Prosecution Insights
Last updated: October 02, 2026
Application No. 18/282,139

TARGETED INSERTION VIA TRANSPOSITION

Non-Final OA §103§112§DOUBLEPATENT
Filed
Sep 14, 2023
Priority
Mar 15, 2021 — provisional 63/161,155 +3 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Curators of the University of Missouri
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
1y 0m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
285 granted / 750 resolved
-22.0% vs TC avg
Strong +53% interview lift
Without
With
+52.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
50 currently pending
Career history
813
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
38.7%
-1.3% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 750 resolved cases

Office Action

§103 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1, 8, 11, 15-16, 18-19, 21, 25-28, 30-32, 34-35, 43-47, 51 and 57 are pending in the present application. Applicant’s election without traverse of Group I, drawn to an engineered system for generating a genetically modified cell, in the reply filed on 06/11/2026 is acknowledged. Applicant also elected the following species: (i) SEQ ID NO: 67 for the gRNA; (ii) SEQ ID NO: 92 for the expression construct for expressing a gRNA; (iii) SEQ ID NO: 92 for an engineered system comprising elements a.i, a.ii, a.iii and b are all present in one nucleic acid construct/plasmid; and (iv) Cas9 nuclease. Accordingly, claims 44-47 and 51 were withdrawn from further consideration because they are directed to non-elected inventions. Additionally, claims 25-27, 31-32, 34-35 and 57 were also withdrawn from further consideration because they are directed to non-elected species. Therefore, claims 1, 8, 11, 15-16, 18-19, 21, 28, 30 and 43 are examined on the merits herein with the above elected species. Claim Objections Applicant is advised that should claim 16 be found allowable, claim 18 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 8, 11, 15-16, 18 and 43 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc). Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed. ”Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116. The instant claims encompass an engineered system for generating a genetically modified cell (e.g., a eukaryotic cell such as a plant cell, an animal cell such as a mammalian cell and non-mammalian cell, a prokaryote), the system comprising one or more constructs comprising: a. one or more nucleic acid constructs for expressing a Pong or Pong-like transposase comprising a Pong ORF1 protein and a Pong ORF2 protein fused at its C-terminus to any nuclease of an RNA-guided clustered regularly interspersed short panlindromic repeats (CRISPR) nuclease system, wherein the CRISPR nuclease system comprises the nuclease and a gRNA, wherein the one or more expression constructs comprise: i. an expression construct for expressing a Pong ORF1 protein (e.g., a Pong ORF1 protein comprising an amino acid sequence at least about 75% or more sequence identity to SEQ ID NO: 1, and wherein a nucleic acid sequence encoding the Pong ORF1 protein comprises at least about 75% or more sequence identity to SEQ ID NO: 2; claim 8), the expression construct comprising a promoter operably linked to a nucleic acid sequence encoding the Pong ORF1 protein; ii. an expression construct for expressing a Pong ORF2 protein (e.g., a Pong ORF2 protein comprising an amino acid sequence at least about 75% or more sequence identity to SEQ ID NO: 3, and wherein a nucleic acid sequence encoding the Pong ORF1 protein comprises at least about 75% or more sequence identity to SEQ ID NO: 4; claim 8) fused at its C-terminus to the nuclease protein of the CRISPR nuclease system (e.g., a Cas9 nuclease comprises an amino acid sequence at least about 75% or more sequence identity to SEQ ID NO: 5, and wherein the Cas9 nuclease is encoded by a nucleic acid sequence comprising at least about 75% sequence identity to SEQ ID NO: 6; claim 15), the expression construct comprising a promoter operably linked to a nucleic acid sequence encoding Pong ORF2 protein fused at its C-terminus to the nuclease protein of the CRISPR nuclease system; and iii. an expression construct for expressing the gRNA (e.g., the gRNA comprises any nucleic acid sequence of the elected SEQ ID NO: 67); and b. a nucleic acid construct comprising a donor polynucleotide flanked by mPing inverted repeat 1 and inverted repeat 2 (e.g., the mPing inverted repeat 1 comprises a nucleotide sequence at least about 75% or more sequence identity to SEQ ID NO: 7 and the mPing inverted repeat 2 sequence comprises a nucleotide sequence at least about 75% or more sequence identity to SEQ ID NO: 8; claim 11); and wherein the CRISPR nuclease system is engineered to introduce a cut in a target nucleic locus thereby guiding insertion of the donor polynucleotide at the target nucleic acid locus by the transposase to generate a genetically modified cell comprising the donor polynucleotide inserted at the target nucleic acid locus. Apart from disclosing that the rice mPing/Pong system provides the highest probability of functioning when fused to Cas9 or CFP1 (both of these CRISPR-Cas nucleases have been shown to be functional in plants) on either the N- or C-terminus of Pong ORF1 or ORF2 protein, as the Pong transposase is split into two proteins (ORF1 and ORF2) and can mobilize the mPing non-autonomous (non-protein coding) TE in a range of plant species (see at least Summary of the Invention; paragraphs [00247]-[00248]; Examples; Figs. 1-2 and 9-10); the instant specification failed to describe sufficiently any other CRISPR nuclease apart from the Cas9 and CFP1 nucleases to be fused to the C-terminus of a Pong ORF2 protein in the engineered system for generating a genetically modified cell, such that other CRISPR nuclease is capable of introduce a cut in a target nucleic acid locus thereby guiding insertion of the donor polynucleotide at the target nucleic acid locus by the Pong or Pong-like transposase as encompassed broadly by the instant claims. For example, which critical or essential elements does the other CRISPR nuclease possess such that upon fusion to the C-terminus of a Pong ORF2 protein it still retains the ability to introduce a cut in a target nucleic acid locus and guiding without affecting the insertion of the donor polynucleotide meditated by the Pong transposase (Pong ORF1 and ORF2-CRISPR nuclease) at the target nucleic acid locus to generate a genetically modified cell? Before the effective filing date of the present application (03/15/2021), Strother et al (Journal of the South Carolina Academy of Science 16: 48-52, 2018; IDS) already disclosed that a dCas9:mPing TPase fusion protein had a low transposition rate, suggesting that the addition of this large protein disrupts TPase function (see at least Abstract), let alone any CRISPR nuclease as encompassed broadly by the instant claims. Additionally, there is no evidence of record indicating or suggesting that the plant derived mPing/Pong system is capable of meditating insertion of a donor polynucleotide at the target nucleic acid locus in any cell other than plant cells (e.g., invertebrate and vertebrate animal cells, mammalian and non-mammalian cells) as encompassed broadly by the instant claims. Thus, which specific critical structure(s) do the components of the plant derived mPing/Pong system in the claimed engineered system possess such that the engineered system is capable of generating any genetically modified cell? With respect to claim 8, it encompasses a Pong ORF1 protein comprising an amino acid sequence comprising at least about 75% or more sequence identity to SEQ ID NO: 1 (465-amino-acid sequence), and wherein a nucleic acid sequence encoding the Pong ORF1 comprises a nucleotide sequence at least about 75% sequence identity to SEQ ID NO: 2 (1398-bp sequence). Thus, which specific modifications (e.g., substitution(s), insertion(s), deletion(s), or a combination thereof) and/or at which particular site(s) in the amino acid sequence of SEQ ID NO: 1 (up to about 117 amino acid modifications) and the nucleotide sequence of SEQ ID NO: 2 (up to about 350 nucleotide modifications) should be made, such that the modified Pong ORF1 protein is still functional and together with an ORF2 protein to mediate insertion of a donor polynucleotide at a target nucleic acid locus in a cell? Similarly, claim 8 also encompasses a Pong ORF2 protein comprising an amino acid sequence comprising at least about 75% or more sequence identity to SEQ ID NO: 3 (482-amino-acid sequence), and wherein a nucleic acid sequence encoding the Pong ORF2 comprises a nucleotide sequence at least about 75% sequence identity to SEQ ID NO: 4 (1446-bp sequence). Thus, which specific modifications (e.g., substitution(s), insertion(s), deletion(s), or a combination thereof) and/or at which particular site(s) in the amino acid sequence of SEQ ID NO: 1 (up to about 121 amino acid modifications) and the nucleotide sequence of SEQ ID NO: 2 (up to about 362 nucleotide modifications) should be made, such that the modified Pong ORF2 protein is still functional, particularly in a fusion protein with a CRISPR nuclease and together with an ORF1 protein to mediate insertion of a donor polynucleotide at a target nucleic acid locus? With respect to claim 11, it encompasses a mPing inverted repeat 1 sequence comprising a nucleotide sequence at least about 75% or more sequence identity with SEQ ID NO: 7 (12-nucleotide sequence) and mPing inverted repeat 2 sequence comprising a nucleotide sequence at least about 75% or more sequence identity with SEQ ID NO: 8 (12-nucleotide sequence). Thus, which specific modifications (e.g., substitution(s), insertion(s), deletion(s), or a combination thereof) and/or at which particular site(s) in the nucleotide sequence of SEQ ID NO: 7 (up to about 3 modifications) and the nucleotide sequence of SEQ ID NO: 8 (up to about 3 modifications) should be made, such that the modified mPing inverted repeat 1 and inverted repeat 2 sequences are still recognized by the Pong transposase and functional? With respect to claim 15, it encompasses a Cas9 nuclease comprising an amino acid sequence comprising at least about 75% or more sequence identity to SEQ ID NO: 5(1399-amino-acid sequence), and wherein the Cas 9 nuclease is encoded by a nucleic acid sequence having at least about 75% sequence identity to SEQ ID NO: 6 (4200-bp sequence). Thus, which specific modifications (e.g., substitution(s), insertion(s), deletion(s), or a combination thereof) and/or at which particular site(s) in the amino acid sequence of SEQ ID NO: 5 (up to about 350 amino acid modifications) and the nucleotide sequence of SEQ ID NO: 2 (up to about 1050 nucleotide modifications) should be made, such that the modified Cas nuclease protein is still functional to introduce a cut in a target nucleic acid and guiding insertion of a donor polynucleotide at the target nucleic acid locus, particularly the modified Cas nuclease protein is also fused to the C-terminus of a Pong ORF2 protein without interfering adversely the function of Pong ORF2 protein? With respect to claims 16 and 18, they encompass at least a gRNA comprising a nucleic acid sequence of the elected SEQ ID NO: 67 (20-nucleotide). The specification fails to provide sufficient written description for a gRNA comprising any nucleic acid sequence of any length (e.g., a 2-, 3-, 4-, 5-, 10-, 11-, 12-, 15- mer or more) as long as it is derived from SEQ ID NO: 67 such that the gRNA is still capable of guiding at least a Cas9 nuclease fused at the C-terminus of a Pong ORF2 to introduce a cut in a target nucleic acid locus, and thereby guiding insertion of a donor polynucleotide at the target nucleic acid locus in a cell as required by the instant claims. Since the prior art before the effective filing date of the present application (03/15/2021) failed to provide sufficient guidance and/or written description for the above issues as evidenced at least by the teachings of Gao et al (US 11,421,241), Guell Cargol et al (WO 2022/129438 with an effective filing date of 12/16/2020), Shrock et al (WO 2018/175872), Strother et al (Journal of the South Carolina Academy of Science 16: 48-52, 2018; IDS), La Rosa et al (US 2011/0131679), Yang et al (PNAS 104:10962-10967, 2007) and Wessler et al (US 7,250,556); it is incumbent upon the instant specification to do so. Furthermore, the instant specification also fails to provide and describe at least a representative number of species for a broad genus of an engineered system for generating a genetically modified cell as claimed broadly. The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision at least a representative number of species for a broad genus of an engineered system for generating a genetically modified cell as claimed broadly; and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 19, 21, 28, 30 and 43 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. In claim 19, it is unclear what is encompassed by the limitation “identity with the nucleic acid sequence starting at nucleotide 69 to nucleotide 498 of SEQ ID NO: 92”. This is because SEQ ID NO: 92 is listed as the 1423-amino-acid sequence in the paper sequence listing of the present application. Clarification is requested because the metes and bounds of the claim are not clearly determined. In claim 21, it is also unclear what is encompassed by the limitation “identity with the nucleic acid sequence of SEQ ID NO: 81”. This is because SEQ ID NO: 81 is listed as the 20-amino-acid sequence in the paper sequence listing of the present application. Clarification is requested because the metes and bounds of the claim are not clearly determined. In claim 28, it is unclear what is encompassed by the limitation “identity with the nucleic acid sequence starting at base 729 to base 1440 of SEQ ID NO: 92”. This is because SEQ ID NO: 92 is listed as the 1423-amino-acid sequence in the paper sequence listing of the present application. Once again, clarification is requested because the metes and bounds of the claim are not clearly determined. In claim 30, it is unclear what is encompassed by the limitations “identity with the nucleic acid sequence starting at base 1456 to base 5362 of SEQ ID NO: 92”, “identity with the nucleic acid sequence starting at base 5548 to base 12904 of SEQ ID NO: 92”, and “identity with the nucleic acid sequence starting at nucleotide 69 to nucleotide 498 of SEQ ID NO: 92”. This is because SEQ ID NO: 92 is listed as the 1423-amino-acid sequence in the paper sequence listing of the present application. Once again, clarification is requested because the metes and bounds of the claim are not clearly determined. In claim 43, it is unclear what is encompassed by the limitation “One or more nucleic acid constructs encoding an engineered nucleic acid modification system of claim 1”. This is because an engineered nucleic acid modification system of claim 1 already comprises one or more nucleic acid constructs for expression of various components recited in claim 1, and accordingly what exactly Applicant intend to claim one or more nucleic acid constructs encoding one or more nucleic acid constructs of an engineered nucleic acid modification system of claim 1. Clarification is requested because the metes and bounds of the claim are not clearly determined. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1 and 43 are rejected under 35 U.S.C. 103 as being unpatentable over Shrock et al (WO 2018/175872) in view of Yang et al (PNAS 104:10962-10967, 2007), Guell Cargol et al (WO 2022/129438 with an effective filing date of 12/16/2020). Shrock et al already disclosed a composition of altering a target nucleic acid sequence in a cell (e.g., a eukaryotic cell, a stem cell or a somatic cell), the composition comprises a guide RNA comprising a portion that is complementary to all or a portion of the target nucleic acid sequence, a Cas9 transposase fusion protein, and a donor nucleic acid sequence, wherein the guide RNA and the Cas9 transposase fusion protein co-localize at the target nucleic acid sequence, and wherein the Cas9 transposase fusion protein cleaves the target nucleic acid and the donor nucleic acid sequence is inserted into the target nucleic acid sequence in a site-specific manner (Abstract; Summary; first full paragraph at page 9; and Example 1). Shrock et al also taught that the guide RNA and/or Cas9 transposase fusion protein are in the form of a vector(s), and the donor nucleic acid sequence is a transposon sequence. Example 1 demonstrated CRISPR Cas9-transposase fusion mediated site-specific integration of a 20kb transposon sequence, and wherein an encoded hyperactive piggyBac transposase is fused downstream of Cas9 in a pcDNA3.3 backbone vector. Shrock et al stated “Critically, the fusion construct involved the nuclease-competent version of Cas9, rather than the nuclease-null dCas9….In contrast, this example makes use of the nuclease-competent version of Cas9, which retains its capacities for both sequence-specific localization and cleavage of double-stranded DNA (dsDNA)” (second last sentence at page 23 continues to first complete sentence at page 24). Shrock et al did not teach explicitly an engineered system comprising the elements recited in claim 1 of the present application, particularly one or more nucleic acid constructs for expressing a Pong or Pong-like transposase comprising a Pong ORF1 protein and a Pong ORF2 protein fused at its C terminus to a CRISPR nuclease; a gRNA and a nucleic acid construct comprising a donor polynucleotide flanked by mPing inverted repeat 1 and inverted repeat 2. Before the effective filing date of the present application (03/15/2021), Yang et al already characterized and demonstrated successful deployment of a heterologous transposition system for mPing in Arabidopsis thaliana (Abstract; Figs. 1-2 and 6). Yang et al demonstrated that functional copies of both ORF1 and ORF2 are necessary for transposition of mPing, and ORF2 is probably the transposase because it contains the DDE motif (right column, last two paragraphs at page 10966 continue to first two paragraphs on left column at page 10966). Yang et al also stated “Our data also indicate that mPing, unlike most (but not all) DNA transposons, does not have a preference for insertion into sites linked to the donor” (left column, last full paragraph at page 10966). Additionally, Guell Cargol et al also taught a composition comprising (i) a first protein comprising or consisting of a site-specific DNA binding protein capable of binding and cleaving a target nucleic acid sequence (e.g., CRISPR Cas9); or a nucleic acid construct encoding said first protein; and (ii) a second protein comprising or consisting of a transposase (e.g., Frog Prince, Sleeping Beauty, PiggyBac and hyperactive PiggyBac); or a nucleic acid construct encoding said second protein; the same composition further comprises a guide RNA and an exogenous nucleic acid for insertion in a genome (Abstract; Summary of the Disclosure). Guell Cargol et al also disclosed that the first protein and the second protein are fused together to form a fusion protein, optionally through a linker; and in one embodiment, the first protein (e.g., Cas 9) is fused to the C-terminal end of the second protein (e.g., Frog Prince, Sleeping Beauty, PiggyBac and hyperactive PiggyBac), optionally through a linker (page 3, lines 3-5; lines 1-10 at page 27). Moreover, Guell Cargol et al also tested various combinations of Cas9 variants fused to PB variants for on-target and off-target transposition in an exemplification; and they found that the highest level of programmable insertion in Nter-cas9-PB-Cter fusions containing Cas9 with intact nuclease activity with significantly lower efficiency of targeted insertion by nCas9 (D10A) and dcas9 (D10A and H840A) fused to PB (last paragraph at page 77; and Fig. 2A). Guell Cargol et al stated “These results are consistent with a mechanism where DSB generation by Cas9 in the vicinity of PB facilitates the insertional activity of PB and bypasses its requirement for the canonical TTAA at the insertion site” (last sentence at page 77). Accordingly, it would have been obvious for an ordinary skill in the art to modify the teachings of Shrock et al by also at least preparing one or more nucleic acid constructs for expressing a Pong or Pong-like transposase comprising a Pong ORF1 protein and a Pong ORF2 protein fused at its C terminus to an active CRISPR Cas9 nuclease; a gRNA and a nucleic acid construct comprising a donor polynucleotide flanked by mPing inverted repeat 1 and inverted repeat 2, in light of teachings of Yang et al and Guell Cargol et al as presented above. An ordinary skill in the art would have been motivated to carry out the above modifications so that the modified mPing system resulting from the combined teachings of Shrock et al, Yang et al and Guell Cargol et al could mediate site-specific integration of a donor transposon sequence into a target nucleic acid sequence in a site-specific manner in a plant cell. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Shrock et al, Yang et al and Guell Cargol et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified system resulting from the combined teachings of Shrock et al, Yang et al and Guell Cargol et al as set forth above is indistinguishable from the engineered system of the present application. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 8 and 11 are rejected under 35 U.S.C. 103 as being unpatentable over Shrock et al (WO 2018/175872) in view of Yang et al (PNAS 104:10962-10967, 2007), Guell Cargol et al (WO 2022/129438 with an effective filing date of 12/16/2020) as applied to claims 1 and 43 above, and further in view of Wessler et al (US 7,250,556) and La Rosa et al (US 2011/0131679). The combined teachings of Shrock et al, Yang et al and Guell Cargol et al were presented above. However, none of the cited references teach specifically using the Pong ORF1 protein comprising an amino acid sequence comprising at least about 75% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, and wherein a nucleic acid sequence encoding the Pong ORF1 comprises at least about 75% or more sequence identity with the nucleic acid sequence of SEQ ID NO: 2; and the Pong ORF2 protein comprising an amino acid sequence comprising at least about 75% or more sequence identity with the amino acid sequence of SEQ ID NO: 3, and wherein a nucleic acid sequence encoding the Pong ORF2 comprises at least about 75% or more sequence identity with the nucleic acid sequence of SEQ ID NO: 4; and/or the mPing inverted repeat 1 comprises a nucleotide sequence at least about 75% or more sequence identity with the nucleic acid sequence of SEQ ID NO: 7, and the mPing inverted repeat 2 comprises a nucleotide sequence at least about 75% or more sequence identity with the nucleic acid sequence of SEQ ID NO: 8. Before the effective filing date of the present application (03/15/2021), Wessler et al already disclosed isolated transposable elements or isolated DNA sequences that are members of the mPing/Pong family of transposable elements, and such transposable elements are useful in applications such as the stable introduction of a DNA sequence of interest into a plant cell (Abstract; Summary of the Invention; particularly Table 1). The disclosed transposable elements include the nucleotide sequence of SEQ ID NO: 9 for Pong in rice, in which the sequence of nucleotides 2959-4404 is 99.3% sequence identity to SEQ ID NO: 4 (Pong ORF2 nucleic acid) of the present application and encodes 99.6% sequence identity to SEQ ID NO: 3 (Pong ORF2 protein) of the present application (Table 1; and attached sequence searches below); and the nucleotide sequence of SEQ ID NO: 3 (430-bp sequence) for mPing in rice, in which the sequence of first 12 nucleotides is 100% identical to SEQ ID NO: 7 of the present application, and the sequence of last 12 nucleotides (nucleotides 419-430) is 100% identical to SEQ ID NO: 8 of the present application (Table 1, and attached sequence searches below). Wessler et al also disclosed the nucleotide sequence of SEQ ID NO: 5 for Ping in rice, in which the sequence of nucleotides 454-2660 encodes for an amino acid sequence that has 86.4% to the amino acid sequence of SEQ ID NO: 1 (Pong ORF1 protein) of the present application (Table 1; and attached sequence search below). Additionally, La Rossa et al also disclosed rice nucleic acids molecules that are useful for improvement of plants, including the nucleotide sequence of SEQ ID NO: 94922 in which the sequence of nucleotides 168-1564 is 91.1% identical to SEQ ID NO: 2 (Pong ORF1 nucleic acid) of the present application, and encodes an amino acid sequence that is 94.2% identical to SEQ ID NO: 1 (Pong ORF1 protein) of the present application (Abstract; Summary of the Invention; and attached sequence searches below). La Rossa et al also disclosed the nucleotide sequence of 27845, in which the sequence of nucleotides 1-1341 is 92.1% identical to SEQ ID NO: 4 (Pong ORF2 nucleic acid) of the present application, and encodes an amino acid sequence that is 93.2% identical to SEQ ID NO: 3 (Pong ORF2 protein) of the present application (Abstract; Summary of the Invention; and attached sequence searches below). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Shrock et al, Yang et al and Guell Cargol et al by also utilizing isolated transposable elements or isolated DNA sequences that are members of the mPing/Pong family of transposable elements, including the Pong ORF1 and the Pong ORF2 transposable elements as well as the mPing inverted repeat 1 and the mPing inverted repeat 2 having the recited amino acid and/or nucleic acid homology for the engineered system of the present application, in light of the teachings of Wessler et al and La Rosa et al as set forth above. An ordinary skill in the art would have been motivated to further carry out the above modifications because both Wessler et al and La Rosa et al have already disclosed isolated DNA sequences that are members of the mPing/Pong family of transposable elements, and rice nucleic acid molecules, respectively; that fall within the recited amino acid and nucleic acid homology for the Pong ORF1 and Pong ORF2 components of the engineered system of the present application. Additionally, Wessler et al also disclosed mPing inverted repeat 1 and mPing inverted repeat 2 that are 100% identical to SEQ ID NOs: 7-8, respectively, of the present application in the mPing sequence of SEQ ID NO: 3. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Shrock et al, Yang et al, Guell Cargol et al, Wessler et al and La Rosa et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified system resulting from the combined teachings of Shrock et al, Yang et al, Guell Cargol et al, Wessler et al and La Rosa et al as set forth above is indistinguishable from the engineered system of the present application. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 15-16 and 18 is rejected under 35 U.S.C. 103 as being unpatentable over Shrock et al (WO 2018/175872) in view of Yang et al (PNAS 104:10962-10967, 2007), Guell Cargol et al (WO 2022/129438 with an effective filing date of 12/16/2020) as applied to claims 1 and 43 above, and further in view of Gao et al (US 11,421,241). The combined teachings of Shrock et al, Yang et al and Guell Cargol et al were presented above. However, none of the cited references teach specifically the use of a Cas9 nuclease comprising an amino acid having at least about 75% or more with the amino acid sequence of SEQ ID NO: 5 of the present application, and wherein the Cas9 nuclease is encoded by a nucleic acid sequence comprising at least about 75% or more sequence identity with the nucleic acid sequence of SEQ ID NO: 6 of the present application; or a gRNA comprising a nucleic acid sequence of the elected SEQ ID NO: 67. Please note that a sequence of SEQ ID NO: 67 can be any sequence having at least a 2-nucleotide sequence of SEQ ID NO: 67, and not necessarily limited to the entire SEQ ID NO: 67. Before the effective filing date of the present application (03/15/2021), Gao et al already disclosed the use of pHSN4110C1 plasmid for site-directed modification of whole plant through gene transient expression, wherein the plasmid comprising the nucleotide sequence of SEQ ID NO: 4 in which the sequence of nucleotides 73-4272 is 100% identical to SEQ ID NO: 6 of the present application, and encodes a Cas9 nuclease comprising the amino acid sequence that is 100% identical to SEQ ID NO: 5 of the present application (see at least Abstract; Summary of the Invention; Examples; and attached sequence search below). Gao et al also taught using a gRNA that complementarily binds to the target sequence of 5’-ACGATATCCGCCGATTTCAC-3’ in Arabidopsis endogenous gene AtPTPA; and such gRNA (5’-GTGAAATCGGCGGATATCGT-3’) contains at least a sequence of SEQ ID NO: 67 (col. 5, lines 48-57; and Example 2). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Shrock et al, Yang et al and Guell Cargol et al by also utilizing the Cas9 nuclease that is encoded by the sequence of nucleotides 73-4272 in SEQ ID NO: 4 of the pHSN41110C1 plasmid along with the disclosed gRNA as taught by Gao et al for generating a genetically modified Arabidopsis cell. An ordinary skill in the art would have been motivated to further carry out the above modifications because Gao et al already taught successfully using these components for site-directed modification of whole plant. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Shrock et al, Yang et al, Guell Cargol et al and Gao et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified system resulting from the combined teachings of Shrock et al, Yang et al, Guell Cargol et al and Gao et al as set forth above is indistinguishable from the engineered system of the present application. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 8, 11, 15-16, 18 and 43 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 6-13, 19-22, 26-40, 43-44, 48-51, 62 and 64-65 of copending Application No. 19/126,724 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because an engineered nucleic acid modification system for generating a genetically modified cell, the system comprising: a. a donor polynucleotide comprising a first and second mPing miniature inverted-repeat transposable element (MITE) transposition sequences (e.g., the first mPing transposition sequence comprises at least about 75% or more sequence identity with SEQ ID NO: 7 and the second mPing transposition sequence comprises at least about 75% or more sequence identity with SEQ ID NO: 8; claims 26-28); b. one or more nucleic acid constructs for expressing a transposase comprising a promoter operably linked to a nucleic acid encoding the Pong ORF1 protein (e.g., the Pong ORF1 comprises an amino acid sequence comprising at least about 75% or more sequence identity to SEQ ID NO: 1, and wherein a nucleic acid sequence encoding the Pong ORF1 protein comprises at least about 75% or more sequence identity to SEQ ID NO: 2; claim 4) and a promoter operably linked to a nucleic acid encoding the Pong ORF2 protein (e.g., the Pong ORF2 protein comprises an amino acid sequence comprising at least about 75% or more sequence identity to SEQ ID NO: 3, and wherein a nucleic acid sequence encoding the Pong ORF2 protein comprises at least about 75% or more sequence identity to SEQ ID NO: 4; claim 4); and c. a nucleic acid expression construct for expressing a programmable targeting system, wherein the expression construct comprises a promoter operably linked to a nucleic acid sequence encoding the programmable targeting system (e.g., a CRISPR-Cas system comprising a Cas9 nuclease such as a Cas9 nuclease comprising an amino acid sequence at least about 75% or more sequence identity to SEQ ID NO: 5, and wherein the Cas9 nuclease is encoded by a nucleic acid sequence comprising at lest about 75% or more sequence identity to SEQ ID NO: 6, and a gRNA such as SEQ ID NO: 67; claims 7-8; including the Pong ORF2 protein is linked at its C-terminus to the Cas9 nuclease via one copy of a G4S linker of SEQ ID NO: 64 such as a nucleic acid sequence starting at base 8392 to base 14052 of SEQ ID NO: 74 or a nucleic acid sequence starting at base 7451 to base 15799 of SEQ ID NO:74; claims 9-12); wherein the programmable targeting system is programmed to target the transposase and the donor polynucleotide to a target nucleic acid locus in the cell, to introduce a cut in the target nucleic acid locus, or both, thereby accomplishing insertion of the donor polynucleotide at the target nucleic acid locus to generate a genetically modified cell comprising the donor polynucleotide inserted at the target nucleic acid locus in claims 1, 4, 6-13, 19-22, 26-40, 43-44, 48-51, 62 and 64-65 of copending Application No. 19/126,724 encompasses and/or anticipates the engineered system for generating a genetically modified cell in the application being examined and, therefore, a patent to the genus would, necessarily, extend the rights of the species or sub- should the genus issue as a patent after the species of sub-genus. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusions No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/ Primary Examiner, Art Unit 1631 Sequence 9, US/10346198 Patent No. 7250556 Alignment Scores: Length: 5166 Score: 2506.00 Matches: 480 Percent Similarity: 99.6% Conservative: 0 Best Local Similarity: 99.6% Mismatches: 2 Query Match: 99.6% Indels: 0 Gaps: 0 US-18-282-139-3 (1-482) x US-10-346-198-9 (1-5166) Qy 1 MetGlnSerLeuAlaIleSerLeuLeuLeuSerGluThrHisSerLeuPheSerHisThr 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2959 ATGCAGAGTTTAGCCATCTCTCTACTCCTCTCAGAAACTCATTCCCTCTTTTCTCATACG 3018 Qy 21 LysThrSerSerLeuLeuSerLeuLeuPheLeuSerSerSerLysMetSerGluGlnAsn 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3019 AAGACCTCCTCCCTTTTATCTTTACTGTTTCTCTCTTCTTCAAAGATGTCTGAGCAAAAT 3078 Qy 41 ThrAspGlySerGlnValProValAsnLeuLeuAspGluPheLeuAlaGluAspGluIle 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3079 ACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTGGCTGAGGATGAGATC 3138 Qy 61 IleAspAspLeuLeuThrGluAlaThrValValValGlnSerThrIleGluGlyLeuGln 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3139 ATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACTATAGAAGGTCTTCAA 3198 Qy 81 AsnGluAlaSerAspHisArgHisHisProArgLysHisIleLysArgProArgGluGlu 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3199 AACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAGAGGCCACGAGAGGAA 3258 Qy 101 AlaHisGlnGlnLeuValAsnAspTyrPheSerGluAsnProLeuTyrProSerLysIle 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3259 GCACATCAGCAACTAGTGAATGATTACTTTTCAGAAAATCCTCTTTACCCTTCCAAAATT 3318 Qy 121 PheArgArgArgPheArgMetSerArgProLeuPheLeuArgIleValGluAlaLeuGly 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3319 TTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATCGTTGAGGCATTAGGC 3378 Qy 141 GlnTrpSerValTyrPheThrGlnArgValAspAlaValAsnArgLysGlyLeuSerPro 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3379 CAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGGAAAGGACTCAGTCCA 3438 Qy 161 LeuGlnLysCysThrAlaAlaIleArgGlnLeuAlaThrGlySerGlyAlaAspGluLeu 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3439 CTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGTGGCGCAGATGAACTA 3498 Qy 181 AspGluTyrLeuLysIleGlyGluThrThrAlaMetGluAlaMetLysAsnPheValLys 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3499 GATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATGAAGAATTTTGTCAAA 3558 Qy 201 GlyLeuGlnAspValPheGlyGluArgTyrLeuArgArgProThrMetGluAspThrGlu 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3559 GGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACCATGGAAGATACCGAA 3618 Qy 221 ArgLeuLeuGlnLeuGlyGluLysArgGlyPheProGlyMetPheGlySerIleAspCys 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3619 CGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTCGGCAGCATTGACTGC 3678 Qy 241 MetHisTrpHisTrpGluArgCysProValAlaTrpLysGlyGlnPheThrArgGlyAsp 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3679 ATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAGTTCACTCGTGGAGAT 3738 Qy 261 GlnLysValProThrLeuIleLeuGluAlaValAlaSerHisAspLeuTrpIleTrpHis 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3739 CAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGATCTTTGGATTTGGCAT 3798 Qy 281 AlaPhePheGlyAlaAlaGlySerAsnAsnAspIleAsnValLeuAsnGlnSerThrVal 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3799 GCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTGAACCAATCTACTGTA 3858 Qy 301 PheIleLysGluLeuLysGlyGlnAlaProArgValGlnTyrMetValAsnGlyAsnGln 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3859 TTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATGGTAAATGGGAATCAA 3918 Qy 321 TyrAsnThrGlyTyrPheLeuAlaAspGlyIleTyrProGluTrpAlaValPheValLys 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3919 TACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGGGCAGTGTTTGTTAAG 3978 Qy 341 SerIleArgLeuProAsnThrGluLysGluLysLeuTyrAlaAspMetGlnGluGlyAla 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3979 TCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGATATGCAAGAAGGGGCA 4038 Qy 361 ArgLysAspIleGluArgAlaPheGlyValLeuGlnArgArgPheCysIleLeuLysArg 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4039 AGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTTTGCATCTTAAAACGA 4098 Qy 381 ProAlaArgLeuTyrAspArgGlyValLeuArgAspValValLeuAlaCysIleIleLeu 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4099 CCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTAGCTTGCATCATACTT 4158 Qy 401 HisAsnMetIleValGluAspGluLysGluThrArgIleIleGluGluAspAlaAspAla 420 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 4159 CACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAAGAAGATTTAGATCTA 4218 Qy 421 AsnValProProSerSerSerThrValGlnGluProGluPheSerProGluGlnAsnThr 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4219 AATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCTCCTGAACAGAACACA 4278 Qy 441 ProPheAspArgValLeuGluLysAspIleSerIleArgAspArgAlaAlaHisAsnArg 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4279 CCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGAGCGGCTCATAACCGA 4338 Qy 461 LeuLysLysAspLeuValGluHisIleTrpAsnLysPheGlyGlyAlaAlaHisArgThr 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4339 CTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGTGCTGCACATAGAACT 4398 Qy 481 GlyAsn 482 |||||| Db 4399 GGAAAT 4404 Sequence 9, US/10346198 Patent No. 7250556 Query Match 99.3%; Score 1436.4; Length 5166; Best Local Similarity 99.6%; Matches 1440; Conservative 0; Mismatches 6; Indels 0; Gaps 0; Qy 1 ATGCAGAGTTTAGCCATCTCTCTACTCCTCTCAGAAACTCATTCCCTCTTTTCTCATACG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2959 ATGCAGAGTTTAGCCATCTCTCTACTCCTCTCAGAAACTCATTCCCTCTTTTCTCATACG 3018 Qy 61 AAGACCTCCTCCCTTTTATCTTTACTGTTTCTCTCTTCTTCAAAGATGTCTGAGCAAAAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3019 AAGACCTCCTCCCTTTTATCTTTACTGTTTCTCTCTTCTTCAAAGATGTCTGAGCAAAAT 3078 Qy 121 ACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTGGCTGAGGATGAGATC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3079 ACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTGGCTGAGGATGAGATC 3138 Qy 181 ATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACTATAGAAGGTCTTCAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3139 ATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACTATAGAAGGTCTTCAA 3198 Qy 241 AACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAGAGGCCACGAGAGGAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3199 AACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAGAGGCCACGAGAGGAA 3258 Qy 301 GCACATCAGCAACTGGTGAATGATTACTTTTCAGAAAATCCTCTTTACCCTTCCAAAATT 360 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 3259 GCACATCAGCAACTAGTGAATGATTACTTTTCAGAAAATCCTCTTTACCCTTCCAAAATT 3318 Qy 361 TTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATCGTTGAGGCATTAGGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3319 TTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATCGTTGAGGCATTAGGC 3378 Qy 421 CAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGGAAAGGACTCAGTCCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3379 CAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGGAAAGGACTCAGTCCA 3438 Qy 481 CTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGTGGCGCAGATGAACTA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3439 CTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGTGGCGCAGATGAACTA 3498 Qy 541 GATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATGAAGAATTTTGTCAAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3499 GATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATGAAGAATTTTGTCAAA 3558 Qy 601 GGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACTATGGAAGATACCGAA 660 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 3559 GGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACCATGGAAGATACCGAA 3618 Qy 661 CGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTCGGCAGCATTGACTGC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3619 CGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTCGGCAGCATTGACTGC 3678 Qy 721 ATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAGTTCACTCGTGGAGAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3679 ATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAGTTCACTCGTGGAGAT 3738 Qy 781 CAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGATCTTTGGATTTGGCAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3739 CAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGATCTTTGGATTTGGCAT 3798 Qy 841 GCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTGAACCAATCTACTGTA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3799 GCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTGAACCAATCTACTGTA 3858 Qy 901 TTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATGGTAAATGGGAATCAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3859 TTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATGGTAAATGGGAATCAA 3918 Qy 961 TACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGGGCAGTGTTTGTTAAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3919 TACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGGGCAGTGTTTGTTAAG 3978 Qy 1021 TCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGATATGCAAGAAGGGGCA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3979 TCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGATATGCAAGAAGGGGCA 4038 Qy 1081 AGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTTTGCATCTTAAAACGA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4039 AGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTTTGCATCTTAAAACGA 4098 Qy 1141 CCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTAGCTTGCATCATACTT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4099 CCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTAGCTTGCATCATACTT 4158 Qy 1201 CACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAAGAAGATGCAGATGCA 1260 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | Db 4159 CACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAAGAAGATTTAGATCTA 4218 Qy 1261 AATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCTCCTGAACAGAACACA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4219 AATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCTCCTGAACAGAACACA 4278 Qy 1321 CCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGAGCGGCTCATAACCGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4279 CCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGAGCGGCTCATAACCGA 4338 Qy 1381 CTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGTGCTGCACATAGAACT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4339 CTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGTGCTGCACATAGAACT 4398 Qy 1441 GGAAAT 1446 |||||| Db 4399 GGAAAT 4404 Sequence 5, US/10346198 Patent No. 7250556 Alignment Scores: Length: 5341 Score: 2143.00 Matches: 433 Percent Similarity: 60.7% Conservative: 14 Best Local Similarity: 58.8% Mismatches: 18 Query Match: 86.4% Indels: 272 Gaps: 2 US-18-282-139-1 (1-465) x US-10-346-198-5 (1-5341) Qy 1 MetAspProSerProAlaValAspProSerProAlaValAspProSerProAlaAlaGlu 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 454 ATGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCTGCTGAA 513 Qy 21 ThrArgArgArgAlaThrGlyLysGlyGlyLysGlnArgGlyGlyLysGlnLeuGlyLeu 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 514 ACCCGGCGGCGTGCAACCGGGAAAGGAGGCAAACAGCGCGGGGGCAAGCAACTAGGATTG 573 Qy 41 LysArgProProProIleSerValProAlaThrProProProAlaAlaThrSerSerSer 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 574 AAGAGGCCGCCGCCGATTTCTGTCCCGGCCACCCCGCCTCCTGCTGCGACGTCTTCATCC 633 Qy 61 ProAlaAlaProThrAlaIleProProArgProProGlnSerSerProIlePheValPro 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 634 CCTGCTGCGCCGACGGCCATCCCACCACGACCACCGCAATCTTCGCCGATTTTCGTCCCC 693 Qy 81 AspSerProAsnProSerProAlaAlaProThrSerSerLeuAlaSerGlyThrSerThr 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 694 GATTCGCCGAATCCGTCACCGGCTGCGCCGACCTCCTCTCTTGCTTCGGGGACATCGACG 753 Qy 101 AlaArgProProGlnProGlnGlyGlyGlyTrpGlyProThrSerThrIleSerProAsn 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 754 GCAAGGCCACCGCAACCACAAGGAGGAGGATGGGGACCAACATCGACCATTTCCCCAAAC 813 Qy 121 PheAlaSerPhePheGlyAsnGlnGlnAspProAsnSer--------------------- 133 ||||||||||||||||||||||||||||||||||||||| Db 814 TTTGCATCTTTCTTTGGAAACCAACAAGACCCAAATTCATGGTACATGTATTTTCTTCTT 873 Qy 133 ------------------------------------------------------------ 133 Db 874 TTTCTGTTACTTTCAACCTACGGTAACTCTAATTCATGGATGAGACTACTGCCATTGTGC 933 Qy 133 ------------------------------------------------------------ 133 Db 934 AGTTCAATGCTTTTTCTTCATGTTATATTTCGTCCAGCTGTGAGTTATGGTTTGAAGATT 993 Qy 133 ------------------------------------------------------------ 133 Db 994 GCTGTGGTTGTTTCATTGCTGAGTATGTGAAAGATAGATGGATGAAAGAGAGAATTATAT 1053 Qy 133 ------------------------------------------------------------ 133 Db 1054 TTTAGTCTGTAATCTTGCTCATCCAGTTGCTCATGTATGACCTTGGTTCTAGAATGTTGC 1113 Qy 133 ------------------------------------------------------------ 133 Db 1114 CCTGACTGTATGCTTAATGTTCAGAGAAGTGATGCCTAAAGCAGTGAGATCAGTGGGATC 1173 Qy 133 ------------------------------------------------------------ 133 Db 1174 AGATTAGCTATCGACATATAATATTAGCTATCTCAGTTGTGAAAGAGAGATGGGTGAAAA 1233 Qy 133 ------------------------------------------------------------ 133 Db 1234 GGCACCCCTTGGATTAATTCTGTAGTATCAAATTCTGCACCTTGTCTGTCCATATGTTCT 1293 Qy 133 ------------------------------------------------------------ 133 Db 1294 GCTTGGTTGGTGGGTGCAGTGCATTTGTAAAAAATAGTTTGCTTCTGATCCTTAATATAT 1353 Qy 133 ------------------------------------------------------------ 133 Db 1354 GTAACAGGGAATGAATTTTCACCCATCTCAGTTGTAAAGGTACTGTCTTGCTATGCAATA 1413 Qy 133 ------------------------------------------------------------ 133 Db 1414 TGTGTAAATTGACAAACCTGAAAATAGTCTGTTTGGAATTTGCAAAAGCAATTCGATAGT 1473 Qy 133 ------------------------------------------------------------ 133 Db 1474 TTGGAATTTCCAAACCTCAGTCAGCAGTAGGCAATCCATTTTAGTTCTTGCTATGCACAA 1533 Qy 134 ----------------------------------------------------CysLeuVa 136 ||||| Db 1534 AAACAGTACACCTGATATGCTCATTTTAATACAACTTTTTTGTCTCTGTTACAGTTTGGT 1593 Qy 136 lArgGlyTyrProProGlyGlyPheValAsnPheIleGlnGlnAsnCysProProGlnPr 156 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1594 CAGGGGTTATCCTCCAGGAGGGTTTGTCAATTTTATTCAACAAAATTGTCCGCCGCAGCC 1653 Qy 156 oGlnGlnGlnGlyGluAsnPheHisPheValGlyHisAsnMetGlyPheAsnProIleSe 176 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1654 ACAACAGCAAGGTGAAAATTTTCATTTCGTTGGTCACAATATGGGATTCAACCCAATATC 1713 Qy 176 rProGlnProProSerAlaTyrGlyThrProThrProGlnAlaThrAsnGlnGlyThrSe 196 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1714 TCCACAGCCACCAAGTGCCTACGGAACACCAACACCCCAAGCTACGAACCAAGGCACTTC 1773 Qy 196 rThrAsnIleMetIleAspGluGluAspAsnAsnAspAspSerArgAlaAlaLysLysAr 216 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1774 AACAAACATTATGATTGATGAAGAGGACAACAATGATGACAGTAGGGCAGCAAAGAAAAG 1833 Qy 216 gTrpThrHisGluGluGluGluArgLeu-------------------------------- 225 |||||||||||||||||||||||||||| Db 1834 ATGGACTCATGAAGAGGAAGAGAGACTGGTATTCATCGGATACTTTTACATTTCCATATG 1893 Qy 226 -----------------------------------------------AlaSerAlaTrpL 230 ||||||||||||| Db 1894 TCTTTGTTTTGACTAATACTTGACAGGTCATTAACTGATTCTTGTAGGCCAGTGCTTGGT 1953 Qy 230 euAsnAlaSerLysAspSerIleHisGlyAsnAspLysLysGlyAspThrPheTrpLysG 250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1954 TGAATGCTTCTAAAGACTCAATTCATGGGAATGATAAGAAAGGTGATACATTTTGGAAGG 2013 Qy 250 luValThrAspGluPheAsnLysLysGlyAsnGlyLysArgArgArgGluIleAsnGlnL 270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2014 AAGTCACTGATGAATTTAACAAGAAAGGGAATGGAAAACGTAGGAGGGAAATTAACCAAC 2073 Qy 270 euLysValHisTrpSerArgLeuLysSerAlaIleSerGluPheAsnAspTyrTrpSerT 290 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2074 TGAAGGTTCACTGGTCAAGGTTGAAGTCAGCGATCTCTGAGTTCAATGACTATTGGAGTA 2133 Qy 290 hrValThrGlnMetHisThrSerGlyTyrSerAspAspMetLeuGluLysGluAlaGlnA 310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2134 CGGTTACTCAAATGCATACAAGCGGATACTCCGACGACATGCTTGAGAAAGAGGCACAGA 2193 Qy 310 rgLeuTyrAlaAsnArgPheGlyLysProPheAlaLeuValHisTrpTrpLysIleLeuL 330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2194 GGCTGTATGCAAACAGGTTTGGAAAACCTTTTGCGTTGGTCCATTGGTGGAAGATACTCA 2253 Qy 330 ysArgGluProLysTrpCysAlaGlnPheGluLysArgLysArgLysSerGluMetAspA 350 || ||||||||||||||||||||||||||| ||| |||||||||||||||| Db 2254 AAGATGAGCCCAAATGGTGTGCTCAGTTTGAATCAGAGAAAGACAAGAGCGAAATGGATG 2313 Qy 350 laValProGluGlnGlnLysArgProIleGlyArgGluAlaAlaLysSerGluArgLysA 370 ||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 2314 CTGTTCCAGAACAGCAGTCACGTCCTATTGGTAGAGAAGCAGCAAAGTCTGAGCGCAATG 2373 Qy 370 rgLysArgLysLysGluAsnValMetGluGlyIleValLeuLeuGlyAspAsnValGlnL 390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2374 GAAAGCGCAAGAAAGAAAATGTTATGGAAGGCATTGTCCTCCTAGGGGACAATGTCCAGA 2433 Qy 390 ysIleIleLysValThrGlnAspArgLysLeuGluArgGluLysValThrGluAlaGlnI 410 |||||||||||||| :::||||||:::::::::||||||||| ||||||||||||| Db 2434 AAATTATAAAGGTCCACGAAGACCGGAGGGTGGATCGTGAAAAGGCCACCGAAGCACAGA 2493 Qy 410 leHisIleSerAsnValAsnLeuLysAlaAlaGluGlnGlnLysGluAlaLysMetPheG 430 || ||||||||| ||| ||||||::::::|||||||||||||||||||||: Db 2494 TTCAGATATCAAATGCAACATTGTTGGCCGCTAAGGAGCAGAAGGAAGCAAAGATGTTCG 2553 Qy 430 luValTyrAsnSerLeuLeuThrGlnAspThrSerAsnMetSerGluGluGlnLysAlaA 450 ::|||||||||:::||||||::::::|||||||||||||||||||||:::||| ||| Db 2554 ATGTGTACAATACTCTATTAAGTAAGGATACAAGCAACATGTCTGAAGATCAAATGGCTA 2613 Qy 450 rgArgAspLysAlaLeuGlnLysLeuGluGluLysLeuPheAlaAsp 465 :::|||::::::||||||||||||||||||||||||||| Db 2614 GCCACCAGAGGGCAATACGGAAATTAGAGGAGAAGCTATTTGCGGAT 2660 Sequence 94922, US/10437963 Publication No. US20110131679A2 Alignment Scores: Length: 1628 Score: 2334.00 Matches: 434 Percent Similarity: 96.3% Conservative: 14 Best Local Similarity: 93.3% Mismatches: 17 Query Match: 94.2% Indels: 0 Gaps: 0 US-18-282-139-1 (1-465) x US-10-437-963-94922 (1-1628) Qy 1 MetAspProSerProAlaValAspProSerProAlaValAspProSerProAlaAlaGlu 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 168 ATGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCTGCTGAA 227 Qy 21 ThrArgArgArgAlaThrGlyLysGlyGlyLysGlnArgGlyGlyLysGlnLeuGlyLeu 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 228 ACCCGGCGGCGTGCAACCGGGAAAGGAGGCAAACAGCGCGGGGGCAAGCAACTAGGATTG 287 Qy 41 LysArgProProProIleSerValProAlaThrProProProAlaAlaThrSerSerSer 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 288 AAGAGGCCGCCGCCGATTTCTGTCCCGGCCACCCCGCCTCCTGCTGCGACGTCTTCATCC 347 Qy 61 ProAlaAlaProThrAlaIleProProArgProProGlnSerSerProIlePheValPro 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 348 CCTGCTGCGCCGACGGCCATCCCACCACGACCACCGCAATCTTCGCCGATTTTCGTCCCC 407 Qy 81 AspSerProAsnProSerProAlaAlaProThrSerSerLeuAlaSerGlyThrSerThr 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 408 GATTCGCCGAATCCGTCACCGGCTGCGCCGACCTCCTCTCTTGCTTCGGGGACATCGACG 467 Qy 101 AlaArgProProGlnProGlnGlyGlyGlyTrpGlyProThrSerThrIleSerProAsn 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 468 GCAAGGCCACCGCAACCACAAGGAGGAGGATGGGGACCAACATCGACCATTTCCCCAAAC 527 Qy 121 PheAlaSerPhePheGlyAsnGlnGlnAspProAsnSerCysLeuValArgGlyTyrPro 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 528 TTTGCATCTTTCTTTGGAAACCAACAAGACCCAAATTCATGTTTGGTCAGGGGTTATCCT 587 Qy 141 ProGlyGlyPheValAsnPheIleGlnGlnAsnCysProProGlnProGlnGlnGlnGly 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 588 CCAGGAGGGTTTGTCAATTTTATTCAACAAAATTGTCCGCCGCAGCCACAACAGCAAGGT 647 Qy 161 GluAsnPheHisPheValGlyHisAsnMetGlyPheAsnProIleSerProGlnProPro 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 648 GAAAATTTTCATTTCGTTGGTCACAATATGGGATTCAACCCAATATCTCCACAGCCACCA 707 Qy 181 SerAlaTyrGlyThrProThrProGlnAlaThrAsnGlnGlyThrSerThrAsnIleMet 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 708 AGTGCCTACGGAACACCAACACCCCAAGCTACGAACCAAGGCACTTCAACAAACATTATG 767 Qy 201 IleAspGluGluAspAsnAsnAspAspSerArgAlaAlaLysLysArgTrpThrHisGlu 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 768 ATTGATGAAGAGGACAACAATGATGACAGTAGGGCAGCAAAGAAAAGATGGACTCATGAA 827 Qy 221 GluGluGluArgLeuAlaSerAlaTrpLeuAsnAlaSerLysAspSerIleHisGlyAsn 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 828 GAGGAAGAGAGACTGGCCAGTGCTTGGTTGAATGCTTCTAAAGACTCAATTCATGGGAAT 887 Qy 241 AspLysLysGlyAspThrPheTrpLysGluValThrAspGluPheAsnLysLysGlyAsn 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 888 GATAAGAAAGGTGATACATTTTGGAAGGAAGTCACTGATGAATTTAACAAGAAAGGGAAT 947 Qy 261 GlyLysArgArgArgGluIleAsnGlnLeuLysValHisTrpSerArgLeuLysSerAla 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 948 GGAAAACGTAGGAGGGAAATTAACCAACTGAAGGTTCACTGGTCAAGGTTGAAGTCAGCG 1007 Qy 281 IleSerGluPheAsnAspTyrTrpSerThrValThrGlnMetHisThrSerGlyTyrSer 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1008 ATCTCTGAGTTCAATGACTATTGGAGTACGGTTACTCAAATGCATACAAGCGGATACTCC 1067 Qy 301 AspAspMetLeuGluLysGluAlaGlnArgLeuTyrAlaAsnArgPheGlyLysProPhe 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1068 GACGACATGCTTGAGAAAGAGGCACAGAGGCTGTATGCAAACAGGTTTGGAAAACCTTTT 1127 Qy 321 AlaLeuValHisTrpTrpLysIleLeuLysArgGluProLysTrpCysAlaGlnPheGlu 340 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1128 GCGTTGGTCCATTGGTGGAAGATACTCAAAGATGAGCCCAAATGGTGTGCTCAGTTTGAA 1187 Qy 341 LysArgLysArgLysSerGluMetAspAlaValProGluGlnGlnLysArgProIleGly 360 ||| ||||||||||||||||||||||||||||||||| |||||||||||| Db 1188 TCAGAGAAAGACAAGAGCGAAATGGATGCTGTTCCAGAACAGCAGTCACGTCCTATTGGT 1247 Qy 361 ArgGluAlaAlaLysSerGluArgLysArgLysArgLysLysGluAsnValMetGluGly 380 |||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 1248 AGAGAAGCAGCAAAGTCTGAGCGCAATGGAAAGCGCAAGAAAGAAAATGTTATGGAAGGC 1307 Qy 381 IleValLeuLeuGlyAspAsnValGlnLysIleIleLysValThrGlnAspArgLysLeu 400 |||||||||||||||||||||||||||||||||||||||||| :::||||||:::::: Db 1308 ATTGTCCTCCTAGGGGACAATGTCCAGAAAATTATAAAGGTCCACGAAGACCGGAGGGTG 1367 Qy 401 GluArgGluLysValThrGluAlaGlnIleHisIleSerAsnValAsnLeuLysAlaAla 420 :::||||||||| ||||||||||||||| ||||||||| ||| |||||| Db 1368 GATCGTGAAAAGGCCACCGAAGCACAGATTCAGATATCAAATGCAACATTGTTGGCCGCT 1427 Qy 421 GluGlnGlnLysGluAlaLysMetPheGluValTyrAsnSerLeuLeuThrGlnAspThr 440 ::::::|||||||||||||||||||||:::|||||||||:::||||||::::::|||||| Db 1428 AAGGAGCAGAAGGAAGCAAAGATGTTCGATGTGTACAATACTCTATTAAGTAAGGATACA 1487 Qy 441 SerAsnMetSerGluGluGlnLysAlaArgArgAspLysAlaLeuGlnLysLeuGluGlu 460 |||||||||||||||:::||| ||| :::|||::::::|||||||||||| Db 1488 AGCAACATGTCTGAAGATCAAATGGCTAGCCACCAGAGGGCAATACGGAAATTAGAGGAG 1547 Qy 461 LysLeuPheAlaAsp 465 ||||||||||||||| Db 1548 AAGCTATTTGCGGAT 1562 Sequence 94922, US/10437963 Publication No. US20110131679A2 Query Match 91.1%; Score 1273.8; Length 1628; Best Local Similarity 94.5%; Matches 1320; Conservative 0; Mismatches 77; Indels 0; Gaps 0; Qy 1 ATGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCTGCTGAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 168 ATGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCCGTGGATCCGTCGCCGGCTGCTGAA 227 Qy 61 ACCCGGCGGCGTGCAACCGGGAAAGGAGGCAAACAGCGCGGGGGCAAGCAACTAGGATTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 228 ACCCGGCGGCGTGCAACCGGGAAAGGAGGCAAACAGCGCGGGGGCAAGCAACTAGGATTG 287 Qy 121 AAGAGGCCGCCGCCGATTTCTGTCCCGGCCACCCCGCCTCCTGCTGCGACGTCTTCATCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 288 AAGAGGCCGCCGCCGATTTCTGTCCCGGCCACCCCGCCTCCTGCTGCGACGTCTTCATCC 347 Qy 181 CCTGCTGCGCCGACGGCCATCCCACCACGACCACCGCAATCTTCGCCGATTTTCGTCCCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 348 CCTGCTGCGCCGACGGCCATCCCACCACGACCACCGCAATCTTCGCCGATTTTCGTCCCC 407 Qy 241 GATTCGCCGAATCCGTCACCGGCTGCGCCGACCTCCTCTCTTGCTTCGGGGACATCGACG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 408 GATTCGCCGAATCCGTCACCGGCTGCGCCGACCTCCTCTCTTGCTTCGGGGACATCGACG 467 Qy 301 GCAAGGCCACCGCAACCACAAGGAGGAGGATGGGGACCAACATCGACCATTTCCCCAAAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 468 GCAAGGCCACCGCAACCACAAGGAGGAGGATGGGGACCAACATCGACCATTTCCCCAAAC 527 Qy 361 TTTGCATCTTTCTTTGGAAACCAACAAGACCCAAATTCATGTTTGGTCAGGGGTTATCCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 528 TTTGCATCTTTCTTTGGAAACCAACAAGACCCAAATTCATGTTTGGTCAGGGGTTATCCT 587 Qy 421 CCAGGAGGGTTTGTCAATTTTATTCAACAAAATTGTCCGCCGCAGCCACAACAGCAAGGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 588 CCAGGAGGGTTTGTCAATTTTATTCAACAAAATTGTCCGCCGCAGCCACAACAGCAAGGT 647 Qy 481 GAAAATTTTCATTTCGTTGGTCACAATATGGGGTTCAACCCAATATCTCCACAGCCACCA 540 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 648 GAAAATTTTCATTTCGTTGGTCACAATATGGGATTCAACCCAATATCTCCACAGCCACCA 707 Qy 541 AGTGCCTACGGAACACCAACACCCCAAGCTACGAACCAAGGCACTTCAACAAACATTATG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 708 AGTGCCTACGGAACACCAACACCCCAAGCTACGAACCAAGGCACTTCAACAAACATTATG 767 Qy 601 ATTGATGAAGAGGACAACAATGATGACAGTAGGGCAGCAAAGAAAAGATGGACTCATGAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 768 ATTGATGAAGAGGACAACAATGATGACAGTAGGGCAGCAAAGAAAAGATGGACTCATGAA 827 Qy 661 GAGGAAGAGAGACTGGCCAGTGCTTGGTTGAATGCTTCTAAAGACTCAATTCATGGGAAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 828 GAGGAAGAGAGACTGGCCAGTGCTTGGTTGAATGCTTCTAAAGACTCAATTCATGGGAAT 887 Qy 721 GATAAGAAAGGTGATACATTTTGGAAGGAAGTCACTGATGAATTTAACAAGAAAGGGAAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 888 GATAAGAAAGGTGATACATTTTGGAAGGAAGTCACTGATGAATTTAACAAGAAAGGGAAT 947 Qy 781 GGAAAACGTAGGAGGGAAATTAACCAACTGAAGGTTCACTGGTCAAGGTTGAAGTCAGCG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 948 GGAAAACGTAGGAGGGAAATTAACCAACTGAAGGTTCACTGGTCAAGGTTGAAGTCAGCG 1007 Qy 841 ATCTCTGAGTTCAATGACTATTGGAGTACGGTTACTCAAATGCATACAAGCGGATACTCA 900 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1008 ATCTCTGAGTTCAATGACTATTGGAGTACGGTTACTCAAATGCATACAAGCGGATACTCC 1067 Qy 901 GACGACATGCTTGAGAAAGAGGCACAGAGGCTGTATGCAAACAGGTTTGGAAAACCTTTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1068 GACGACATGCTTGAGAAAGAGGCACAGAGGCTGTATGCAAACAGGTTTGGAAAACCTTTT 1127 Qy 961 GCGTTGGTCCATTGGTGGAAGATACTCAAAAGAGAGCCCAAATGGTGTGCTCAGTTTGAA 1020 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1128 GCGTTGGTCCATTGGTGGAAGATACTCAAAGATGAGCCCAAATGGTGTGCTCAGTTTGAA 1187 Qy 1021 AAGAGGAAAAGGAAGAGCGAAATGGATGCTGTTCCAGAACAGCAGAAACGTCCTATTGGT 1080 |||| ||||||||||||||||||||||||||||||||| ||||||||||||| Db 1188 TCAGAGAAAGACAAGAGCGAAATGGATGCTGTTCCAGAACAGCAGTCACGTCCTATTGGT 1247 Qy 1081 AGAGAAGCAGCAAAGTCTGAGCGCAAAAGAAAGCGCAAGAAAGAAAATGTTATGGAAGGC 1140 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Db 1248 AGAGAAGCAGCAAAGTCTGAGCGCAATGGAAAGCGCAAGAAAGAAAATGTTATGGAAGGC 1307 Qy 1141 ATTGTCCTCCTAGGGGACAATGTCCAGAAAATTATCAAAGTGACGCAAGATCGGAAGCTG 1200 ||||||||||||||||||||||||||||||||||| || || |||| |||| | || Db 1308 ATTGTCCTCCTAGGGGACAATGTCCAGAAAATTATAAAGGTCCACGAAGACCGGAGGGTG 1367 Qy 1201 GAGCGTGAGAAGGTCACTGAAGCACAGATTCACATTTCAAACGTAAATTTGAAGGCAGCA 1260 || ||||| |||| ||| |||||||||||||| || ||||| | || ||| ||| || Db 1368 GATCGTGAAAAGGCCACCGAAGCACAGATTCAGATATCAAATGCAACATTGTTGGCCGCT 1427 Qy 1261 GAACAGCAAAAAGAAGCAAAGATGTTTGAGGTATACAATTCCCTGCTCACTCAAGATACA 1320 | |||| || |||||||||||||| || || |||||| | || | | | | |||||| Db 1428 AAGGAGCAGAAGGAAGCAAAGATGTTCGATGTGTACAATACTCTATTAAGTAAGGATACA 1487 Qy 1321 AGTAACATGTCTGAAGAACAGAAGGCTCGCCGAGACAAGGCATTACAAAAGCTGGAGGAA 1380 || |||||||||||||| || | |||| ||| | | |||| ||| || | ||||| Db 1488 AGCAACATGTCTGAAGATCAAATGGCTAGCCACCAGAGGGCAATACGGAAATTAGAGGAG 1547 Qy 1381 AAGTTATTTGCTGACTA 1397 ||| ||||||| || || Db 1548 AAGCTATTTGCGGATTA 1564 Sequence 27845, US/10437963 Publication No. US200110131679A2 Alignment Scores: Length: 1344 Score: 2346.00 Matches: 445 Percent Similarity: 99.6% Conservative: 0 Best Local Similarity: 99.6% Mismatches: 2 Query Match: 93.2% Indels: 0 Gaps: 0 US-18-282-139-3 (1-482) x US-10-437-963-27845 (1-1344) Qy 36 MetSerGluGlnAsnThrAspGlySerGlnValProValAsnLeuLeuAspGluPheLeu 55 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTCTGAGCAAAATACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTG 60 Qy 56 AlaGluAspGluIleIleAspAspLeuLeuThrGluAlaThrValValValGlnSerThr 75 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GCTGAGGATGAGATCATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACT 120 Qy 76 IleGluGlyLeuGlnAsnGluAlaSerAspHisArgHisHisProArgLysHisIleLys 95 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATAGAAGGTCTTCAAAACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAG 180 Qy 96 ArgProArgGluGluAlaHisGlnGlnLeuValAsnAspTyrPheSerGluAsnProLeu 115 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AGGCCACGAGAGGAAGCACATCAGCAACTAGTGAATGATTACTTTTCAGAAAATCCTCTT 240 Qy 116 TyrProSerLysIlePheArgArgArgPheArgMetSerArgProLeuPheLeuArgIle 135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TACCCTTCCAAAATTTTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATC 300 Qy 136 ValGluAlaLeuGlyGlnTrpSerValTyrPheThrGlnArgValAspAlaValAsnArg 155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTTGAGGCATTAGGCCAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGG 360 Qy 156 LysGlyLeuSerProLeuGlnLysCysThrAlaAlaIleArgGlnLeuAlaThrGlySer 175 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AAAGGACTCAGTCCACTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGT 420 Qy 176 GlyAlaAspGluLeuAspGluTyrLeuLysIleGlyGluThrThrAlaMetGluAlaMet 195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GGCGCAGATGAACTAGATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATG 480 Qy 196 LysAsnPheValLysGlyLeuGlnAspValPheGlyGluArgTyrLeuArgArgProThr 215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AAGAATTTTGTCAAAGGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACC 540 Qy 216 MetGluAspThrGluArgLeuLeuGlnLeuGlyGluLysArgGlyPheProGlyMetPhe 235 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATGGAAGATACCGAACGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTC 600 Qy 236 GlySerIleAspCysMetHisTrpHisTrpGluArgCysProValAlaTrpLysGlyGln 255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GGCAGCATTGACTGCATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAG 660 Qy 256 PheThrArgGlyAspGlnLysValProThrLeuIleLeuGluAlaValAlaSerHisAsp 275 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TTCACTCGTGGAGATCAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGAT 720 Qy 276 LeuTrpIleTrpHisAlaPhePheGlyAlaAlaGlySerAsnAsnAspIleAsnValLeu 295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTTTGGATTTGGCATGCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTG 780 Qy 296 AsnGlnSerThrValPheIleLysGluLeuLysGlyGlnAlaProArgValGlnTyrMet 315 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 AACCAATCTACTGTATTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATG 840 Qy 316 ValAsnGlyAsnGlnTyrAsnThrGlyTyrPheLeuAlaAspGlyIleTyrProGluTrp 335 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GTAAATGGGAATCAATACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGG 900 Qy 336 AlaValPheValLysSerIleArgLeuProAsnThrGluLysGluLysLeuTyrAlaAsp 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GCAGTGTTTGTTAAGTCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGAT 960 Qy 356 MetGlnGluGlyAlaArgLysAspIleGluArgAlaPheGlyValLeuGlnArgArgPhe 375 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGCAAGAAGGGGCAAGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTT 1020 Qy 376 CysIleLeuLysArgProAlaArgLeuTyrAspArgGlyValLeuArgAspValValLeu 395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TGCATCTTAAAACGACCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTA 1080 Qy 396 AlaCysIleIleLeuHisAsnMetIleValGluAspGluLysGluThrArgIleIleGlu 415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GCTTGCATCATACTTCACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAA 1140 Qy 416 GluAspAlaAspAlaAsnValProProSerSerSerThrValGlnGluProGluPheSer 435 |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAAGATTTAGATCTAAATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCT 1200 Qy 436 ProGluGlnAsnThrProPheAspArgValLeuGluLysAspIleSerIleArgAspArg 455 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CCTGAACAGAACACACCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGA 1260 Qy 456 AlaAlaHisAsnArgLeuLysLysAspLeuValGluHisIleTrpAsnLysPheGlyGly 475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCGGCTCATAACCGACTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGT 1320 Qy 476 AlaAlaHisArgThrGlyAsn 482 ||||||||||||||||||||| Db 1321 GCTGCACATAGAACTGGAAAT 1341 Sequence 27845, US/10437963 Publication No. US20110131679A2 Query Match 92.1%; Score 1331.4; Length 1344; Best Local Similarity 99.6%; Matches 1335; Conservative 0; Mismatches 6; Indels 0; Gaps 0; Qy 106 ATGTCTGAGCAAAATACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTG 165 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTCTGAGCAAAATACTGATGGAAGTCAAGTTCCAGTGAACTTGTTGGATGAGTTCCTG 60 Qy 166 GCTGAGGATGAGATCATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACT 225 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GCTGAGGATGAGATCATAGATGATCTTCTCACTGAAGCCACGGTGGTAGTACAGTCCACT 120 Qy 226 ATAGAAGGTCTTCAAAACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAG 285 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATAGAAGGTCTTCAAAACGAGGCTTCTGACCATCGACATCATCCGAGGAAGCACATCAAG 180 Qy 286 AGGCCACGAGAGGAAGCACATCAGCAACTGGTGAATGATTACTTTTCAGAAAATCCTCTT 345 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 181 AGGCCACGAGAGGAAGCACATCAGCAACTAGTGAATGATTACTTTTCAGAAAATCCTCTT 240 Qy 346 TACCCTTCCAAAATTTTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATC 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TACCCTTCCAAAATTTTTCGTCGAAGATTTCGTATGTCTAGGCCACTTTTTCTTCGCATC 300 Qy 406 GTTGAGGCATTAGGCCAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGG 465 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTTGAGGCATTAGGCCAGTGGTCAGTGTATTTCACACAAAGGGTGGATGCTGTTAATCGG 360 Qy 466 AAAGGACTCAGTCCACTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGT 525 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AAAGGACTCAGTCCACTGCAAAAGTGTACTGCAGCTATTCGCCAGTTGGCTACTGGTAGT 420 Qy 526 GGCGCAGATGAACTAGATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATG 585 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GGCGCAGATGAACTAGATGAATATCTGAAGATAGGAGAGACTACAGCAATGGAGGCAATG 480 Qy 586 AAGAATTTTGTCAAAGGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACT 645 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AAGAATTTTGTCAAAGGTCTTCAAGATGTGTTTGGTGAGAGGTATCTTAGGCGCCCCACC 540 Qy 646 ATGGAAGATACCGAACGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTC 705 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATGGAAGATACCGAACGGCTTCTCCAACTTGGTGAGAAACGTGGTTTTCCTGGAATGTTC 600 Qy 706 GGCAGCATTGACTGCATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAG 765 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GGCAGCATTGACTGCATGCACTGGCATTGGGAAAGATGCCCAGTAGCATGGAAGGGTCAG 660 Qy 766 TTCACTCGTGGAGATCAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGAT 825 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TTCACTCGTGGAGATCAGAAAGTGCCAACCCTGATTCTTGAGGCTGTGGCATCGCATGAT 720 Qy 826 CTTTGGATTTGGCATGCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTG 885 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTTTGGATTTGGCATGCATTTTTTGGAGCAGCGGGTTCCAACAATGATATCAATGTATTG 780 Qy 886 AACCAATCTACTGTATTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATG 945 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 AACCAATCTACTGTATTTATCAAGGAGCTCAAAGGACAAGCTCCTAGAGTCCAGTACATG 840 Qy 946 GTAAATGGGAATCAATACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGG 1005 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GTAAATGGGAATCAATACAATACTGGGTATTTTCTTGCTGATGGAATCTACCCTGAATGG 900 Qy 1006 GCAGTGTTTGTTAAGTCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGAT 1065 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GCAGTGTTTGTTAAGTCAATACGACTCCCAAACACTGAAAAGGAGAAATTGTATGCAGAT 960 Qy 1066 ATGCAAGAAGGGGCAAGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTT 1125 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGCAAGAAGGGGCAAGAAAAGATATCGAGAGAGCCTTTGGTGTATTGCAGCGAAGATTT 1020 Qy 1126 TGCATCTTAAAACGACCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTA 1185 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TGCATCTTAAAACGACCAGCTCGTCTATATGATCGAGGTGTACTGCGAGATGTTGTTCTA 1080 Qy 1186 GCTTGCATCATACTTCACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAA 1245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GCTTGCATCATACTTCACAATATGATAGTTGAAGATGAGAAGGAAACCAGAATTATTGAA 1140 Qy 1246 GAAGATGCAGATGCAAATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCT 1305 |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAAGATTTAGATCTAAATGTGCCTCCTAGTTCATCAACCGTTCAGGAACCTGAGTTCTCT 1200 Qy 1306 CCTGAACAGAACACACCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGA 1365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CCTGAACAGAACACACCATTTGATAGAGTTTTAGAAAAAGATATTTCTATCCGAGATCGA 1260 Qy 1366 GCGGCTCATAACCGACTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGT 1425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCGGCTCATAACCGACTTAAGAAAGATTTGGTGGAACACATTTGGAATAAGTTTGGTGGT 1320 Qy 1426 GCTGCACATAGAACTGGAAAT 1446 ||||||||||||||||||||| Db 1321 GCTGCACATAGAACTGGAAAT 1341 Sequence 4, US/15546481B Patent No. 11421241 OTHER INFORMATION: Cas9 sequence of pHSN411-C1 Query Match 100.0%; Score 4200; Length 4272; Best Local Similarity 100.0%; Matches 4200; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCTCCGAAGAAGAAGAGGAAGGTTGGCATCCACGGGGTGCCAGCTGCTGACAAGAAGTAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 73 GCTCCGAAGAAGAAGAGGAAGGTTGGCATCCACGGGGTGCCAGCTGCTGACAAGAAGTAC 132 Qy 61 TCGATCGGCCTCGATATTGGGACTAACTCTGTTGGCTGGGCCGTGATCACCGACGAGTAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 133 TCGATCGGCCTCGATATTGGGACTAACTCTGTTGGCTGGGCCGTGATCACCGACGAGTAC 192 Qy 121 AAGGTGCCCTCAAAGAAGTTCAAGGTCCTGGGCAACACCGATCGGCATTCCATCAAGAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 193 AAGGTGCCCTCAAAGAAGTTCAAGGTCCTGGGCAACACCGATCGGCATTCCATCAAGAAG 252 Qy 181 AATCTCATTGGCGCTCTCCTGTTCGACAGCGGCGAGACGGCTGAGGCTACGCGGCTCAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 253 AATCTCATTGGCGCTCTCCTGTTCGACAGCGGCGAGACGGCTGAGGCTACGCGGCTCAAG 312 Qy 241 CGCACCGCCCGCAGGCGGTACACGCGCAGGAAGAATCGCATCTGCTACCTGCAGGAGATT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 313 CGCACCGCCCGCAGGCGGTACACGCGCAGGAAGAATCGCATCTGCTACCTGCAGGAGATT 372 Qy 301 TTCTCCAACGAGATGGCGAAGGTTGACGATTCTTTCTTCCACAGGCTGGAGGAGTCATTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 373 TTCTCCAACGAGATGGCGAAGGTTGACGATTCTTTCTTCCACAGGCTGGAGGAGTCATTC 432 Qy 361 CTCGTGGAGGAGGATAAGAAGCACGAGCGGCATCCAATCTTCGGCAACATTGTCGACGAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 433 CTCGTGGAGGAGGATAAGAAGCACGAGCGGCATCCAATCTTCGGCAACATTGTCGACGAG 492 Qy 421 GTTGCCTACCACGAGAAGTACCCTACGATCTACCATCTGCGGAAGAAGCTCGTGGACTCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 493 GTTGCCTACCACGAGAAGTACCCTACGATCTACCATCTGCGGAAGAAGCTCGTGGACTCC 552 Qy 481 ACAGATAAGGCGGACCTCCGCCTGATCTACCTCGCTCTGGCCCACATGATTAAGTTCAGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 553 ACAGATAAGGCGGACCTCCGCCTGATCTACCTCGCTCTGGCCCACATGATTAAGTTCAGG 612 Qy 541 GGCCATTTCCTGATCGAGGGGGATCTCAACCCGGACAATAGCGATGTTGACAAGCTGTTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 613 GGCCATTTCCTGATCGAGGGGGATCTCAACCCGGACAATAGCGATGTTGACAAGCTGTTC 672 Qy 601 ATCCAGCTCGTGCAGACGTACAACCAGCTCTTCGAGGAGAACCCCATTAATGCGTCAGGC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 673 ATCCAGCTCGTGCAGACGTACAACCAGCTCTTCGAGGAGAACCCCATTAATGCGTCAGGC 732 Qy 661 GTCGACGCGAAGGCTATCCTGTCCGCTAGGCTCTCGAAGTCTCGGCGCCTCGAGAACCTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 733 GTCGACGCGAAGGCTATCCTGTCCGCTAGGCTCTCGAAGTCTCGGCGCCTCGAGAACCTG 792 Qy 721 ATCGCCCAGCTGCCGGGCGAGAAGAAGAACGGCCTGTTCGGGAATCTCATTGCGCTCAGC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 793 ATCGCCCAGCTGCCGGGCGAGAAGAAGAACGGCCTGTTCGGGAATCTCATTGCGCTCAGC 852 Qy 781 CTGGGGCTCACGCCCAACTTCAAGTCGAATTTCGATCTCGCTGAGGACGCCAAGCTGCAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 853 CTGGGGCTCACGCCCAACTTCAAGTCGAATTTCGATCTCGCTGAGGACGCCAAGCTGCAG 912 Qy 841 CTCTCCAAGGACACATACGACGATGACCTGGATAACCTCCTGGCCCAGATCGGCGATCAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 913 CTCTCCAAGGACACATACGACGATGACCTGGATAACCTCCTGGCCCAGATCGGCGATCAG 972 Qy 901 TACGCGGACCTGTTCCTCGCTGCCAAGAATCTGTCGGACGCCATCCTCCTGTCTGATATT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 973 TACGCGGACCTGTTCCTCGCTGCCAAGAATCTGTCGGACGCCATCCTCCTGTCTGATATT 1032 Qy 961 CTCAGGGTGAACACCGAGATTACGAAGGCTCCGCTCTCAGCCTCCATGATCAAGCGCTAC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1033 CTCAGGGTGAACACCGAGATTACGAAGGCTCCGCTCTCAGCCTCCATGATCAAGCGCTAC 1092 Qy 1021 GACGAGCACCATCAGGATCTGACCCTCCTGAAGGCGCTGGTCAGGCAGCAGCTCCCCGAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1093 GACGAGCACCATCAGGATCTGACCCTCCTGAAGGCGCTGGTCAGGCAGCAGCTCCCCGAG 1152 Qy 1081 AAGTACAAGGAGATCTTCTTCGATCAGTCGAAGAACGGCTACGCTGGGTACATTGACGGC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1153 AAGTACAAGGAGATCTTCTTCGATCAGTCGAAGAACGGCTACGCTGGGTACATTGACGGC 1212 Qy 1141 GGGGCCTCTCAGGAGGAGTTCTACAAGTTCATCAAGCCGATTCTGGAGAAGATGGACGGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1213 GGGGCCTCTCAGGAGGAGTTCTACAAGTTCATCAAGCCGATTCTGGAGAAGATGGACGGC 1272 Qy 1201 ACGGAGGAGCTGCTGGTGAAGCTCAATCGCGAGGACCTCCTGAGGAAGCAGCGGACATTC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1273 ACGGAGGAGCTGCTGGTGAAGCTCAATCGCGAGGACCTCCTGAGGAAGCAGCGGACATTC 1332 Qy 1261 GATAACGGCAGCATCCCACACCAGATTCATCTCGGGGAGCTGCACGCTATCCTGAGGAGG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1333 GATAACGGCAGCATCCCACACCAGATTCATCTCGGGGAGCTGCACGCTATCCTGAGGAGG 1392 Qy 1321 CAGGAGGACTTCTACCCTTTCCTCAAGGATAACCGCGAGAAGATCGAGAAGATTCTGACT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1393 CAGGAGGACTTCTACCCTTTCCTCAAGGATAACCGCGAGAAGATCGAGAAGATTCTGACT 1452 Qy 1381 TTCAGGATCCCGTACTACGTCGGCCCACTCGCTAGGGGCAACTCCCGCTTCGCTTGGATG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1453 TTCAGGATCCCGTACTACGTCGGCCCACTCGCTAGGGGCAACTCCCGCTTCGCTTGGATG 1512 Qy 1441 ACCCGCAAGTCAGAGGAGACGATCACGCCGTGGAACTTCGAGGAGGTGGTCGACAAGGGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1513 ACCCGCAAGTCAGAGGAGACGATCACGCCGTGGAACTTCGAGGAGGTGGTCGACAAGGGC 1572 Qy 1501 GCTAGCGCTCAGTCGTTCATCGAGAGGATGACGAATTTCGACAAGAACCTGCCAAATGAG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1573 GCTAGCGCTCAGTCGTTCATCGAGAGGATGACGAATTTCGACAAGAACCTGCCAAATGAG 1632 Qy 1561 AAGGTGCTCCCTAAGCACTCGCTCCTGTACGAGTACTTCACAGTCTACAACGAGCTGACT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1633 AAGGTGCTCCCTAAGCACTCGCTCCTGTACGAGTACTTCACAGTCTACAACGAGCTGACT 1692 Qy 1621 AAGGTGAAGTATGTGACCGAGGGCATGAGGAAGCCGGCTTTCCTGTCTGGGGAGCAGAAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1693 AAGGTGAAGTATGTGACCGAGGGCATGAGGAAGCCGGCTTTCCTGTCTGGGGAGCAGAAG 1752 Qy 1681 AAGGCCATCGTGGACCTCCTGTTCAAGACCAACCGGAAGGTCACGGTTAAGCAGCTCAAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1753 AAGGCCATCGTGGACCTCCTGTTCAAGACCAACCGGAAGGTCACGGTTAAGCAGCTCAAG 1812 Qy 1741 GAGGACTACTTCAAGAAGATTGAGTGCTTCGATTCGGTCGAGATCTCTGGCGTTGAGGAC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1813 GAGGACTACTTCAAGAAGATTGAGTGCTTCGATTCGGTCGAGATCTCTGGCGTTGAGGAC 1872 Qy 1801 CGCTTCAACGCCTCCCTGGGGACCTACCACGATCTCCTGAAGATCATTAAGGATAAGGAC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1873 CGCTTCAACGCCTCCCTGGGGACCTACCACGATCTCCTGAAGATCATTAAGGATAAGGAC 1932 Qy 1861 TTCCTGGACAACGAGGAGAATGAGGATATCCTCGAGGACATTGTGCTGACACTCACTCTG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1933 TTCCTGGACAACGAGGAGAATGAGGATATCCTCGAGGACATTGTGCTGACACTCACTCTG 1992 Qy 1921 TTCGAGGACCGGGAGATGATCGAGGAGCGCCTGAAGACTTACGCCCATCTCTTCGATGAC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1993 TTCGAGGACCGGGAGATGATCGAGGAGCGCCTGAAGACTTACGCCCATCTCTTCGATGAC 2052 Qy 1981 AAGGTCATGAAGCAGCTCAAGAGGAGGAGGTACACCGGCTGGGGGAGGCTGAGCAGGAAG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2053 AAGGTCATGAAGCAGCTCAAGAGGAGGAGGTACACCGGCTGGGGGAGGCTGAGCAGGAAG 2112 Qy 2041 CTCATCAACGGCATTCGGGACAAGCAGTCCGGGAAGACGATCCTCGACTTCCTGAAGAGC 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2113 CTCATCAACGGCATTCGGGACAAGCAGTCCGGGAAGACGATCCTCGACTTCCTGAAGAGC 2172 Qy 2101 GATGGCTTCGCGAACCGCAATTTCATGCAGCTGATTCACGATGACAGCCTCACATTCAAG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2173 GATGGCTTCGCGAACCGCAATTTCATGCAGCTGATTCACGATGACAGCCTCACATTCAAG 2232 Qy 2161 GAGGATATCCAGAAGGCTCAGGTGAGCGGCCAGGGGGACTCGCTGCACGAGCATATCGCG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2233 GAGGATATCCAGAAGGCTCAGGTGAGCGGCCAGGGGGACTCGCTGCACGAGCATATCGCG 2292 Qy 2221 AACCTCGCTGGCTCGCCAGCTATCAAGAAGGGGATTCTGCAGACCGTGAAGGTTGTGGAC 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2293 AACCTCGCTGGCTCGCCAGCTATCAAGAAGGGGATTCTGCAGACCGTGAAGGTTGTGGAC 2352 Qy 2281 GAGCTGGTGAAGGTCATGGGCAGGCACAAGCCTGAGAACATCGTCATTGAGATGGCCCGG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2353 GAGCTGGTGAAGGTCATGGGCAGGCACAAGCCTGAGAACATCGTCATTGAGATGGCCCGG 2412 Qy 2341 GAGAATCAGACCACGCAGAAGGGCCAGAAGAACTCACGCGAGAGGATGAAGAGGATCGAG 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2413 GAGAATCAGACCACGCAGAAGGGCCAGAAGAACTCACGCGAGAGGATGAAGAGGATCGAG 2472 Qy 2401 GAGGGCATTAAGGAGCTGGGGTCCCAGATCCTCAAGGAGCACCCGGTGGAGAACACGCAG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2473 GAGGGCATTAAGGAGCTGGGGTCCCAGATCCTCAAGGAGCACCCGGTGGAGAACACGCAG 2532 Qy 2461 CTGCAGAATGAGAAGCTCTACCTGTACTACCTCCAGAATGGCCGCGATATGTATGTGGAC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2533 CTGCAGAATGAGAAGCTCTACCTGTACTACCTCCAGAATGGCCGCGATATGTATGTGGAC 2592 Qy 2521 CAGGAGCTGGATATTAACAGGCTCAGCGATTACGACGTCGATCATATCGTTCCACAGTCA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2593 CAGGAGCTGGATATTAACAGGCTCAGCGATTACGACGTCGATCATATCGTTCCACAGTCA 2652 Qy 2581 TTCCTGAAGGATGACTCCATTGACAACAAGGTCCTCACCAGGTCGGACAAGAACCGGGGC 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2653 TTCCTGAAGGATGACTCCATTGACAACAAGGTCCTCACCAGGTCGGACAAGAACCGGGGC 2712 Qy 2641 AAGTCTGATAATGTTCCTTCAGAGGAGGTCGTTAAGAAGATGAAGAACTACTGGCGCCAG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2713 AAGTCTGATAATGTTCCTTCAGAGGAGGTCGTTAAGAAGATGAAGAACTACTGGCGCCAG 2772 Qy 2701 CTCCTGAATGCCAAGCTGATCACGCAGCGGAAGTTCGATAACCTCACAAAGGCTGAGAGG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2773 CTCCTGAATGCCAAGCTGATCACGCAGCGGAAGTTCGATAACCTCACAAAGGCTGAGAGG 2832 Qy 2761 GGCGGGCTCTCTGAGCTGGACAAGGCGGGCTTCATCAAGAGGCAGCTGGTCGAGACACGG 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2833 GGCGGGCTCTCTGAGCTGGACAAGGCGGGCTTCATCAAGAGGCAGCTGGTCGAGACACGG 2892 Qy 2821 CAGATCACTAAGCACGTTGCGCAGATTCTCGACTCACGGATGAACACTAAGTACGATGAG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2893 CAGATCACTAAGCACGTTGCGCAGATTCTCGACTCACGGATGAACACTAAGTACGATGAG 2952 Qy 2881 AATGACAAGCTGATCCGCGAGGTGAAGGTCATCACCCTGAAGTCAAAGCTCGTCTCCGAC 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2953 AATGACAAGCTGATCCGCGAGGTGAAGGTCATCACCCTGAAGTCAAAGCTCGTCTCCGAC 3012 Qy 2941 TTCAGGAAGGATTTCCAGTTCTACAAGGTTCGGGAGATCAACAATTACCACCATGCCCAT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3013 TTCAGGAAGGATTTCCAGTTCTACAAGGTTCGGGAGATCAACAATTACCACCATGCCCAT 3072 Qy 3001 GACGCGTACCTGAACGCGGTGGTCGGCACAGCTCTGATCAAGAAGTACCCAAAGCTCGAG 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3073 GACGCGTACCTGAACGCGGTGGTCGGCACAGCTCTGATCAAGAAGTACCCAAAGCTCGAG 3132 Qy 3061 AGCGAGTTCGTGTACGGGGACTACAAGGTTTACGATGTGAGGAAGATGATCGCCAAGTCG 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3133 AGCGAGTTCGTGTACGGGGACTACAAGGTTTACGATGTGAGGAAGATGATCGCCAAGTCG 3192 Qy 3121 GAGCAGGAGATTGGCAAGGCTACCGCCAAGTACTTCTTCTACTCTAACATTATGAATTTC 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3193 GAGCAGGAGATTGGCAAGGCTACCGCCAAGTACTTCTTCTACTCTAACATTATGAATTTC 3252 Qy 3181 TTCAAGACAGAGATCACTCTGGCCAATGGCGAGATCCGGAAGCGCCCCCTCATCGAGACG 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3253 TTCAAGACAGAGATCACTCTGGCCAATGGCGAGATCCGGAAGCGCCCCCTCATCGAGACG 3312 Qy 3241 AACGGCGAGACGGGGGAGATCGTGTGGGACAAGGGCAGGGATTTCGCGACCGTCAGGAAG 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3313 AACGGCGAGACGGGGGAGATCGTGTGGGACAAGGGCAGGGATTTCGCGACCGTCAGGAAG 3372 Qy 3301 GTTCTCTCCATGCCACAAGTGAATATCGTCAAGAAGACAGAGGTCCAGACTGGCGGGTTC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3373 GTTCTCTCCATGCCACAAGTGAATATCGTCAAGAAGACAGAGGTCCAGACTGGCGGGTTC 3432 Qy 3361 TCTAAGGAGTCAATTCTGCCTAAGCGGAACAGCGACAAGCTCATCGCCCGCAAGAAGGAC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3433 TCTAAGGAGTCAATTCTGCCTAAGCGGAACAGCGACAAGCTCATCGCCCGCAAGAAGGAC 3492 Qy 3421 TGGGATCCGAAGAAGTACGGCGGGTTCGACAGCCCCACTGTGGCCTACTCGGTCCTGGTT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3493 TGGGATCCGAAGAAGTACGGCGGGTTCGACAGCCCCACTGTGGCCTACTCGGTCCTGGTT 3552 Qy 3481 GTGGCGAAGGTTGAGAAGGGCAAGTCCAAGAAGCTCAAGAGCGTGAAGGAGCTGCTGGGG 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3553 GTGGCGAAGGTTGAGAAGGGCAAGTCCAAGAAGCTCAAGAGCGTGAAGGAGCTGCTGGGG 3612 Qy 3541 ATCACGATTATGGAGCGCTCCAGCTTCGAGAAGAACCCGATCGATTTCCTGGAGGCGAAG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3613 ATCACGATTATGGAGCGCTCCAGCTTCGAGAAGAACCCGATCGATTTCCTGGAGGCGAAG 3672 Qy 3601 GGCTACAAGGAGGTGAAGAAGGACCTGATCATTAAGCTCCCCAAGTACTCACTCTTCGAG 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3673 GGCTACAAGGAGGTGAAGAAGGACCTGATCATTAAGCTCCCCAAGTACTCACTCTTCGAG 3732 Qy 3661 CTGGAGAACGGCAGGAAGCGGATGCTGGCTTCCGCTGGCGAGCTGCAGAAGGGGAACGAG 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3733 CTGGAGAACGGCAGGAAGCGGATGCTGGCTTCCGCTGGCGAGCTGCAGAAGGGGAACGAG 3792 Qy 3721 CTGGCTCTGCCGTCCAAGTATGTGAACTTCCTCTACCTGGCCTCCCACTACGAGAAGCTC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3793 CTGGCTCTGCCGTCCAAGTATGTGAACTTCCTCTACCTGGCCTCCCACTACGAGAAGCTC 3852 Qy 3781 AAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTCGAGCAGCACAAGCATTAC 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3853 AAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTCGAGCAGCACAAGCATTAC 3912 Qy 3841 CTCGACGAGATCATTGAGCAGATTTCCGAGTTCTCCAAGCGCGTGATCCTGGCCGACGCG 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3913 CTCGACGAGATCATTGAGCAGATTTCCGAGTTCTCCAAGCGCGTGATCCTGGCCGACGCG 3972 Qy 3901 AATCTGGATAAGGTCCTCTCCGCGTACAACAAGCACCGCGACAAGCCAATCAGGGAGCAG 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3973 AATCTGGATAAGGTCCTCTCCGCGTACAACAAGCACCGCGACAAGCCAATCAGGGAGCAG 4032 Qy 3961 GCTGAGAATATCATTCATCTCTTCACCCTGACGAACCTCGGCGCCCCTGCTGCTTTCAAG 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4033 GCTGAGAATATCATTCATCTCTTCACCCTGACGAACCTCGGCGCCCCTGCTGCTTTCAAG 4092 Qy 4021 TACTTCGACACAACTATCGATCGCAAGAGGTACACAAGCACTAAGGAGGTCCTGGACGCG 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4093 TACTTCGACACAACTATCGATCGCAAGAGGTACACAAGCACTAAGGAGGTCCTGGACGCG 4152 Qy 4081 ACCCTCATCCACCAGTCGATTACCGGCCTCTACGAGACGCGCATCGACCTGTCTCAGCTC 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4153 ACCCTCATCCACCAGTCGATTACCGGCCTCTACGAGACGCGCATCGACCTGTCTCAGCTC 4212 Qy 4141 GGGGGCGACAAGCGGCCAGCGGCGACGAAGAAGGCGGGGCAGGCGAAGAAGAAGAAGTGA 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4213 GGGGGCGACAAGCGGCCAGCGGCGACGAAGAAGGCGGGGCAGGCGAAGAAGAAGAAGTGA 4272 Sequence 3, US/10346198 Patent No. 7250556 Query Match 100.0%; Score 12; Length 430; Best Local Similarity 100.0%; Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGCCAGTCACAA 12 |||||||||||| Db 1 GGCCAGTCACAA 12 Sequence 3, US/10346198 Patent No. 7250556 Query Match 100.0%; Score 12; Length 430; Best Local Similarity 100.0%; Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTGTGACTGGCC 12 |||||||||||| Db 419 TTGTGACTGGCC 430
Read full office action

Prosecution Timeline

Sep 14, 2023
Application Filed
Aug 19, 2026
Non-Final Rejection mailed — §103, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12697350
METHODS AND COMPOSITIONS FOR TREATING A PREMATURE TERMINATION CODON-MEDIATED DISORDER
4y 3m to grant Granted Aug 04, 2026
Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.6%)
4y 0m (~1y 0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 750 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month