DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s preliminary amendment filed 7/29/2024 is acknowledged. Claims 1-14 have been amended. Claim 15 was canceled. Claims 16-21 have been added. Claims 1-14 and 16-21 are pending.
Priority
This application is a 371 of PCT/EP2022/056679 filed 03/15/2022.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 2/15/2024 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings were received on 9/14/2023 is acknowledged. These drawings are found acceptable by the examiner.
Claim Rejections - 35 USC § 101
5. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
6. Claims 1-14, 16-18, 20-21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature/natural phenomenon and/or an abstract idea without significantly more. The judicial exception is not integrated into a practical application and the clams do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons that follow.
Note that the unpatentability of laws of nature was CONFIRMED BY THE us Supreme Court in Mayo Collaborative Services v. Prometheus Laboratories, Inc., No. 10-1150 (March 20, 2012).
The unpatentability of abstract ideas was confirmed by the US Supreme Court in Bilski v, Kappos, No. 08-964, 2010 WL 2555192 (June 28, 2010) and in Alice Corp. v. CLS Bank Int’l, 134 S. Ct. 2347, 2354 (2014).
Applicant’s attention is directed to MPEP Ninth Edition, revision 10.2019 (revised June 2020) at Sections 2106 to 2107, which incorporates the USPTO January 7, 2019 Revised Patent Subject Matter Eligibility Guidance (i.e., “PEG”).
Regarding step 1 of the subject atter eligibility test set forth at MPEP 2106III, the claims are directed to the statutory category of a process and natural product.
Regarding Step 2A, prong one, the claims recite the judicial exception of law of nature, The claims recite the correlation between any loci-specific DNA methylation, DNA methylation associated with genomic regions of the human genome build Grch37’hg19 and prediction of risk of preeclampsia. As in May Collaborative Services v. Prometheus, the recited relationship is a natural phenomenon that exists apart from any human action. See also Cleveland Clinic Foundation v. True health Diagnostic, LLC, 2018-1218 (Fed. Cir. 2019) which states that “The re-phrasing of the claims does not make them less directed to a natural law”.
The claims also are directed to a set of probes specific for genomic regions found in the human genome build Grch37/hg19 which embraces products which may occur in nature. Applicants have not created or altered any of the information found in the human genome build Grch37/hg19. Since the probes are simply fragments of the Grch37/hg19 genome, which are considered naturally occurring.
Regarding step 2A, prong two, having determine that the claims recited judicial exception, it is then determined whether the claims recite additional elements that integrate the judicial exception into a practical application.
Herein the claims do not recite additional steps or elements that integrate the recited judicial exceptions into a practical application of the exception(s) because the additional steps are recited at a high level of generality such that they encompass the judicial exception of an abstract idea. The additional limitations for e.g., in the claim 1, recite steps of measuring in the sample a plurality of loc-specific DNA methylation levels, deriving a methylation profile, comparing the DNA profile to a reference DNA methylation profile corresponding to a high risk of preeclampsia group and a reference DNA methylation profile corresponding to a low risk of preeclampsia group, assigning the subject on the basis of the comparison, and administering toe the subject an effective dose of a treatment for preventing preeclampsia when the subject is predicted to be at risk of developing preeclampsia. In this case, the steps of additional steps encompass mathematical calculations and/or possible mental steps in the deriving, comparing and assigning steps. The limitations of measuring and administering are recited at a high level of generality such that they do not impose meaningful limitations on the judicial exception.
Regarding step B, the next question is whether the remaining elements/steps, i.e., the non-patent-ineligible elements/steps – either in isolation combination amount to significantly more than the judicial exception.
Herein, at least with the claims directed to the process, the additionally recited step of measuring for methylation profile and the administering a treatment are non-specific and non-limiting such that they only involve well-understood, routine and conventional assays and do not add significantly more than the judicial exception. Further, MPEP 2106.05(d) states:
The Courts have recognized the following laboratory techniques as well-understood, routine, conventional activity in the life science arts when they are claimed in a merely generic manner (e.g., at a high level of generality) or as insignificant extra solution activity.
i. Determining the level of a biomarker in blood by any means, Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017);
ii. Using polymerase chain reaction to amplify and detect DNA, Genetic Techs. v. Merial LLC, 818 F.3d 1369, 1376, 118 USPQ2d 1541, 1546 (Fed. Cir. 2016); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1377, 115 USPQ2d 1152, 1157 (Fed. Cir. 2015);
iii. Detecting DNA or enzymes in a sample, Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017);
iv. Immunizing a patient against a disease, Classen Immunotherapies, Inc. v. Biogen IDEC, 659 F.3d 1057, 1063, 100 USPQ2d 1492, 1497 (Fed. Cir. 2011);
v. Analyzing DNA to provide sequence information or detect allelic variants, Genetic Techs., 818 F.3d at 1377; 118 USPQ2d at 1546;
vi. Freezing and thawing cells, Rapid Litig. Mgmt. 827 F.3d at 1051, 119 USPQ2d at 1375;
vii. Amplifying and sequencing nucleic acid sequences, University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014); and
viii. Hybridizing a gene probe, Ambry Genetics, 774 F.3d at 764, 113 USPQ2d at 1247.
In Mayo v. Prometheus, the Supreme Court stated: "[t]o put the matter more succinctly, the claims inform a relevant audience about certain laws of nature; any additional steps consist of well understood, routine, conventional activity already engaged in by the scientific community; and those steps, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately."
This is similar to the present situation wherein the additional steps and elements are recited at a high degree of generality and are all routine, well understood and conventional in the prior art. The recited steps and elements do not provide the inventive concept necessary to render the claims patent eligible. See also Genetic Technologies Ltd. v. Merial L.L.C. 818 F.3d at 1377, 1379 (Fed. Cir. 2016).
For the reasons set forth above, when the claims are considered as a whole, the claims are not considered to recite something significantly more than a judicial exception and thereby are not directed to patent eligible subject matter.
Claim Rejections - 35 USC § 112
7. The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
8. Claim 1, 7, 8, 9, 10, 11, 12, 13, 17, 18, 19 and 21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claim 1 of the instant invention are directed to a method for the prediction of the risk of developing preeclampsia in a pregnant human subject, wherein the subject’s gestational age is under 140 days, comprising the steps of providing a biological sample from the subject comprising cell-free DNA; measuring in the sample from the subject a plurality of loci-specific DNA methylation levels, deriving from the measurement a DNA methylation profile for the subject, comparing the DNA methylation profile to a reference DNA methylation profile corresponding to a high risk of preeclampsia group and/or a reference DNA methylation profile corresponding to a low risk of preeclampsia group, assigning the subject on the basis of the comparison to preeclampsia risk group, thereby predicting the risk of developing preeclampsia in the subject, and administering to the subject an effective dose of a treatment for preventing preeclampsia when the subject is predicted to be at risk of developing preeclampsia.
The claims as currently written do not provide adequate support for any and every loci-specific methylation level or any methylation change being associated with prediction the risk of developing preeclampsia. The specification discusses methylation level in a set of genomic regions associated with the human genome build Grch37/hg19. However, the specification provides no evidence of preeclampsia being associated with any genomic loci known or unknown in the human genome. Likewise, neither the specification or art provides any evidence that detection of any methylation change is associated with preeclampsia. Further no evidence is presented that detection of any genomic loci region besides those identified with Grch37/hg19 may have any association with determining risk of preeclampsia. The specification does not provide any guidance as to what methylation change in other regions are required to make the claimed assessment. The general knowledge and level of skill in the art do no supplement the omitted description because specific, not general guidance is what is needed. Therefore, the claims do not provide adequate written description commensurate in scope with the claims as currently filed.
Claim Rejections - 35 USC § 103
9. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
10. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
11. Claim(s) 1-14 and 16-21 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ryu Hyin Mee et al {Mee et al used interchangeably herein} (KR 20180009863, January 2018, citation made of record on IDS filed 2/15/2024) in view of Simon Valles et al {Simon Valles} (WO 2020212588, October 2020, citation made of record on IDS filed 2/15/2024) and further in view Lim et al (Clinical Epigenetics, 12: 128, 1-15, 2020) and (Venter et al (US 6812339, November 2004).
Regarding claims 1-14 and 16-21, Mee et al teaches a method of predicting a risk of preeclampsia in a pregnant woman in also a first trimester, i.e., under 111 and under 133 and under 140 days, characterized by determining methylation levels on cytosine reside in CPG sites of cell-free DNA from plasma samples, and also based on comparison with control levels in cases of know status of preeclampsia (See entire document, esp. Abstract, claims 1, Examples and Figures). Specifically, Mee et al teach that the study encompassed normal control (non-hypertensive group, low risk), pregnancy hypertension group (medium risk) and preeclampsia and pregnancy hypertensive disorder (higher risk). Mee teaches that methylated cell free DNA was extracted from cfDNA extracted pregnant plasma using MethylMiner methylated DNA extraction kit, wherein MBS magnetic beads and the capture magnetic beads conjugate followed by bisulfite direct sequence determining, quantitative real-time PCR and statistical analysis (See examples drawing descriptions and claims).
Mee et al does not teach that measuring comprises measuring a plurality of loci specific DNA comprising genomic regions found in Grch37/hg19 and further administering to the subject an effective dose of a treatment for preventing preeclampsia when the subject is determined to be at risk of developing preeclampsia and further does not teach a kit comprising a set of capture probes comprising at least 10 genomic regions in the Grch37/hg19.
Regarding claims 1-13, 17-19 and 21, Simon Valles et al teach a method of detection risk preeclampsia in a pregnant woman by analyzing cfDNA from plasma or blood sample in respect to methylation on CpG in at least 10, 15, 29 or more genomic regions found in Grch37/hg19 (see e.g., para. 208 which teaches “Methyaction were annotated to Grch37/hg19 human genome assembly and resulting data contained genomic context annotation which encompasses at least 29 or more genomic loci regions, see also TABLES 2-7), wherein the sample is obtained in a first trimester and the method involves the use of capture probes and further administering a treatment once identified with preeclampsia wherein said treatment is a therapeutically effective amount of an aspirin (see section entitled “Treatment Methods” and para [0173]); See also the following paragraphs 8, 13, 53, 76, 101, 103, 109, 137-139, 173, 191, 197-198, 207, 208 and 225; see also Abstract, Claims and Figures).
Regarding claims 14 and 16, Simon Valles teaches a kit comprising a set of capture probes specific for at least 10, 15, 29 or more genetic loci regions found in the human genome build Grch37/gh19 (see [0042] – [0043], [0084], [0091], [0104], [0110], [0138], [0201] - [0202], [0208]; see also TABLES 2-7).
Regarding claims 2-6, 14, 16, and 20, Mee et al in view of Simon Valles et al do not expressly teach wherein the set of at least 10, 15, 29 or more genetic loci regions found in the human genome build Grch37/hg10 comprises at least one of SEQ ID NO: 601 to 3472.
Lim et al, like Simon Valles, provides a teaching of Grch37/hg19-associated biomarkers with the prediction of the risk of developing preeclampsia (PE) in a pregnant human subject based on DNA methylation profiling to determine whether differential patterns of DNA methylation correlate with PE and severe features of PE. The reference teaches wherein genome-wide DNA methylation analysis of genomic loci found in the human genome build Grch37/hg19 was performed using the Illumina HumanMethylation 850K BeadChip encompassing a plethora of new functional annotations of differentially methylated CpGs (DMCs) in PE and prediction profiles using bioinformatics tools (see entire documents, especially Tables 4-5 which teaches a plethora of specific genomic loci of the Grch37/hg19 assembly).
Venter provides evidence of a sequence substantially identical to the SEQ ID NO: 601 (see sequence alignment below (Qy) = SEQ ID NO: 601 and (Db) = Venter sequence 13226). Venter teaches that know modification encompass by their method encompass methylation profiles and a disease that one or more of the gene is known in the art to be associated includes e.g., hypertension (see Table 1).
RESULT 4
XX
DE Human genomic DNA containing a SNP SEQ ID NO:13226.
XX
CC PN US6812339-B1.
XX
XX
CC PA (APPL-) APPLERA CORP.
XX
CC PI Venter JC, Zhang JN, Liu X, Rowe W, Cravchik A, Kalush F;
CC PI Naik A, Subramanian G, Woodage T;
XX
CC PT Novel isolated polynucleotide consisting of single nucleotide
CC PT polymorphisms of genes associated with human disease, useful for
CC PT screening for human disease susceptibility, prevention, and development
CC PT of diagnostics for human disease.
XX
CC PS Disclosure; SEQ ID NO 13226; 24pp; English.
XX
CC The invention relates to an isolated polynucleotide (I) chosen from a
CC polynucleotide consisting of single nucleotide polymorphisms (SNPs) of
CC genes associated with human disease. Also included are a detection
CC reagent (II) comprising (I) (where the segment comprises 15 or 20
CC contiguous nucleotides), an amplified polynucleotide comprising (I)
CC (where the segment comprises at least 30 contiguous nucleotides) and an
CC extension primer (III) comprising (I) (where the segment comprises at
CC least 12 or 20 contiguous nucleotides). Also disclosed as new are
CC antibodies that selectively bind to the proteins encoded by (I), SNP
CC detection kits (such as arrays or microarrays of nucleic acid molecules),
CC vectors containing (I) and recombinant host cells containing the
CC vectors. The polynucleotide (I) is useful for screening for human disease
CC susceptibility, prevention of human disease, development of diagnostics
CC and therapies for human disease, development of drugs for human disease,
CC development of individualized drug treatments based on the individual's
CC SNP profile and for developing superior diagnostic tests capable of
CC identifying individuals who express a detectable trait such as human
CC disease. The detection reagent (II) is useful for determining whether an
CC individual has a SNP affecting the level or pattern of gene expression.
CC (II) is useful for determining the efficacy, toxicity, or side effects of
CC a treatment with an agent in an animal. The present sequence is a genomic
CC DNA representing one of 5871 human genes containing SNPs. Note: The
CC sequence data for this patent did not form part of the printed
CC specification, but was obtained in electronic format directly from USPTO
CC at seqdata.uspto.gov/sequence.html?DocID=6812339B1.
XX
SQ Sequence 16407 BP; 4276 A; 3835 C; 4047 G; 4249 T; 0 U; 0 Other;
Query Match 100.0%; Score 535; Length 16407;
Best Local Similarity 100.0%;
Matches 535; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
_ Query Match 100.0%; Score 535; Length 16407;
Best Local Similarity 100.0%;
Matches 535; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACGCACACACGGGCGGACACACACACACGCGCGCACACACACACGCACAGAGCTCGCTCG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2259 ACGCACACACGGGCGGACACACACACACGCGCGCACACACACACGCACAGAGCTCGCTCG 2318
Qy 61 CCTCGAGCGCACGAACGTGGACGTTCTCTTTGTGTGGAGCCCTCAAGGGGGGTTGGGGCC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2319 CCTCGAGCGCACGAACGTGGACGTTCTCTTTGTGTGGAGCCCTCAAGGGGGGTTGGGGCC 2378
Qy 121 CCGGTTCGGTCCGGGGGAGATGGCGCAGCCCATCCTGGGCCATGGGAGCCTGCAGCCCGC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2379 CCGGTTCGGTCCGGGGGAGATGGCGCAGCCCATCCTGGGCCATGGGAGCCTGCAGCCCGC 2438
Qy 181 CTCGGCCGCTGGCCTGGCGTCCCTGGAGCTCGACTCGTCGCTGGACCAGTACGTGCAGAT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2439 CTCGGCCGCTGGCCTGGCGTCCCTGGAGCTCGACTCGTCGCTGGACCAGTACGTGCAGAT 2498
Qy 241 TCGCATCTTCAAAATAATCGTGATTGGGGACTCCAACGTGGGCAAGACCTGCCTGACCTT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2499 TCGCATCTTCAAAATAATCGTGATTGGGGACTCCAACGTGGGCAAGACCTGCCTGACCTT 2558
Qy 301 CCGCTTCTGCGGGGGTACCTTCCCAGACAAGACTGAAGCCACCATCGGCGTGGACTTCAG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2559 CCGCTTCTGCGGGGGTACCTTCCCAGACAAGACTGAAGCCACCATCGGCGTGGACTTCAG 2618
Qy 361 GGAGAAGACCGTGGAAATCGAGGGCGAGAAGATCAAGGTGATCCAGGGGGTCAGGTCCAG 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2619 GGAGAAGACCGTGGAAATCGAGGGCGAGAAGATCAAGGTGATCCAGGGGGTCAGGTCCAG 2678
Qy 421 GAAGGGTGGGACCCGGGAGGGGACCTCGCCCGAGGCATAGCTCTAGCGGTTGTCGTCGTC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2679 GAAGGGTGGGACCCGGGAGGGGACCTCGCCCGAGGCATAGCTCTAGCGGTTGTCGTCGTC 2738
Qy 481 CAGCGTCCAGCGCGTGGCGGTTTCGCCTCTTGCTGAGCCGAGGACCCTCGGCTCC 535
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2739 CAGCGTCCAGCGCGTGGCGGTTTCGCCTCTTGCTGAGCCGAGGACCCTCGGCTCC 2793
Thus, Venter provides further evidence that sequences associated with the Grch37/hg19 as taught by Simon Valles are known in the prior art as shown above. It would have been obvious to one ordinary skill in the art at the time of the effective filing date of the claimed invention to have modified the method of Ryu Hyin Mee to encompass teachings as taught by Simon Valles, Lim et al and Venter for the obvious benefit of improving means of diagnosing and treating preeclampsia in pregnant subjects based on epigenetic markers known in the art as suggested by the combination of the cited prior art.
Conclusion
12. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CYNTHIA B WILDER whose telephone number is (571)272-0791. The examiner can normally be reached Flexible.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY BENZION can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CYNTHIA B WILDER/Primary Examiner, Art Unit 1681