Prosecution Insights
Last updated: September 17, 2026
Application No. 18/281,312

WEISSELLA CONFUSA, CULTURE METHOD THEREFOR AND USE THEREOF

Final Rejection §102§103§112
Filed
Sep 11, 2023
Priority
Sep 28, 2021 — CN 202111145446.X +1 more
Examiner
ZINGARELLI, SANDRA
Art Unit
1653
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Shanghai Singen Pet Nutrition Co. Ltd.
OA Round
2 (Final)
7%
Grant Probability
At Risk
3-4
OA Rounds
5m
Est. Remaining
53%
With Interview

Examiner Intelligence

Grants only 7% of cases
7%
Career Allowance Rate
2 granted / 29 resolved
-53.1% vs TC avg
Strong +46% interview lift
Without
With
+46.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
21 currently pending
Career history
72
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
42.3%
+2.3% vs TC avg
§102
14.4%
-25.6% vs TC avg
§112
29.5%
-10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 29 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status The amendment of 04/20/2026 has been entered. Claims 1-14 are pending (claim set as filed on 04/20/2026). Claims 1-9, and 11-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant previously elected with traverse invention Group V, claims 10 and 14, drawn to a method of treating diarrhea, in the reply filed on 12/18/2025. Claims 10 and 14 are currently under examination and were examined on their merits. Withdrawn Objections/Rejections The rejection of claims 10 and 14 under 35 U.S.C. 112(a) as set forth in the previous Office action are withdrawn in light of the Statement by the Attorney of Record filed on 04/20/2026. Claim Rejections - 35 USC § 112 (b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 10 and 14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 10, the claim is directed to a method of treating, and further recites the steps of culturing to obtain a supernatant and assaying said supernatant, wherein treating and culturing/assaying are two different methods. It is unclear if the claim is directed to treating (lines 1-2) or to a supernatant (lines 5-9), and how the steps of culturing and assaying a supernatant relate to the treatment step of administering. One of ordinary skill in the art would not be able to determine the metes and bounds of claim 10, and thus, could not clearly determine how to avoid infringement of the claim. In the interest of compact prosecution, the recited culturing and assaying of the supernatant in claim 10 is treated as properties of the recited strain, i.e. if the strain was cultured for 24 h in vitro, the obtained supernatant would have an inhibitory effect on an indicator bacterium as measured by a 7.5 mm or more diameter zone of inhibition against the indicator bacterium using a punch hole method, wherein the indicator bacterium is selected from the group consisting of Escherichia coli, Salmonella typhimurium, and Clostridium perfringens. Dependent claim 14 is further rejected since it does not clarify the indefinite language of claim 10. Claim Rejections - 35 USC § 102/103 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 10 is newly rejected as necessitated by amendment under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Beasley et al. (US 2012/0201796 A1, published on 08/09/2012), hereinafter ‘Beasley 1’, as evidenced by Stanojevic-Nikolic et al. (“Antimicrobial Activity of Lactic Acid Against Pathogen and Spoilage Microorganisms”, published on 12/15/2015, Journal of Food Processing and Preservation, Vol. 40(5), pages 990-998), hereinafter ‘Stanojevic-Nikolic’. Beasley 1’s general disclosure relates to “a probiotic preparation for preventing or treating gastrointestinal disorders in dogs.” (see entire document, including paragraph [0001]). Regarding claim 10, pertaining to a method of treating diarrhea, Beasley 1 teaches a method of treating diarrhea (“probiotic preparation for preventing and treating canine gastrointestinal disorders”, “treatment of the gastrointestinal tract, including treatment or prevention of diarrhoea”; paragraphs [0020], [0055]) comprising administering Weissella confusa to a subject in need thereof (“The probiotic preparation of the invention can be used for the prevention and treatment of canine gastrointestinal disorders either as ….or formulated into more specific pharmaceutical formulations or dog food products e.g. for oral administration”, “the preparation may comprise additional dog-specific strains of lactic acid bacteria, …, for example strains belonging to … or to genus Weissella, such as W. confusa and W. cibaria. Examples of preferable additional dog-specific strains of lactic acid bacteria other than Lactobacillus, are … W. confusa NCIMB 41639; paragraphs [0022], [0030]). In addition, Beasley 1 teaches wherein W. confusa NCIMB 41639 is a dog-specific strain (paragraph [0030]). Pertaining to the inhibitory effect of Weissella confusa, please refer to the 112b rejection. Beasley 1 teaches wherein the Weissella confusa strain is a lactic acid bacterium (paragraph [0030]), wherein the use of lactic acid bacteria as probiotics has the benefit of antagonism against pathogenic microbes (paragraph [0006]), and that dog-specific strains were selected based on their ability to perform antimicrobial activity (paragraph [0026]). Beasley 1 further discloses that lactic acid bacteria produce lactic acid (paragraph [0005]) which has an inhibitory effect on E. coli, as evidenced by Stanojevic-Nikolic (see entire document, including abstract). As such, it is highly likely that a supernatant obtained from culturing Beasley 1’s Weissella confusa strain for 24 h in vitro has an inhibitory effect on E. coli as an indicator bacterium as measured by a 7.5 mm or more diameter zone of inhibition against the indicator bacterium E. coli using a punch hole method. Beasley 1 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. The Examiner notes that the instantly recited assigned strain number, deposit location, date, and preservation number, do not further characterize the instant strain. The instant specification and claims further describe that the claimed Weissella confusa strain was isolated from dog feces (see Example 1 on page 21), and is therefore a dog-specific strain. Based on Beasley 1’s teachings, it is highly likely that Beasley 1’s strain and Applicant’s strain are the same strain since both strains are dog-specific strains (Beasley 1, paragraph [0026] and [0030]; instant Specification, see Example 1, on page 21), have antimicrobial properties (Beasley 1, paragraphs paragraph [0006] and [0026]; see instant Specification, Experimental Example 5 on page 24; instant claim 10), and since both, Applicant’s and Beasley 1’s strain are used to treat diarrhea (Beasley 1, paragraphs [0020], [0022], [0030], [0055]; instant Specification, page 20, paragraph 3; instant claim 10). Still, Beasley 1 does not teach wherein the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. If there should be a slight variation between Beasley 1’s strain and the claimed strain, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have used the claimed strain to substitute Beasley 1’s strain in Beasley 1’s method to treat diarrhea, since both strains, the claimed strain and Beasley 1’s strain, are dog-specific Weissella confusa strains and are used to treat diarrhea. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 10 and 14 are newly rejected as necessitated by amendment under 35 U.S.C. 103 as being unpatentable Beasley et al. (US 2012/0201796 A1, published on 08/09/2012), hereinafter ‘Beasley 1’, as evidenced by Stanojevic-Nikolic et al. (“Antimicrobial Activity of Lactic Acid Against Pathogen and Spoilage Microorganisms”, published on 12/15/2015, Journal of Food Processing and Preservation, Vol. 40(5), pages 990-998), hereinafter ‘Stanojevic-Nikolic’, in view of Goh et al. (“Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin”, published on 10/16/2015, PLOS ONE, Vol.10, No.10, e0140434; pages 1-17), hereinafter ‘Goh’, as evidenced by Ng et al. (“Application of bacteriocins in food preservation and infectious disease treatment for humans and livestock: a review”, published on 10/23/2020, RSC Adv., 2020, Vol.10, No. 64, pages 38937-38964), hereinafter ‘Ng’, and as evidenced by Koshy et al. (“Weissella confusa strain A3 16S ribosomal RNA gene, partial sequence”, published on 05/05/2015, Genbank, Accession number KJ476186), hereinafter ‘Koshy’. Beasley 1’s general disclosure relates to “a probiotic preparation for preventing or treating gastrointestinal disorders in dogs.” (see entire document, including paragraph [0001]). Regarding claim 10, pertaining to a method of treating diarrhea, Beasley 1 teaches a method of treating diarrhea (“probiotic preparation for preventing and treating canine gastrointestinal disorders”, “treatment of the gastrointestinal tract, including treatment or prevention of diarrhoea”; paragraphs [0020], [0055]) comprising administering Weissella confusa to a subject in need thereof (“The probiotic preparation of the invention can be used for the prevention and treatment of canine gastrointestinal disorders either as ….or formulated into more specific pharmaceutical formulations or dog food products e.g. for oral administration”, “the preparation may comprise additional dog-specific strains of lactic acid bacteria, …, for example strains belonging to … or to genus Weissella, such as W. confusa and W. cibaria. Examples of preferable additional dog-specific strains of lactic acid bacteria other than Lactobacillus, are … W. confusa NCIMB 41639; paragraphs [0022], [0030]). In addition, Beasley 1 teaches wherein W. confusa NCIMB 41639 is a dog-specific strain (paragraph [0030]). Pertaining to the inhibitory effect of Weissella confusa, please refer to the 112b rejection. Beasley 1 teaches wherein the Weissella confusa strain is a lactic acid bacterium (paragraph [0030]), wherein the use of lactic acid bacteria as probiotics has the benefit of antagonism against pathogenic microbes (paragraph [0006]), and that dog-specific strains were selected based on their ability to perform antimicrobial activity (paragraph [0026]). Beasley 1 further discloses that lactic acid bacteria produce lactic acid (paragraph [0005]) which has an inhibitory effect on E. coli, as evidenced by Stanojevic-Nikolic (see entire document, including abstract). As such, it is highly likely that a supernatant obtained from culturing Beasley 1’s Weissella confusa strain for 24 h in vitro has an inhibitory effect on E. coli as an indicator bacterium as measured by a 7.5 mm or more diameter zone of inhibition against the indicator bacterium E. coli using a punch hole method. Regarding claim 10, Beasley 1 does not specify that the Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697. Regarding claim 14, Beasley does not teach wherein the Weissella confusa has a 16S rRNA gene having the nucleotide sequence set forth in SEQ ID NO: 1. Goh’s general disclosure relates to a bacteriocin that was isolated from Weissella confusa A3 (see entire document, including abstract). Goh teaches a Weissella confusa strain, wherein a bacteriocin obtained from a supernatant from culturing the Weissella confusa strain for 18 h in vitro has an inhibitory effect on an indicator bacterium as measured by a 7.9 mm diameter zone of inhibition against the indicator bacterium using a punch hole method, wherein the indicator bacterium is Escherichia coli (page 3, paragraph 4 - page 4, paragraph 1; see abstract and Table 2). It is noted that Goh’s indicator bacterium E. coli (page 3, paragraph 4; see Table 2) can cause diarrhea, as evidenced by Ng et al. (page 38956, right column, paragraph 2). Goh further teaches wherein the Weissella produces antibacterial activity after 24 hours of culturing (see Fig. 1). Based on Goh’s teachings it is highly likely that a supernatant obtained from culturing the Weissella confusa strain for 24 h in vitro has an inhibitory effect on an indicator bacterium as measured by a 7.5 mm or more diameter zone of inhibition against the indicator bacterium using a punch hole method, wherein the indicator bacterium is Escherichia coli. In addition, Goh teaches wherein “the Weissella strain has an inhibitory effect on multiple pathogenic strains (see abstract), and wherein “[t]he strain also proved to be non-virulent and does not produce toxins and superantigens based on genome analysis from this investigation” (page 11, paragraph 2; page 15, paragraph 3). Regarding claim 14, pertaining to the 16S RNA gene, Goh teaches wherein the Weissella confusa has a 16S rRNA gene having the nucleotide sequence set forth in SEQ ID NO: 1 (“KJ476186”; page 6, paragraph 3), as evidenced by Koshy and the sequence alignment of instant SEQ ID NO: 1 and Goh’s nucleotide sequence, as shown below. GenCore version 6.5.3 Copyright (c) 1993 - 2026 Biocceleration Ltd. OM nucleic - nucleic search, using sw model Run on: June 18, 2026, 21:11:41 ; Search time 1288 Seconds (without alignments) 655186.791 Million cell updates/sec Title: US-18-281-312-1 Perfect score: 1429 Sequence: 1 aggttaccccaccggctttg..........ccacaaagcgttcgactgca 1429 Scoring table: IDENTITY_NUC Gapop 10.0 , Gapext 1.0 Searched: 61785019 unique seqs, 295269624635 residues Total number of hits satisfying chosen parameters: 123570038 Minimum DB seq length: 1 Maximum DB seq length: 40000 Post-processing: Minimum Match 0% Maximum Match 100% Listing first 45 summaries Database : GenEmbl_269:* RESULT 14 KJ476186/c LOCUS KJ476186 1447 bp DNA linear BCT 05-MAY-2014 DEFINITION Weissella confusa strain A3 16S ribosomal RNA gene, partial sequence. ACCESSION KJ476186 VERSION KJ476186.1 KEYWORDS . SOURCE Weissella confusa ORGANISM Weissella confusa Bacteria; Bacillota; Bacilli; Lactobacillales; Lactobacillaceae; Weissella. REFERENCE 1 (bases 1 to 1447) AUTHORS Koshy,P. and Goh,H.F. TITLE Direct Submission JOURNAL Submitted (20-FEB-2014) Division of Microbiology, Institute of Biological Sciences, Faculty of Science, University of Malaya, Pantai Valley, Kuala Lumpur, Federal Territory 50603, Malaysia FEATURES Location/Qualifiers source 1..1447 /organism="Weissella confusa" /mol_type="genomic DNA" /strain="A3" /isolation_source="fermented cow milk" /db_xref="taxon:1583" /geo_loc_name="Malaysia" /collected_by="Goh Hweh Fen" rRNA <1..>1447 /product="16S ribosomal RNA" ORIGIN Query Match 100.0%; Score 1429; Length 1447; Best Local Similarity 100.0%; Matches 1429; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGTTACCCCACCGGCTTTGGGTGTTACAAACTCTCATGGTGTGACGGGCGGTGTGTACA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1430 AGGTTACCCCACCGGCTTTGGGTGTTACAAACTCTCATGGTGTGACGGGCGGTGTGTACA 1371 Qy 61 AGACCCGGGAACGTATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1370 AGACCCGGGAACGTATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTC 1311 Qy 121 ATGTAGGCGAGTTGCAGCCTACAATCCGAACTGAGACGTACTTTAAGAGATTAGCTCACC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1310 ATGTAGGCGAGTTGCAGCCTACAATCCGAACTGAGACGTACTTTAAGAGATTAGCTCACC 1251 Qy 181 CTCGCGGGTTGGCAACTCGTTGTATACGCCATTGTAGCACGTGTGTAGCCCAGGTCATAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1250 CTCGCGGGTTGGCAACTCGTTGTATACGCCATTGTAGCACGTGTGTAGCCCAGGTCATAA 1191 Qy 241 GGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGTTTGTCACCGGCAGTCTCACT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1190 GGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGTTTGTCACCGGCAGTCTCACT 1131 Qy 301 AGAGTGCCCAACTGAATGCTGGCAACTAGTAATAAGGGTTGCGCTCGTTGCGGGACTTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1130 AGAGTGCCCAACTGAATGCTGGCAACTAGTAATAAGGGTTGCGCTCGTTGCGGGACTTAA 1071 Qy 361 CCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACCTTGTCCCCGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1070 CCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACCTTGTCCCCGA 1011 Qy 421 AGGGAACGCTCCATCTCTGGAGTTGTCAAGGGATGTCAAGACCTGGTAAGGTTCTTCGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1010 AGGGAACGCTCCATCTCTGGAGTTGTCAAGGGATGTCAAGACCTGGTAAGGTTCTTCGCG 951 Qy 481 TTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 950 TTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAG 891 Qy 541 TTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCGGCACTTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 890 TTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCGGCACTTA 831 Qy 601 AGGGCGGAAACCCTCAAACACCTAGCACTCATCGTTTACGGTGTGGACTACCAGGGTATC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 830 AGGGCGGAAACCCTCAAACACCTAGCACTCATCGTTTACGGTGTGGACTACCAGGGTATC 771 Qy 661 TAATCCTGTTTGCTACCCACACTTTCGAGCCTCAACGTCAGTTACAGTCCAGAAAGCCGC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 770 TAATCCTGTTTGCTACCCACACTTTCGAGCCTCAACGTCAGTTACAGTCCAGAAAGCCGC 711 Qy 721 CTTCGCCACTGGTGTTCTTCCATATATCTACGCATTTCACCGCTACACATGGAGTTCCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 710 CTTCGCCACTGGTGTTCTTCCATATATCTACGCATTTCACCGCTACACATGGAGTTCCAC 651 Qy 781 TTTCCTCTACTGCACTCAAGTCATCCAGTTTCCAAAGCAATTCCTCAGTTGAGCTGAGGG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 650 TTTCCTCTACTGCACTCAAGTCATCCAGTTTCCAAAGCAATTCCTCAGTTGAGCTGAGGG 591 Qy 841 CTTTCACTTCAGACTTAAATAACCGTCTGCGCTCGCTTTACGCCCAATAAATCCGGATAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 590 CTTTCACTTCAGACTTAAATAACCGTCTGCGCTCGCTTTACGCCCAATAAATCCGGATAA 531 Qy 901 CGCTTGGAACATACGTATTACCGCGGCTGCTGGCACGTATTTAGCCGTTCCTTTCTGGTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 530 CGCTTGGAACATACGTATTACCGCGGCTGCTGGCACGTATTTAGCCGTTCCTTTCTGGTA 471 Qy 961 AGATACCGTCACACATTGAACAGTTACTCTCAATGTCATTCTTCTCTTACAACAGTGTTT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 470 AGATACCGTCACACATTGAACAGTTACTCTCAATGTCATTCTTCTCTTACAACAGTGTTT 411 Qy 1021 TACGAGCCGAAACCCTTCATCACACACGCGGCGTTGCTCCATCAGGCTTTCGCCCATTGT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 410 TACGAGCCGAAACCCTTCATCACACACGCGGCGTTGCTCCATCAGGCTTTCGCCCATTGT 351 Qy 1081 GGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTATGGGCCGTGTCTCAGTCCCATTGTGG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 350 GGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTATGGGCCGTGTCTCAGTCCCATTGTGG 291 Qy 1141 CCGATCAGTCTCTCAACTCGGCTATGCATCATCGCCTTGGTAAGCCATTACCTTACCAAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 290 CCGATCAGTCTCTCAACTCGGCTATGCATCATCGCCTTGGTAAGCCATTACCTTACCAAC 231 Qy 1201 TAGCTAATGCACCGCGGGACCATCTCTTAGTGATAGCAGAACCATCTTTTAAATAACAAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 230 TAGCTAATGCACCGCGGGACCATCTCTTAGTGATAGCAGAACCATCTTTTAAATAACAAC 171 Qy 1261 CATGCGGTTGTCATTGTTATACGGTATTAGCATCTGTTTCCAAATGTTATCCCCTGCTAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 170 CATGCGGTTGTCATTGTTATACGGTATTAGCATCTGTTTCCAAATGTTATCCCCTGCTAA 111 Qy 1321 GAGGTAGGTTTCCCACGTGTTACTCACCCGTTCGCCACTCTTTGCAATGTCCATCGTCAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 110 GAGGTAGGTTTCCCACGTGTTACTCACCCGTTCGCCACTCTTTGCAATGTCCATCGTCAT 51 Qy 1381 ATCTGAGCAAGCTCTTCAAATCAGTTGAACCACAAAGCGTTCGACTGCA 1429 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 50 ATCTGAGCAAGCTCTTCAAATCAGTTGAACCACAAAGCGTTCGACTGCA 2 Although Beasley 1 does not teach that Weissella confusa is Weissella confusa WSG1 preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 11, 2021 with a preservation number of CGMCC NO. 22697, if there should be a slight variation between Beasley 1’s strain and the instant strain, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have used Goh’s Weissella strain (the Weissella confusa has a 16S rRNA gene having the nucleotide sequence set forth in SEQ ID NO: 1) in Beasley 1’s method. One would have been motivated to substitute one strain for another since both are functional equivalents. A skilled artisan would have expected success since Goh’s strain produces an inhibitory effect on E. coli (page 3, paragraph 4; see Table 2) which can cause diarrhea, as evidenced by Ng et al. (page 38956, right column, paragraph 2). One would have reasonably expected success in the combination of Beasley 1’s and Goh’s teachings since both are directed to Weissella confusa and antimicrobial activity. Response to Arguments Applicant has traversed the previous rejections under 35 U.S.C. 102/103 and under 35 U.S.C. 103 in the reply filed on 04/20/2026 (remarks, pages 7-15). Since Beasley 2 is no longer relied upon in the above rejection, Applicant’s arguments regarding Beasley 2 are moot. Applicant's arguments regarding Beasley 1 have been fully considered but they are not persuasive. In Applicant’s reply, Applicant states that “Beasley 1 and the presently claimed Weissella confusa WSG1 have independent deposit information, moreover, the culture conditions of the strain in the present application are different from those in Beasley 1” (remarks, page 8). The Examiner responds that, as discussed above, the strain deposit information does not characterize the strain. In response to Applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e. culturing conditions comprising an initial pH of 6.0, a culture temperature of 37°C, a culture time of 16 h, a culture medium including carbon source and a nitrogen source, and the contents of the carbon source and the nitrogen source in the medium are each independently 1.0-3.0%) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Applicant describes: “Claim 10 now recites that a supernatant obtained from culturing the Weissella confuse WSG 1 strain for 24 h in vitro has an inhibitory effect on Escherichia coli, Salmonella typhimurium, and Clostridium perfringens. Beasley 1 does not disclose or suggest that limitation.” (remarks, page 9). The Examiner notes the 112b rejection of claim 10, and that the inhibitory effect of the culture supernatant is interpreted as a property of the instant strain, as discussed above. Based on Beasley 1’s teachings on the use of lactic acid bacteria as probiotics having the benefit of antagonism against pathogenic microbes and on lactic acid produced by lactic acid bacteria, wherein lactic acid has inhibitory effects on bacteria including E.coli, it is highly likely that a supernatant obtained from culturing Beasley 1’s strain for 24 h in vitro has an inhibitory effect on E. coli, as discussed above. Applicant states that “a skilled artisan would not have had a predictable basis to expect that replacing or isolating one optional Weissella strain with the specifically claimed WSG1 strain would successfully yield the claimed method of treating diarrhea” (remarks, page 13). The Examiner responds that a skilled artisan would have reasonably expected success in replacing the Beasley 1’s Weissella confusa strain with the claimed strain since both strains are used in a method for treating diarrhea, and since Beasley 1’s dog-specific strains, including Weissella confusa, are selected on their ability to perform antimicrobial activity (paragraphs [0026], [0030]). Applicant states that “the Examiner's rejection rests on impermissible hindsight rather than on the teachings of the applied references because the obviousness rationale is premised on Applicant's own disclosure rather than on what the cited references” (remarks, page 15). The Examiner responds that the above rejection of claim 10 under 103 over Beasley 1 relies on Beasley 1’s teachings, as evidenced by Stanojevic-Nikolic. It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to SANDRA ZINGARELLI whose telephone number is (703)756-1799. The examiner can normally be reached M-F 9-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Sharmila Landau can be reached at (571) 272-0614. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SANDRA ZINGARELLI/Examiner, Art Unit 1653 /SHARMILA G LANDAU/Supervisory Patent Examiner, Art Unit 1653
Read full office action

Prosecution Timeline

Sep 11, 2023
Application Filed
Jan 27, 2026
Non-Final Rejection mailed — §102, §103, §112
Apr 20, 2026
Response Filed
Jul 15, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12447184
NOVEL LACTIC ACID BACTERIA AND USE THEREOF
5y 11m to grant Granted Oct 21, 2025
Study what changed to get past this examiner. Based on 1 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
7%
Grant Probability
53%
With Interview (+46.3%)
3y 5m (~5m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 29 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month