DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-4, 7-8 and 11-20 are pending.
Claims 11-20 are withdrawn by the Applicant and withdrawn from examination as being part of non-elected inventions.
Claims 1-4 and 7-8 are being examined.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
There are browser-executable codes/links in page 43, line 13; page 53, line 23, line 27; page 54, line 12.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4 and 7-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites the limitation "said marker" in line 8. There are three markers recited before the recitation of the “said marker”. Moreover, claims 2-4 and 8, which depend from claim 1, also recite “the genetic marker” in line 1. It is not clear to the Examiner which of the three markers recited in claim 1 are referred to by the “said marker” in claim 1 or “the genetic marker” in claims 2-4 and 8.
For compact prosecution and as a courtesy to the Applicant, the Examiner interprets the “said marker” and “the genetic marker” to imply the first genetic marker (in line 4 of claim 1), which is, hereafter, referred as “1st marker” while the two other markers flanking the 1st marker are being referred as 2nd and 3rd marker.
Claims 7-8 recites, “… chromosome 2 at 83660977-84353662 bp”. It is not clear what is the reference sequence specific to this physical position in chromosome 2. It is noted that numbering based on physical location is not the same for chromo 2 of all species of Cannabis.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 1-4 and 7-8 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 is broadly drawn to a method for creating a population of Cannabis plants with enhanced powdery mildew resistance, the method comprising: a) providing a first population of Cannabis plants; b) detecting the presence of a genetic marker (1st marker) linked to a powdery mildew resistance locus on chromosome 2 and flanked by two other markers (2nd and 3rd marker); c) selecting one or more Cannabis plants containing the said marker (1st marker) from the first population of Cannabis plants; and d) producing a population of offspring from at least one of said selected Cannabis plants.
The Applicant describes many genetic markers (Fig. 4 and Fig. 5) including marker 219 in Fig. 5I. However, the allelic forms associated with enhanced powdery mildew resistance are not described even for marker 219. Marker 219 has the following sequence: CAGAAACCGATAAACGAATTAAAAGAGCAAGAAGAAGAAGAAACCCTAAA [T/C] TGAGTTGAAGAGAGTTTTTGTAGTGATTAAAATATGCCATTGTTTGATAT. Instant description does not indicate which allele (the one having a T or the one having C at position 51) confers enhanced powdery mildew resistance.
The Applicant does not claim the necessary SNP(s)/allele(s) associated with the particular markers and haplotypes associated with enhanced powdery mildew resistance. The Applicant also does not disclose a structure responsible with respect to the markers and alleles as to accomplish the instantly claimed function of enhanced powdery mildew resistance.
Accordingly, the claims are drawn to an extremely large genus of markers including SNPs encompassing any possible yet unspecified alleles associated with the claimed phenotype of enhanced powdery mildew resistance, when the Applicant has not reduced to practice a single allele/gene aligned with at least one specific marker in the 692,685 nucleotide (approximately 7 kb) long region in chromosome 2 at 83660977-84353662 bp (in claims 7-8), and which is associated with the claimed phenotype. It is more than likely that the long region in chromosome 2 comprises many genes. It is noted, however, that 1 centimorgan (cM) does not represent a fixed number of nucleotides because it is a measure of recombination frequency, not physical length. However, based on studies estimating a cannabis genome to be approximately 800–900 Mb (Braich et al., A new and improved genome sequence of Cannabis sativa, 2020, Gigabyte, 1–13; abstract), on average 1 cM roughly corresponds to 200-1000 kb or even more, depending on the region of the chromosome. (The range increases significantly around chromosomal regions with low recombination frequency, e.g., around heterochromatin regions and regions with repetitive sequences.) Thus, 5-20 cM (as recited in claims 1-4) would correspond to a long stretch of the chromosome spanning anywhere from 1000 kb to 20,000 kb, or may be even more.
Given the Applicant has provided very vague description of the method steps or structures that would link a myriad of unspecified markers which are determinants of Cannabis plants comprising in their genomes an enhanced powdery mildew resistance locus, it remains unclear what features or method steps are capable of performing the claimed function. All the markers listed are within the (approximately) 7 kb long region (from 83660977 to 84353662 bp) in the chromosome. The Specification fails to provide an adequate written description to support the breadth of the claims.
Considering the breadth of the claims, lack of representative species of the broad genus claimed, lack of structure function relationship of the broad genus claimed, and unpredictability of the art, the Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-4 and 7-8 are rejected under 35 U.S.C. 103 as being unpatentable over McKernan et al. (Sequence and annotation of 42 cannabis genomes reveals extensive copy number variation in cannabinoid synthesis and pathogen resistance genes, 2020, bioRxiv 2020.01.03.894428) in view of Braich et al. (A new and improved genome sequence of Cannabis sativa, 2020, Gigabyte, 1–13) and in evidence of Bakloushinskaya, I.Y. (Chromosomal Rearrangements, Genome Reorganization, and Speciation, 2016, Biology Bulletin, 43:759–775).
Claim 1 is drawn to a method of a method for creating a population of Cannabis plants with enhanced powdery mildew resistance by detecting the presence of a genetic marker linked within 20 cM or less to a powdery mildew resistance locus in Chromosome 2 and producing a population of offspring from at least one of said selected Cannabis plants.
McKernan et al. describes that identification of the genetic basis of powdery mildew (PM) resistance can lead to more targeted breeding, increased yields and reduced employee allergen exposure (page 13, para 1, line 6-8). McKernan et al. also describes 82 genes in Cannabis which are associated with powdery mildew resistance (abstract).
McKernan et al. describes one of the loci involved in powdery mildew resistance is Mildew resistance Loci O (MLO) (page 13, last para, line 6). Many MLO genes are described by McKernan et al. (page 14, Fig 6A) including 24 MLO genes that were found in 40 cannabis cultivars (page 14, Fig. 6A) including Jamaican Lion (JL) reference genome (page 16, para 2, line 1-2). A search in the GenBank database identified several MLO genes in various Cannabis strains published before the effective filing date of the invention. One such MLO gene in Cannabis sativa encodes an MLO protein (MLO6) (GenBank accession no. XP_030504631; published on 1 May 2020). The gene (Gene ID: 115719652) is located at position 89,490,974 to 89,500,740 in chromosome 2. The location of the MLO6 gene is interpreted as within 5 cM of the location 83660977-84353662 bp ((See 112(a) Written Description rejection above)) in chromosome 2 of the Cannabis plant, as recited in claims 1-4 and 7-8. It is noted here that genomic sequence of chromosome 2 of several strains of C. sativa plant were published before the effective filing date of the invention. One such genomic sequence of chromosome 2 of a C. sativa plant was published on 15 January 2021 (GenBank Accession No. CM028015 JADEVU010000000).
It is prudent to mention here that exact physical location of a particular gene in a genome is known to vary (more so in plants than animals) depending on many factors including specific strain/cultivar; polyploidy (whole genome duplication); chromosomal rearrangements where chromosome segments are deleted, duplicated, inverted, or translocated, often caused by improper repair of DNA double-strand breaks during meiosis; and genome restructuring via recombination between two parents having the same or similar (in terms of sequence identity) gene(s) in the specific chromosome pair (homologous chromosome) (Bakloushinskaya, I.Y., title and abstract). However, the function of a specific gene and the protein it encodes and the specific function of the encoded protein (e.g., enhanced powdery mildew resistance) remain unchanged. Thus, physical location of the of the gene(s) conferring enhanced powdery mildew resistance in chromosome 2 are functional equivalents of the physical location starting at position 83660977 to 84353662 in chromosome 2 in the reference genome(s) used by the Applicant.
Braich et al. describes several fully sequenced cannabis genomes (title and abstract) from several strains/cultivars of Cannabis sativa comprising PK (GenBank-GCA_ 000230575 .5), Finola (GenBank-GCA_003417725.2), CBDRx (GenBank-GCA_900626175.2) and also in the reference strain JL (Jamaican Lion) (GenBank-GCA_013030365.1) (page 2, para 2, line 5-9). It is noted, however, that gene annotation for various genes in Cannabis genome is done based on predictions using Arabidopsis genome, as described by Braich et al. (page 4, para 2, line 9-10).
Sequencing of several Cannabis genome, as taught by Braich et al., would make identification and/or development of appropriate markers linked to specific loci and, thus specific trait, easier. An ordinarily skilled artisan can develop new markers and/or use existing markers (reads on first marker and second marker consisting of nucleotide sequences, as recited in claim 1) to identify the presence of a powdery mildew resistance allele in a specific cultivar/strain based on presence of specific linkage group by less than 20 cM (as recited in claim 1), 15 cM (as recited in claim 2), 10 cM (recited in claim 3), and 5 cM (recited in claim 4). Producing a population of offspring from the selected Cannabis plants with any specific trait including enhanced powdery mildew resistance is a routine process in the art.
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to identify the genetic locus for enhanced the powdery mildew resistance trait in a Cannabis plant, as described by McKernan et al., by detecting the presence of genetic markers linked to a powdery mildew resistance locus MLO6 in chromosome 2. Identifying pre-existing genetic marker(s) and/or developing new markers flanking the trait locus that may contain specific marker(s) is a well-known routine process in the art especially once the genomic sequence is known. Next generation sequencing (NGS) has transformed genomics by providing low-cost, high-throughput technologies for the identification of markers including SNP markers in plants1.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to develop several genetic markers linked to a powdery mildew resistance locus MLO6 in chromosome 2 with a realistic goal to add by introgressing the powdery mildew resistance locus in a commercially valuable elite Cannabis cultivar, which is susceptible to powdery mildew, by the well-known standard method of marker-assisted breeding.
Conclusion
No claim is allowed.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 He et al. (Genotyping-by-sequencing (GBS), an ultimate marker-assisted selection (MAS) tool to accelerate plant breeding, 2014, Frontiers in Plant Science, 5:1-8) provides the evidence that next generation sequencing (NGS) has transformed genomics by providing low-cost, high-throughput technologies for the identification of markers including SNP markers in plants (abstract)