Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on Sep. 13, 2023. Claims 1-6, 9 and 11-16 are pending and currently examined.
Foreign Priority
Acknowledgment is made of Applicant's claim for foreign priority based on an application 2021-041015 filed in Japan on March 15, 2021 and submission of a certified copy of the priority document. Since the priority document is not in English, an English translation must also be provided for the examiner to determine whether the document provides a written description for the instant claims. For the purpose of examination, the effective filing date is currently determined to be May 10, 2021, the filing date of the current application.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 14-15 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because claims 14-15 are directed to “use” of a recombinant measles virus.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 3, 5-6 and 9 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
Claim 3 recites “wherein the measles virus genome is an RNA consisting of a base sequence complementary to a base sequence set forth in SEQ ID NO: 1” which is not clear. It is not clear how to interpret the limitation “a base sequence complementary to a base sequence set forth in SEQ ID NO: 1”. E.g., it is not clear if the phrase “a base sequence” requires the entirety of SEQ ID NO: 1, or only a certain portion of the SEQ ID NO: 1 will suffice. If only a portion of SEQ ID NO: 1 is required, then it is not clear how a measles virus genome as claimed can be a RNA consisting of a portion of a genome RNA, and what portion it can be. It is noted that SEQ ID NO: 1 represents the sequence of a measles virus vector that does not contain a heterologous sequence, i.e., the vector sequence.
Claim 5 recites “An RNA consisting of a base sequence complementary to a base sequence set forth in SEQ ID NO: 3, or a DNA consisting of a base sequence set forth in SEQ ID NO: 3, or a plasmid vector comprising a DNA consisting of a base sequence set forth in SEQ ID NO: 1.” Here, the limitations “a base sequence set forth in SEQ ID NO: 1” and “a base sequence set forth in SEQ ID NO: 3” render the claim indefinite since it is not clear if these limitations require the entire nucleotide sequences of SEQ ID NO: 1 or SEQ ID NO: 3, or only certain regions of them would suffice.
Claim 6 recites “A DNA comprising: a gene encoding a protein of SARS-CoV-2 inserted into: a region ranging from a 1,686th base to a 1,694th base in a base sequence set forth in SEQ IDNO:2, or an Fse I recognition sequence located from a 1,686th base to a 1,694th base of a base sequence set forth in SEQ ID NO: 1.” This claim is not clear in at least the following aspects.
First, similar to the situation in claim 5, the phrases “a base sequence set forth in SEQ ID NO: 1” and “a base sequence set forth in SEQ ID NO: 2” is not clear since it is not clear if they refer to the entire sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or certain regions in these two sequences would suffice. Secondly, if the phrase may read on regions of SEQ ID NO: 1 or 2, then it is not clear how to determine the claimed nucleotide sequence positions 1686th base and 1694th base. Additionally, since claim 6 only requires that the claimed DNA comprise a gene encoding a protein of SARS-CoV-2 that is inserted into a region in a sequence set for forth in SEQ ID NO: 1 or SEQ ID NO: 2, it is not clear if the claim requires any of the sequences set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
To expedite examination, the phrase “a base sequence set forth in” SEQ ID NO: 1, 2 or 3 is considered as not requiring the entirety of the recited sequence.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-2, 4 and 12-16 are rejected under 35 U.S.C. 103 as being unpatentable over Horner et al. (P.N.A.S. 2020, 117: 32657-32666; submitted in IDS filed on Feb. 4, 2025) and/or Li et al. (US 2023/0310581 A1, published on Oct. 5, 2023; PCT filed on Apr. 27, 2021; and claiming benefit from US provisional applications 63/016,184 and 63/134,111, filed on Apr. 27, 2020 and Jan. 5, 2021, respectively), in view of Kai et al. (US 2012/0263751 A1, published on Oct. 18, 2012) and/or Yoneda et al. (PLoS ONE, 2013, 8(3): e58414; submitted in IDS filed on Feb. 4, 2025).
These claims relate to a recombinant measles virus or a genomic RNA thereof comprising a gene encoding a protein of coronavirus SARS-CoV-2 inserted between an N gene region and a P gene region in a measles genome.
Horner teaches that the authors generated measles virus (MeV)-based vaccine candidates expressing the SARS-CoV-2 spike glycoprotein (S). Insertion of the full-length S protein gene in two different MeV genomic positions resulted in modulated S protein expression. The variant with lower S protein expression levels was genetically stable and induced high levels of effective Th1-biased antibody and T cell responses in mice after two immunizations. In addition to neutralizing IgG antibody responses in a protective range, multifunctional CD8+ and CD4+ T cell responses with S protein-specific killing activity were detected. Upon challenge using a mouse-adapted SARS-CoV-2, virus loads in vaccinated mice were significantly lower, while vaccinated Syrian hamsters revealed protection in a harsh challenge setup using an early-passage human patient isolate. These results are highly encouraging and support further development of MeV-based COVID-19 vaccines. See Abstract.
Fig. 1 of Horner presents generation and in vitro characterization of two MeV-based SARS-CoV-2 vaccine candidates. Fig. 1A shows schematically the structures of the recombinant measles virus genomes containing inserts of a SARS-CoV-2 Spike gene sequence in two different regions, between the measles virus P and M gene regions or H and L gene regions. See below.
PNG
media_image1.png
220
476
media_image1.png
Greyscale
Li teaches an invention relating to a live attenuated recombinant measles virus (rMeV)-based coronavirus vaccine containing a SARS-Co V-2 spike (S) protein that has at least one mutation to remove a glycosylation site. In some embodiments, the rMeVs-based coronavirus vaccine contains full-length stabilized pre-fusion and native S proteins, S proteins of SARS-Co V-2 variants, truncated S proteins lacking its transmembrane and cytoplasmic domains, S proteins lacking glycosylation sites, the monomeric and trimeric receptor binding domain (RBD), the monomeric and trimeric S1 protein, Fc-fused RBD, or Fc-fused S1 protein. Also disclosed is a live attenuated recombinant coronavirus vaccine, wherein a stabilized prefusion spike (S) protein is inserted into a viral vector genome. See Abstract.
Fig. 2 of Li presents schematic construct of a recombinant measles virus (MeV) genome comprising sequences encoding various of the SARS-CoV-2 Spike antigens inserted between the MeV P and M gene regions, as well as a process of producing a plasmid DNA vector (pMeV-SARS-CoV-2) for the expression of the recombinant viral genome. See below.
PNG
media_image2.png
800
790
media_image2.png
Greyscale
Fig. 1A shows that heterologous antigen sequences can also be inserted between the MeV H and L regions in a recombinant MeV construct.
Accordingly, Horner and Li each individually teaches a recombinant measles virus comprising a SARS-CoV-2 antigen (e.g. a SARS-CoV-2 S antigen) sequence and application of the recombinant virus as vaccines against SARS-CoV-2. However, Horner and Li are silent on inserting the heterologous sequences between the MeV N and P regions; instead, they both use the regions between the P and M or H and L gene regions for the insertion of heterologous sequences.
Kai teaches an invention relating a vaccine against Nipah virus infection in the form of a recombinant measles virus in which is inserted a gene that encodes a Nipah virus antigen, such as the Nipah virus G protein or F protein. Also provided is a method of manufacturing a vaccine against Nipah virus infection. See Abstract.
Specifically, Kai teaches construction of a recombinant measles virus containing a Nipah G protein (MV-NiVG) in Example 1. Kai teaches that membrane protein of the Nipah virus, was obtained by RT-PCR using overall RNA extracted from a Nipah virus-infected vero cell. NiV-G cDNA was reamplified by a pair of primers to which was added Fse I restriction enzyme recognition sequence, it was cloned in a plasmid vector, and the base sequence was inspected. The NiV-G cDNA which was obtained by digesting this plasmid with Fse I was inserted at the Fsel site between the N gene and the P gene of pMV (7+) to obtain infectious cDNA clone pMV-NiVG which is used to construct a recombinant measles virus having G gene of a Nipah virus. See [0045].
Yoneda teaches construction of a recombinant measles virus vaccine expressing the Nipah Virus glycoprotein and shows that the recombinant measles virus vaccine protects against lethal Nipah virus challenge. In the study, the authors have developed a recombinant measles virus (rMV) vaccine expressing NiV envelope glycoproteins (rMV-HL-G and rMV-Ed-G). See Abstract.
Specifically, for the construction of the recombinant measles virus, Yoneda teaches that NiV G cDNA was amplified from pNiV(6+) by using following primers, NipG-SacI-F, 5’-GAGCTCATGCCGGCAGAAAACAAGAA- 3’ (SacI site in italic); and reverse primer NipG-FseI-R 5’-GGCCGGCCTATTATGTACATTGCTCTGGTA- 3’ (FseI site in italics; additional two nucleotides for rule of six in boldface). The intergenic region between the N and P junction was amplified by using the following primers. NP-F, GGCCGGCCTCCAATATTCTA (FseI site in italics); and reverse primer NP-R, GAGCTCCATTGGATGAATTGTTATTA (SacI site in italics). The PCR products were cloned into pGEM-T Easy (Promega, Madison, WI, USA). The NiV G fragment was inserted downstream of the N-P intergenic region, followed by digestion by SacI. Finally, the fragment of NiV G connected to the N-P intergenic region was cloned into the FseI site of the pMV-HL and pMV-Ed, and the resulting clones were used to rescue the infectious recombinant MVs expressing NiV G protein (rMV-HL-G and rMV-Ed-G). See page 2, left column, para 5.
Yoneda teaches that recombinant viruses expressing the NiV G protein were generated and rescued using vectors based on the HL (pMVHL) and Edmonston (pMV-Ed) strains. The rescued viruses were tested for the expression of G protein using infected cells. B95a and Vero cells were infected with the rMVs (rMVs, rMV-HL-G and rMV-Ed-G) and the expression of NiV G was examined by immunofluorescence. The NiV G protein was well expressed in rMV-HL-G- or rMV-Ed-G-infected cells (Fig. 1A). See page 3. Left column, para 1.
Accordingly, Kai and Yoneda each individually teaches the construction of recombinant measles virus-based vaccines against Nipah virus expressing Nipah virus antigens, wherein the heterologous antigen-coding sequences are inserted between the N and P gene regions, more specifically inserted at the Fse I restriction site in the N-P intergenic region on the measles virus genome. Even though Kai and Yoneda teach vaccines against a different virus, their teachings indicate that the intergenic region between the N and P genes of the measles virus genome was known and successfully used to accommodate heterologous antigen-coding sequences in the development of measle virus-based vaccines.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to combine teachings of Horner/Li with Kai/Yoneda to arrive at the invention as claimed. One would have been motivated to do so, e.g., to compare the known insertion positions for heterologous sequences for the optimization of gene expression and recombinant virus production.
Claims 3, 5-6 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Horner et al. (P.N.A.S. 2020, 117: 32657-32666; submitted in IDS filed on Feb. 4, 2025) and/or Li et al. (US 2023/0310581 A1, published on Oct. 5, 2023; PCT filed on Apr. 27, 2021; and claiming benefit from US provisional applications 63/016,184 and 63/134,111, filed on Apr. 27, 2020 and Jan. 5, 2021, respectively), in view of Kai et al. (US 2012/0263751 A1, published on Oct. 18, 2012) and/or Yoneda et al. (PLoS ONE, 2013, 8(3): e58414; submitted in IDS filed on Feb. 4, 2025), as applied above, and further in view of Lauer et al. (US 2013/0217757, published on Aug. 22, 2013).
These claims specify a MeV genomic sequence of SEQ ID NO: 1, 2 or 3.
SEQ ID NOs: 1 and 2 are sequences of two measles virus vectors without a heterologous gene. SEQ 1 and SEQ 2 are identical except for the following difference (the underlined sequence GGCCGGCC is the FseI restriction site):
SEQ1 1681 ACTAGGGCCGGCCTGCCGAGGACCAGAACAACATCCGCCTACCCTCCATCATTGTTATAA 1740
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||
SEQ2 1681 ACTAGGTGCGAGATGCCGAGGACCAGAACAACATCCGCCTACCCTCCATCATTGTTATAA 1740
SEQ ID NO: 3 represents a recombinant measles virus sequence containing a heterologous SARS-CoV-2 sequence.
As indicated in the 112(b) rejection above, claims 3, 5-6 and 9 are unclear, and, to expedite examination, these claims are interpreted as not requiring the entirety of the recited sequences (i.e., SEQ ID NO: 1, 2 or 3).
Relevance of Horner, Li, Kai and Yoneda is set forth above. However, they are silent on the sequences of the measles virus vectors used in the respective studies.
Lauer teaches an invention relating to a recombinant measles virus encoding a heterologous gene of interest, i.e., a suicide gene, for use in the treatment of malignant cells. See Abstract.
Lauer discloses the genomic sequence of a measles virus vector used in the study, SEQ ID NO: 1, also shown as Figure 1, which is at least 99.7% identical to the SEQ ID NOs: 1 and 2.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to substitute the measles virus vectors in the studies of Horner, Li, Kai, and Yoneda with the one disclosed in Lauer, if none of studies of Horner, Li, Kai, and Yoneda has already done so1, since the MeV vector of Lauer is known and used in the field and can be considered as an equivalent. See MPEP 2144.06.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN, on (571) 270-3497, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/NIANXIANG ZOU/
Primary Examiner, Art Unit 1671
1 Yoneda et al. (PLoS ONE, 2013, 8(3): e58414) is referred to in a Genbank publication submitted by the inventors, GenBank: MT409882 (dated May 11, 2020), which discloses a MeV sequence that is 100% identical to instant SEQ ID NO: 1. GenBank: MT409882 is submitted in IDS filed on Sep 13, 2023.