Prosecution Insights
Last updated: October 01, 2026
Application No. 18/282,138

PREECLAMPSIA DIAGNOSIS

Final Rejection §101§103§112
Filed
Sep 14, 2023
Priority
Mar 15, 2021 — EU 21162527.2 +1 more
Examiner
WILDER, CYNTHIA B
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Katholieke Universiteit Leuven
OA Round
2 (Final)
71%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
98%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
650 granted / 916 resolved
+11.0% vs TC avg
Strong +27% interview lift
Without
With
+26.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
47 currently pending
Career history
955
Total Applications
across all art units

Statute-Specific Performance

§101
8.3%
-31.7% vs TC avg
§103
38.1%
-1.9% vs TC avg
§102
14.5%
-25.5% vs TC avg
§112
28.0%
-12.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 916 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment filed 5/28/2026 is acknowledged. Claims 2, 10, 15, 19 have been canceled. Claims 1, 3-9, 11-14, 16-18, 20 and 21 are pending. Any rejection not reiterated in this action has been withdrawn as being obviated by the amendment of the claims. This action is made Final. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Information Disclosure Statement The information disclosure statement (IDS) submitted on 6/11/2026 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Previous Rejection The claim rejections under 35 USC 101 directed to claims 1-14, 16-18 and 20-21 are withdrawn in view of Applicant’s amendment of the claims. The claim rejection under 35 USC 112(a) first paragraph directed to the claims 1, 7, 8, 9, 10, 11, 12, 13, 17, 18, 19 and 21 as failing to comply with the written description requirement are withdrawn in view of applicant’s amendment of the claims. The prior art rejection under 35 USC 103 directed to the claims 1-14 as being unpatentable over Mee et al in view of Simon Valles and further in view of Lime and Venter is withdrawn in view of applicant’s amendment of the claims. New Ground(s) of Rejections THE NEW GROUND(S) OF REJECTIONS WERE NECESSITATED BY APPLICANT’S AMENDMENT OF THE CLAIMS: Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 14 and 16 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature/natural phenomenon and/or an abstract idea without significantly more. The judicial exception is not integrated into a practical application and the clams do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons that follow. Note that the unpatentability of laws of nature was confirmed by the U.S. Supreme Court in Mayo Collaborative Services v. Prometheus Laboratories, Inc., No. 10-1150 (March 20, 2012). The unpatentability of abstract ideas was confirmed by the US Supreme Court in Bilski v, Kappos, No. 08-964, 2010 WL 2555192 (June 28, 2010) and in Alice Corp. v. CLS Bank Int’l, 134 S. Ct. 2347, 2354 (2014). Applicant’s attention is directed to MPEP Ninth Edition, revision 10.2019 (revised June 2020) at Sections 2106 to 2107, which incorporates the USPTO January 7, 2019 Revised Patent Subject Matter Eligibility Guidance (i.e., “PEG”). Regarding step 1 of the subject atter eligibility test set forth at MPEP 2106III, the claims are directed to the statutory category of a natural product. Regarding Step 2A, prong one, the claims recite the judicial exception of natural products. The claims are directed to a set of probes specific for genomic regions found in the human genome build Grch37/hg19 which embraces products which may occur in nature. Applicants have not created or altered any of the information found in the human genome build Grch37/hg19. Since the probes are simply fragments of the Grch37/hg19 genome, which are considered naturally occurring. Regarding step 2A, prong two, having determine that the claims recited judicial exception, it is then determined whether the claims recite additional elements that integrate the judicial exception into a practical application. Herein the claims do not recite additional steps or elements that integrate the recited judicial exceptions into a practical application of the exception(s) because the additional steps are recited at a high level of generality such that they encompass the judicial exception of an abstract idea. The additional limitations “wherein the capture probes are modified to comprise a binding site that allows for direct or indirect capture of the capture probes” is likewise recited at a high level of generality, is non-specific, such that the modification of the oligoprobes could have evolved or occurred in nature and are therefore considered natural biological systems. Regarding step B, the next question is whether the remaining elements/steps, i.e., the non-patent-ineligible elements/steps – either in isolation or in combination amount to significantly more than the judicial exception. Herein, no additional elements are recited therein. Therefore, Applicant, have through experimentation, identified regions of gene which exists in the human genome Grch37/hg19 which could be used to detect a desire target in a human subject. MPEP states that the discovery of the region itself, no matter how innovative, does not by itself satisfy the 101 inquiries: “Groundbreaking, innovative, or even brilliant discovery does not by itself satisfy the 101 inquiries.” (Page 12, Association for Molecular Pathology v. Myriad Genetics, INC., herein "Myriad") In Myriad, the Supreme Court ruled that Myriad’s patent, which embraces a BRCA1 and BRCA2 genes and any 15 fragments thereof, if valid, would give it the exclusive rights to isolate an individual's BRCA1 and BRCA2 genes (page 6, Myriad). The Supreme Court also stated that, “Myriad did not create or alter any of the genetic information encoded by the BRCA1 and BRCA2 genes in that the location and order of the nucleotides existed in nature before Myriad found them" (page 6, Myriad). Further, MPEP 2106.05(d) states: The Courts have recognized the following laboratory techniques as well-understood, routine, conventional activity in the life science arts when they are claimed in a merely generic manner (e.g., at a high level of generality) or as insignificant extra solution activity. i. Determining the level of a biomarker in blood by any means, Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017); ii. Using polymerase chain reaction to amplify and detect DNA, Genetic Techs. v. Merial LLC, 818 F.3d 1369, 1376, 118 USPQ2d 1541, 1546 (Fed. Cir. 2016); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1377, 115 USPQ2d 1152, 1157 (Fed. Cir. 2015); iii. Detecting DNA or enzymes in a sample, Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017); iv. Immunizing a patient against a disease, Classen Immunotherapies, Inc. v. Biogen IDEC, 659 F.3d 1057, 1063, 100 USPQ2d 1492, 1497 (Fed. Cir. 2011); v. Analyzing DNA to provide sequence information or detect allelic variants, Genetic Techs., 818 F.3d at 1377; 118 USPQ2d at 1546; vi. Freezing and thawing cells, Rapid Litig. Mgmt. 827 F.3d at 1051, 119 USPQ2d at 1375; vii. Amplifying and sequencing nucleic acid sequences, University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014); and viii. Hybridizing a gene probe, Ambry Genetics, 774 F.3d at 764, 113 USPQ2d at 1247. In Mayo v. Prometheus, the Supreme Court stated: "[t]o put the matter more succinctly, the claims inform a relevant audience about certain laws of nature; any additional steps consist of well understood, routine, conventional activity already engaged in by the scientific community; and those steps, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately." For the reasons set forth above, when the claims are considered as a whole, the claims are not considered to recite something significantly more than a judicial exception and thereby are not directed to patent eligible subject matter. Response Arguments Applicant traverses the rejection on the following grounds that the claims the claims as amended recited the limitation that the probes are modified to comprises a binding site that allows for direct or indirect capture of the probes. Applicant states that the kir is not directed to a product of nature and qualifies as eligible subject matter. All of the amendment and arguments has been thoroughly reviewed and considered but not found persuasive for the reasons that follow: The examiner acknowledges Applicant’s arguments but respectfully disagree because no actual modification is recited and given the generality of the claim language, the examiner acknowledges that modifications of oligonucleotides can occur naturally. Applicant’s arguments are not found persuasive to obviate the rejections. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 3-9, 11-13, 17-18, 20 and 21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are directed to a method for determining the risk of developing preeclampsia in a pregnant human subject, wherein the subject's gestational age is under 140 days, comprising the steps of: a. providing a biological sample from the subject comprising cell-free DNA; b. measuring in the sample from the subject a plurality of loci-specific DNA methylation levels; b c. deriving from the measurement a DNA methylation profile for the subject; d. comparing the DNA methylation profile to: i. a reference DNA methylation profile corresponding to a high risk of preeclampsia group; and/or, ii. a reference DNA methylation profile corresponding to a low risk of preeclampsia group; e. assigning the subject, on the basis of the comparison, a preeclampsia risk group, thereby predicting the risk of developing preeclampsia in the subject and f. administering to the subject an effective dose of a treatment for preventing preeclampsia when the subject is predicted to be at risk of developing preeclampsia. The specification discusses and depict in the claim figures 1-6, a set of receiver operating characteristics curve of 20-500 iterations of a 10-fold cross-validation elastic net analysis, trained in 80% of the DNA methylation between control and preeclamptic placentas and validated on 20% of the correctly labelled data or the same data after label randomization and a whisker plot of the DNA concentration of bisulfite sequencing libraries prepared from cfDNA samples decried from matched controls. The specification discusses in the Examples, analysis of placental DNA methylation profile after delivery, at time of diagnosis, and before the onset of symptoms and selection of informative loci and elastic net analyses. The specification in the Table 4 provides an extensive table of genomic regions with non-zero coefficients and coordinates indicated on the basis of Grch37/hg19. Neither the specification nor claims make clear how one is to “assign the subject as having a high risk of developing preeclampsia when the DNA methylation profile of the subject is not statistically different from the reference DNA methylation profile because no actual methylation profile as classified as “high risk” or “low risk” is actually identified. The specification states that the coefficient can be positive or negative values indication potential different relationship between the DNA methylation at these regions, and preeclampsia-associated signals (see page 50). However, the specification does not indicate if the positive and negative values indicate risk values as being “high risk” or “low risk” or specified methylation profile corresponding to either a high risk or low risk of preeclampsia. The specification does not make clear the model of assigning a subject’s risk based on the data presented therein but rather make clear genomic regions of interest for assessing methylation signals in preeclampsia and matched control blood samples. Likewise, the specification does not provide any evidence of administering an effective dose or what encompasses an effective dose of aspirin when the subject is assigned as having a high risk of developing preeclampsia. The specification only recites a general recitation of the treatment being aspirin. No where is there a teaching associating assignment of risk (either low or high) with any “effective dose” of a treatment, such as aspirin. The general knowledge and level of skill in the art do not supplement the omitted description because specific, not general guidance is needed. Therefore, the claims do not provide adequate written description commensurate in scope with he claims as currently filed. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 3-9, 11-13, 17-18, 20 and 21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. (a) Claims 1, 3-9, 11-13, 17-18, 20 and 21 are indefinite in the claim 1 at the recitation of “ assign as having a high risk of developing preeclampsia” because the neither the specification nor claims provide a limiting definition of the term “high” in reference to the assigning “risk of preeclampsia”. Thus, the metes and bounds in the context of the claims is unclear. Clarification is required. Claim Rejections - 35 USC § 103 The following are new grounds of rejections necessitated by Applicant's amendments. Although the claims were previously rejected as being anticipated and/or unpatentable over the same reference(s), Applicant's amendments have necessitated the inclusion of new grounds of rejections in this Office action. It is noted that, to the extent that they apply to the present rejection; Applicant's arguments are addressed following the rejection. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 3-9, 11-14, 16-18, 20 and 21 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ryu Hyin Mee et al {Mee et al used interchangeably herein} (KR 20180009863, January 2018, citation made of record on IDS filed 2/15/2024) in view of Simon Valles et al {Simon Valles} (WO 2020212588, October 2020, citation made of record on IDS filed 2/15/2024) in view Lim et al (Clinical Epigenetics, 12: 128, 1-15, 2020) and Venter et al (US 6812339, November 2004) and further in view of Tuytten et al (WO 2019155071, August 2019). Regarding claims 1, 3-9, 11-14, 16-18, 20 and 21, Mee et al teaches a method of predicting a risk of preeclampsia in a pregnant woman in also a first trimester, i.e., under 111 and under 133 and under 140 days, characterized by determining methylation levels on cytosine reside in CPG sites of cell-free DNA from plasma samples, and also based on comparison with control levels in cases of know status of preeclampsia (See entire document, esp. Abstract, claims 1, Examples and Figures). Specifically, Mee et al teach that the study encompassed normal control (non-hypertensive group, low risk), pregnancy hypertension group (medium risk) and preeclampsia and pregnancy hypertensive disorder (higher risk). Mee teaches that methylated cell free DNA was extracted from cfDNA extracted pregnant plasma using MethylMiner methylated DNA extraction kit, wherein MBS magnetic beads and the capture magnetic beads conjugate followed by bisulfite direct sequence determining, quantitative real-time PCR and statistical analysis (See examples drawing descriptions and claims). Mee et al does not teach that measuring comprises measuring a plurality of loci specific DNA comprising genomic regions found in Grch37/hg19 and further administering to the subject an effective dose of an aspirin treatment for preventing preeclampsia when the subject is determined to be at risk of developing preeclampsia and further does not teach a kit comprising a set of capture probes comprising at least 10 genomic regions in the Grch37/hg19. Regarding claims 1, 3-9, 11-14, 16-18, 20 and 21, Simon Valles et al teach a method of detection risk preeclampsia in a pregnant woman by analyzing cfDNA from plasma or blood sample in respect to methylation on CpG in at least 10, 15, 29 or more genomic regions found in Grch37/hg19 (see e.g., para. 208 which teaches “Methyaction were annotated to Grch37/hg19 human genome assembly and resulting data contained genomic context annotation which encompasses at least 29 or more genomic loci regions, see also TABLES 2-7), wherein the sample is obtained in a first trimester and the method involves the use of capture probes and further administering a treatment once identified with preeclampsia wherein said treatment is a therapeutically effective amount of an aspirin (see section entitled “Treatment Methods” and para [0173]); See also the following paragraphs 8, 13, 53, 76, 101, 103, 109, 137-139, 173, 191, 197-198, 207, 208 and 225; see also Abstract, Claims and Figures). Regarding claims 14 and 16, Simon Valles teaches a kit comprising a set of capture probes specific for at least 10, 15, 29 or more genetic loci regions found in the human genome build Grch37/gh19 (see [0042] – [0043], [0084], [0091], [0104], [0110], [0138], [0201] - [0202], [0208]; see also TABLES 2-7). Regarding claims 3-6, 14, 16, and 20, Mee et al in view of Simon Valles et al do not expressly teach wherein the set of at least 10, 15, 29 or more genetic loci regions found in the human genome build Grch37/hg10 comprises at least one of SEQ ID NO: 601 to 3472. Lim et al, like Simon Valles, provides a teaching of Grch37/hg19-associated biomarkers with the prediction of the risk of developing preeclampsia (PE) in a pregnant human subject based on DNA methylation profiling to determine whether differential patterns of DNA methylation correlate with PE and severe features of PE. The reference teaches wherein genome-wide DNA methylation analysis of genomic loci found in the human genome build Grch37/hg19 was performed using the Illumina Human Methylation 850K BeadChip encompassing a plethora of new functional annotations of differentially methylated CpGs (DMCs) in PE and prediction profiles using bioinformatics tools (see entire documents, especially Tables 4-5 which teaches a plethora of specific genomic loci of the Grch37/hg19 assembly). Venter provides evidence of a sequence substantially identical to the SEQ ID NO: 601 (see sequence alignment below (Qy) = SEQ ID NO: 601 and (Db) = Venter sequence 13226). Venter teaches that know modification encompass by their method encompass methylation profiles and a disease that one or more of the gene is known in the art to be associated includes e.g., hypertension (see Table 1). RESULT 4 XX DE Human genomic DNA containing a SNP SEQ ID NO:13226. XX CC PN US6812339-B1. XX XX CC PA (APPL-) APPLERA CORP. XX CC PI Venter JC, Zhang JN, Liu X, Rowe W, Cravchik A, Kalush F; CC PI Naik A, Subramanian G, Woodage T; Query Match 100.0%; Score 535; Length 16407; Best Local Similarity 100.0%; Matches 535; Conservative 0; Mismatches 0; Indels 0; Gaps 0; _ Query Match 100.0%; Score 535; Length 16407; Best Local Similarity 100.0%; Matches 535; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACGCACACACGGGCGGACACACACACACGCGCGCACACACACACGCACAGAGCTCGCTCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2259 ACGCACACACGGGCGGACACACACACACGCGCGCACACACACACGCACAGAGCTCGCTCG 2318 Qy 61 CCTCGAGCGCACGAACGTGGACGTTCTCTTTGTGTGGAGCCCTCAAGGGGGGTTGGGGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2319 CCTCGAGCGCACGAACGTGGACGTTCTCTTTGTGTGGAGCCCTCAAGGGGGGTTGGGGCC 2378 Qy 121 CCGGTTCGGTCCGGGGGAGATGGCGCAGCCCATCCTGGGCCATGGGAGCCTGCAGCCCGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2379 CCGGTTCGGTCCGGGGGAGATGGCGCAGCCCATCCTGGGCCATGGGAGCCTGCAGCCCGC 2438 Qy 181 CTCGGCCGCTGGCCTGGCGTCCCTGGAGCTCGACTCGTCGCTGGACCAGTACGTGCAGAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2439 CTCGGCCGCTGGCCTGGCGTCCCTGGAGCTCGACTCGTCGCTGGACCAGTACGTGCAGAT 2498 Qy 241 TCGCATCTTCAAAATAATCGTGATTGGGGACTCCAACGTGGGCAAGACCTGCCTGACCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2499 TCGCATCTTCAAAATAATCGTGATTGGGGACTCCAACGTGGGCAAGACCTGCCTGACCTT 2558 Qy 301 CCGCTTCTGCGGGGGTACCTTCCCAGACAAGACTGAAGCCACCATCGGCGTGGACTTCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2559 CCGCTTCTGCGGGGGTACCTTCCCAGACAAGACTGAAGCCACCATCGGCGTGGACTTCAG 2618 Qy 361 GGAGAAGACCGTGGAAATCGAGGGCGAGAAGATCAAGGTGATCCAGGGGGTCAGGTCCAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2619 GGAGAAGACCGTGGAAATCGAGGGCGAGAAGATCAAGGTGATCCAGGGGGTCAGGTCCAG 2678 Qy 421 GAAGGGTGGGACCCGGGAGGGGACCTCGCCCGAGGCATAGCTCTAGCGGTTGTCGTCGTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2679 GAAGGGTGGGACCCGGGAGGGGACCTCGCCCGAGGCATAGCTCTAGCGGTTGTCGTCGTC 2738 Qy 481 CAGCGTCCAGCGCGTGGCGGTTTCGCCTCTTGCTGAGCCGAGGACCCTCGGCTCC 535 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2739 CAGCGTCCAGCGCGTGGCGGTTTCGCCTCTTGCTGAGCCGAGGACCCTCGGCTCC 2793 Thus, Venter provides further evidence that sequences associated with the Grch37/hg19 as taught by Simon Valles are known in the prior art as shown above. It would have been obvious to one ordinary skill in the art at the time of the effective filing date of the claimed invention to have modified the method of Ryu Hyin Mee to encompass teachings as taught by Simon Valles, Lim et al and Venter for the obvious benefit of improving means of diagnosing and treating preeclampsia in pregnant subjects based on epigenetic markers known in the art as suggested by the combination of the cited prior art. Additionally, While Mee in view of Simon Valles, Lim and Ventor teaches treating a subject having preeclampsia with aspirin as discussed above, the combination of the cited prior art does expressly focus on treatment when the subject is assigned as having a high risk of developing preeclampsia. Tuytten et al teach a system and method of generating a model that can detect or predict the predisposition of an outcome such as preeclampsia with a positive or/and negative predictive value better or equal to a predefine predictive value target, wherein the method factors in the impact of prevalence on test performed (abstract). Tuytten teaches with regards to preeclampsia, the model is used for predicting risk of developing preeclampsia in a woman at an early stage of pregnancy and therefore the subject in the test population do not necessarily have the target health condition at the time of measurement (see page 8, see also page 26, line 34 to page 27, line 4). Tuytten discuss determining high risk of developing the condition based on determining positive predictive values as compared to reference values (page 13, last paragraph and page 28). Finally, Tuytten recognize the advantages and impact of treat preeclampsia and the importance of using the model for predicting risk. Tuytten states “[W]hilst there are currently no readily available treatments to cure preeclampsia when it manifests, there are some drug treatments, i.e, aspirin and metformin (and others), which have the potential to prevent some of the preeclampsia cases developing. However, for these prophylactic interventions with therapeutics to impact on the incidence of preeclampsia at the population level to be effective, health care providers need to have a risk stratification tool, or test, which combines the following two attributes: identification of these pregnancies at increased risk for the disease early in pregnancy and triage the pregnancies to the appropriate treatment. These requirements follow the precautionary principle that one should not do harm to the pregnant woman and her unborn child. A blanket administration of drugs to all pregnancies in order to prevent preeclampsia in some, might incur unnecessary health risks (e.g., due to treatment side effects) in these who are not at risk in the first place. Contemporary hypotheses regarding the etiological causes of preeclampsia suggest that PE is syndromic in nature, and that preeclampsia is possibly more than one disease. In this hypothesis framework, the ability for accurately assessing early in pregnancy (several months prior to the manifestation of any clinical symptoms) which pregnant women are at increased (or high) risk of developing preeclampsia, and which women are a decreased (or low) risk of developing preeclampsia, will hinge on this assumption of preeclampsia being a multi-disease (page 60). It would have been obvious to one ordinary skill in the art at the time of the effective filing date of the claimed invention to have modified the method of Ryu Hyin Mee, Simon Valles, Lim et al and Venter to further encompass specific modeling profiles to predict risk of preeclampsia and then determine the appropriate treatment as taught by Tuytten et al for the obvious benefit of accurately assess early in pregnancy increased risk of developing preeclampsia and improve pregnancy outcomes as suggested by Tuytten. The combination of the cited prior art is prima facie obvious in the absence of secondary consideration. Conclusion 16. No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. 17. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CYNTHIA B WILDER whose telephone number is (571)272-0791. The examiner can normally be reached Flexible. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY BENZION can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CYNTHIA B WILDER/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Sep 14, 2023
Application Filed
Jan 28, 2026
Non-Final Rejection mailed — §101, §103, §112
May 28, 2026
Response Filed
Aug 10, 2026
Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12748105
METHOD FOR ANALYZING GLYCAN
4y 0m to grant Granted Sep 29, 2026
Patent 12735753
CRISPR-BASED ASSAY FOR DETECTING TB IN BODILY FLUIDS
4y 1m to grant Granted Sep 15, 2026
Patent 12729395
METHODS FOR RNA ANALYSIS
3y 10m to grant Granted Sep 08, 2026
Patent 12723276
A METHOD TO CALIBRATE NUCLEIC ACID LIBRARY SEEDING EFFICIENCY IN FLOWCELLS
3y 8m to grant Granted Sep 01, 2026
Patent 12708903
NUCLEIC ACID AMPLIFICATION SYSTEM AND METHOD THEREOF
3y 4m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
71%
Grant Probability
98%
With Interview (+26.6%)
3y 0m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 916 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month