2_01142026_135430
ALIGNMENTS
RESULT 1
NASEQ2_01142026_135430/c
Query Match 47.1%; Score 673.6; DB 1; Length 861;
Best Local Similarity 93.0%;
Matches 795; Conservative 0; Mismatches 46; Indels 14; Gaps 9;
Qy 563 CCCAGGCGGAGTGCTTAATGCGTTAGCTGCGGCACTTAAGGGCGGAAACCCTCAAACACC 622
|||||| || ||||||||||| || ||||||||| ||||| || || || || ||
Db 855 CCCAGGNGGGAGGCTTAATGCGTNAGTTGCGGCACTNAAGGGGGGGAAACCCTCAAANCC 796
Qy 623 TAGCACTCATC-----GTTTACGGTGTGGACTACCAGGGTA-TCTAATCCTGTTTGCTAC 676
|| ||||| | |||||||||||||| ||||||||||||||||||
Db 795 CCCTTAGCANTTTNATGTTTANCGGTGGGACTACCAGGGTATTCTAATCCTGTTTGCTAC 736
Qy 677 CCACACTTTCG--AGCCTCAACGTC-AGTTACAGTCCAGAAAGCCGCC-TTCGCCACTGG 732
||||||||| | |||||||| |||||||||||||||||||||| |||||||||||
Db 735 CCACACTTTTNGAGCCNTCAACGTCAAGTTACAGTCCAGAAAGCCGCCTTTCGCCACTGG 676
Qy 733 TGTTCTTCCATATA-TCTACGCATTTCACCGCTACA-CATGGAGTTCCACTTTCC-TCTA 789
||||||||||||| | ||||||||||||||||||| || ||||||||||||||| | ||
Db 675 GGTTCTTCCATATATTNTACGCATTTCACCGCTACACCANGGAGTTCCACTTTCCTTTTA 616
Qy 790 CTGCACTCAAGTCATCCAGTTTCCAAAGCAATTCCTCAGTTGAGCTGAGGGCTTTCACTT 849
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 615 CTGCACTCAAGTCATCCAGTTTCCAAAGCAATTCCTCAGTTGAGCTGAGGGCTTTCACTT 556
Qy 850 CAGACTTAAATAACCGTCTGCGCTCGCTTTACGCCCAATAAATCCGGATAACGCTTGGAA 909
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Db 555 CAGACTTAAATAACCCTCTGCGCTCGCTTTACGCCCAATAAATCCGGATAACGCTTGGAA 496
Qy 910 CATACGTATTACCGCGGCTGCTGGCACGTATTTAGCCGTTCCTTTCTGGTAAGATACCGT 969
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 495 CATACGTATTACCGCGGCTGCTGGCACGTATTTAGCCGTTCCTTTCTGGTAAGATACCGT 436
Qy 970 CACACATTGAACAGTTACTCT-CAATGTCATTCTTCTCTTACAACAGTGTTTTACGAGCC 1028
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Db 435 CACACATTGAACAGTTACTCTNCAATGTCATTCTTCTCTTACAACAGTGTTTTACGAGCC 376
Qy 1029 GAAACCCTTCATCACACACGCGGCGTTGCTCCATCAGGCTTTCGCCCATTGTGGAAGATT 1088
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 375 GAAACCCTTCATCACACACGCGGCGTTGCTCCATCAGGCTTTCGCCCATTGTGGAAGATT 316
Qy 1089 CCCTACTGCTGCCTCCCGTAGGAGTATGGGCCGTGTCTCAGTCCCATTGTGGCCGATCAG 1148
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 315 CCCTACTGCTGCCTCCCGTAGGAGTATGGGCCGTGTCTCAGTCCCATTGTGGCCGATCAG 256
Qy 1149 TCTCTCAACTCGGCTATGCATCATCGCCTTGGTAAGCCATTACCTTACCAACTAGCTAAT 1208
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 255 TCTCTCAACTCGGCTATGCATCATCGCCTTGGTAAGCCATTACCTTACCAACTAGCTAAT 196
Qy 1209 GCACCGCGGGACCATCTCTTAGTGATAGCAGAACCATCTTTTAAATAACAACCATGCGGT 1268
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 195 GCACCGCGGGACCATCTCTTAGTGATAGCAGAACCATCTTTTAAATAACAACCATGCGGT 136
Qy 1269 TGTCATTGTTATACGGTATTAGCATCTGTTTCCAAATGTTATCCCCTGCTAAGAGGTAGG 1328
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 135 TGTCATTGTTATACGGTATTAGCATCTGTTTCCAAATGTTATCCCCTGCTAAGAGGTAGG 76
Qy 1329 TTTCCCACGTGTTACTCACCCGTTCGCCACTCTTTGCAATGTCCATCGTCATATCTGAGC 1388
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Db 75 TTTCCCACGTGTTACTCACCCGTTCGCCACTCTNTGCAATGTCCATCGTCATATNTGAGC 16
Qy 1389 AAGCTCTTCAAATCA 1403
||| | | ||| ||
Db 15 AAGNTNNTNAAANCA 1
Additionally, Beasley 2 teaches wherein Weissella confusa strain LAB10 was isolated from dog feces (“LAB were found in 67% (14/21) of the canine faeces
samples … Out of 13 species …. , and Weissella confusa LAB10 were selected as candidate probiotic strains”; see abstract and Table 1), that the strain has antibacterial activity (“antimicrobial activity of the LAB8-LAB12 against M. luteus”; see page 134, left column, paragraph 2; see abstract and Fig. 2), that the strain is capable to survive in acidic conditions (“…, W. confusa LAB10 and L. mucosae LAB12 were viable in pH 2 for 4 h (mLBS), indicating tolerance to acidity and thus the potential to survive in gastrointestinal tract of the canine”; see abstract and Fig. 1), and that the strain is susceptible to antibiotics (see Table 2).
Beasley 2 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. The Examiner notes that the instantly recited assigned strain number, deposit location, date, and preservation number, are a label and do not further characterize the instant strain. The instant specification and claims describe that the claimed Weissella confusa strain was isolated from dog feces (see Example 1 on page 21), that the strain is susceptible to antibiotics (see Experimental Example 2 on pages 22-23), is capable to survive in acidic conditions (see Experimental Example 4 on pages 23-24), and has antibacterial properties (see Experimental Example 5 on page 24). Based on Beasley 2’s teachings, it is highly likely that Beasley 2’s strain and Applicant’s strain are the same strain since both strains were isolated from dog feces, have antibacterial properties, show survival in acidic conditions, and are susceptible to antibiotics.
Beasley 2 does not expressly wherein the method comprising administering Weissella confusa is a method of treating diarrhea (instant claim 10), and that the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697 (instant claims 10 and 14).
While Beasley 2 does not expressly teach wherein the method comprising administering Weissella confusa is a method of treating diarrhea, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined Beasley 2’s method with Beasley 2’s teachings on reducing diarrhea in humans and animals using probiotic bacteria, in order to create a method of treating diarrhea comprising administering Beasley’s Weissella confusa strain to a subject in need thereof. One would have been motivated to do so in order to create a superior method for treating diarrhea, since Beasley’s Weissella confusa has antibacterial activity (“page 134, left column, paragraph 2; see abstract and Fig. 2), is capable to survive in acidic conditions (see abstract and Fig. 1), and is susceptible to antibiotics (see Table 2). A skilled artisan would have reasonably expected success since Beasley 2 teaches “[t]he selected LAB strains are among the first host-specific LAB with antimicrobial activity isolated from canines that could serve as potential probiotics for canine use” (see abstract).
Beasley 2 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. As discussed above, based on Beasley 2’s teachings, it is highly likely that Beasley 2’s strain and Applicant’s strain are the same strain since both strains were isolated from dog feces, have antibacterial properties, show survival in acidic conditions, and are susceptible to antibiotics. However, if there should be a slight variation between Beasley 2’s strain and the claimed strain, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have used the claimed strain to substitute Beasley 2’s strain in modified Beasley 2’s method, since both strains, the claimed strain and Beasley 2’s strain, share the same abilities, i.e. antibacterial properties, the ability to survive in acidic conditions, and susceptibility to antibiotics.
Conclusion
No claims are allowed.
Correspondence Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SANDRA ZINGARELLI whose telephone number is (703)756-1799. The examiner can normally be reached M-F 9-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Sharmila Landau can be reached at (571) 272-0614. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SANDRA ZINGARELLI/Examiner, Art Unit 1653
/SHARMILA G LANDAU/Supervisory Patent Examiner, Art Unit 1653