DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1, 4-5, and 9-25 are pending.
Preliminary Amendments
Applicant’s preliminary amendment filed on 04/03/2024 is acknowledged. The claims were amended to (1) cancel claims 2-3, 6-8, and 26-27; and (2) amended 1, 4, 5, 9-11, 13, 15-16, 18-21, and 23-25.
Election/Restrictions
Applicant’s election without traverse of the species of:
one or more gRNAs targeting exon 31, optionally wherein the targeting sequences are one or more of SEQ ID NOs: 410, 420, and 430;
Cas9, optionally comprising SEQ ID NO: 600 and tracrRNA flagpole and tracrRNA nuclease binding domain SEQ ID NOs: 106 and 108, respectively; and
No template DNA;
in the reply filed on 05/05/2026 is acknowledged.
Claim(s) 4 and 15 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species of (1) one or more gRNAs (i.e., through the election of gRNAs only targeting exon 31) and (3) Template DNA (i.e., through electing no template DNA), there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/05/2026.
Claim(s) 1, 5, 9-14, and 16-25 are under consideration.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 112(a) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later- filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed application, Application Nos. 63/163,692 filed 03/19/2021 and 63/164,404 filed 03/22/2021 fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre -AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
The prior filed applications only contain SEQ ID NOs: 1-22, which correspond to the following sequences in the instant application:
Prior
SEQ ID NO
1
2
3
4
5
6
7
8
9
10
Instant
SEQ ID NO
410
420
430
210
220
230
310
320
330
10
Prior
SEQ ID NO
11
12
13
14
15
16
17
18
19
20
Instant
SEQ ID NO
11
12
13
14
15
16
17
18
19
20
Prior
SEQ ID NO
21
22
Instant
SEQ ID NO
21
22
Thus, the prior filed applications lack description for claim 1’s following SEQ ID NOs: 200-207, 4, 211-213, 5, 221-223, 6, 231-233, 109, 111-114, 115-118, 300-307, 7, 311-313, 8, 321-323, 9, 331-333, 400-407, 1, 411-413, 2, 421-423, 3, 431-433, 440-443, and 450-453. The prior filed applications lack description for claim 10’s following SEQ ID NOs: 600-611
Accordingly, all claims are given the priority date of the 371 of PCT/IB2022/052491 filed 03/18/2022.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 09/18/2023 and 11/12/2025 are acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they do not include the following reference sign(s) mentioned in the description:
The description of Figure 7C recites at [000178] “. . . The regions corresponding to the targeting sequences of the three gRNAs specific to HTT exon 31 used in Examples are highlighted (SEQ ID NOS: 410 (or 1), 420 (or 2), and 430 (or 3)).” However, none of these sequences are highlighted despite Figure 7A, 7B and 7D all having their corresponding sequences highlighted.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Page 41 Line 30
Page 67 Line 17
Claim Objections
Claim(s) 11-12 and 16-25 are objected to under 37 CFR 1.75(c) as being in improper form because a multiple dependent claim should refer to other claims in the alternative only. See MPEP § 608.01(n). Accordingly, the claims have not been further treated on the merits.
Claim(s) 5, 10, and 13 are objected to because of the following informalities: A proper dependent claim should not refer to “parts” (i.e., embodiment (A), (B) or (C)) of a claim from which it depends. It would be remedial to remove “. . ., embodiment (A), (B) or (C).”
Claim(s) 9 and 10 are objected to because of the following informalities:
There are two commas in line 2 after “claim 5” in claim 9;
There is a period after “(C).;” in line 2 of claim 10;
Appropriate correction is required.
Claim Rejections - 35 USC § 112(d) – Improper Multiple Dependent
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 5 and 9 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Independent claim 1 is drawn to a guide RNA, whereas the dependent claim (claim 5) is drawn to a polynucleotide(s) encoding the guide RNA of claim 1. Thus, the claim reads on an embodiment where the RNA is replaced with DNA encoding the RNA. Therefore, the guide RNA is no longer present and the dependent does not include all of the limitations of the claim from which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Accordingly, claim 9 is rejected for being dependent upon claim 5.
Improper Markush
Claim 1, 5, 9-10, 11-14, and 16-25 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of claim 1 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
The elected species of SEQ ID NOs: 410, 420, and 430, target exon 31 of the htt gene (as seen in embodiment (c)), however, SEQ ID NOs: 210, 220, and 230 target exon 5 and SEQ ID NOs: 310, 320, and 330, target exon 8. As shown in Figure 5, each exon (i.e., 5, 8, or 31) transcript(s) is/are decreased by 75-80%, and are not all decreased to the same level (also see paragraph [000405]); and
Claim 1 recites, “. . . the Cas endonuclease is Cas 9, Cas3, Cas8a2, Cas8b, Cas8c, Cas10, Cas11, Cas12, Cas12a or Cpf1, Cas13, Cas13a, C2c1, C2c3, or C2c2, further optionally Cas9 or Cpf1, yet further optionally SpCas9. . .”. Wherein C2c1 is Cas12b, C2c3 is Casl2c, and C2c2 is Cas13a.
Synthego (Chapter 05: How to Choose the Right Cas Variant for Every CRISPR, How To Use CRISPR: Your guide to Successful Genome Engineering; pages 1-13; accessed on 06/05/2026) experiment discloses the following about Cas variants.
Synthego discloses that Cas13a (previously C2c2) and Cas13b target RNA (page 9, paragraphs 9-10). Regarding Cas12b, Synthego discloses, “[i]s generally smaller than its relatives Cas9 and Cas12a, which is an advantage. However, it functions at 48°C and therefore cannot be used in mammalian cells.”, (page 9, paragraph 4). Regarding Cas12a, “As Cas9 requires the guanine-rich PAM sequence 5’ NGG 3’, it is not well suited for targeting AT-rich sequences. Cas12a, however, is well-suited for experiments targeting AT-rich DNA sequences. . . One of the important features of Cas12a is that it creates staggered double-stranded breaks in the target DNA, rather than the blunt-end cuts generated by SpCas9. . . Also, Cas12a is smaller than SpCas9 and does not require a tracer RNA, only the crRNA. The gRNA required by Cas12a is, therefore, shorter in length, making it more economical to produce.”, (Page 7 paragraphs 7 to 9, to page 8, paragraph 1). Regarding Cas3, “Cas3 differs significantly from other Cas nucleases. While Cas9 and its relatives will create clean, double-stranded breaks in DNA, Cas3 degrades DNA, moving along one strand and effectively ‘shredding’ it. It also lacks any PAM sequence requirements, being activated when the CRISPR-associated complex for antiviral defense (CASCADE) recognizes a target. . .”, (page 7, paragraph 3).
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 5, 9-10, and 13-14 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Brodsky et al (US 2022/0265852 A1; Published August 25th, 2022; Effective Filing date of January 12th, 2021)
Claim 1 is drawn to “An isolated guide RNA (gRNA) for Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-mediated gene editing, wherein…(C) the gRNA comprises a targeting sequence comprising at least or consisting of 17 nucleotides…, wherein (I) the targeting sequence comprises or consists of: (i) (i-1) a sequence of at least 17 consecutive nucleotides…contained in one or more of SEQ ID NO: 400, 401, 402, 405, 406, and/or 407, or (i-2) a sequence of (a) SEQ ID NO: 1, 410, 411, 412, or 413, (b) SEQ ID NO: 2, 420, 421, 422, 423, (c) SEQ ID NO: 3, 430, 431, 432, or 433, or (d) SEQ ID NO: 440, 441, 442, or 443, (e) SEQ ID NO: 450, 451, 452, or 453, (ii) a sequence of at least 17 nucleotides comprising one or more mutations…, said mutations relative to the at least 17 consecutive nucleotides…of (i)…, or (iii) a sequence of at least 17 nucleotides which comprises at least 85, 90, 95, 96, 97, 98 or 99% sequence identity to the sequence of at least 17 consecutive nucleotides…of (i)…and/or (II) when the gRNA is complexed with a Cas endonuclease, the targeting sequence guides the Cas endonuclease to allow for cleavage of exon 31 of the HTT gene or within 30 nucleotides upstream or downstream of the exon 31.” Thus, the claim encompasses an embodiment which is a gRNA comprising a targeting sequence comprising at least 17 nucleotides contained in one or more of SEQ ID NO: 410, 420 and 430 (elected species contained in part (i)), wherein the at least 17 nucleotides comprise one or more mutations relative to the at least 17 consecutive nucleotides of part (i). The phrase “one or more mutations” is reasonably interpreted as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or more relative to one or more of SEQ ID NO: 410, 420 and 430 (elected species). No upper bound on the number of mutations is provided by the claim or by an explicit definition in the specification regarding the phrase “one or more mutations.”
PNG
media_image1.png
178
552
media_image1.png
Greyscale
Regarding claim(s) 1 and 10, Brodsky et al teaches targeting Exons 29, 48, 50, 57, and 61 of the htt gene with one to three guide RNAs using Cas9 (See figure 2A-C). Brodsky et al uses three guide RNAs to target Exon 50 in Figure 2B and Table 1.
PNG
media_image2.png
182
592
media_image2.png
Greyscale
SEQ ID NO: 410 – agataagccatcaaactggg = 11 mutations
Ex50T_g1 - tgaagtgcacacagtagatgagg
SEQ ID NO: 420 – gtacaagcctggcctcacac = 16 mutations
Ex50C_g2 - tgaagtgcacacagtggatgagg
SEQ ID NO: 430 – ccgcctgcaccatgttcctc = 14 mutations
Ex50C_g3 - gaagtgcacacagtggatgaggg
Regarding claim(s) 5 and 9, Brodsky et al teaches cloning the sgRNA sequences (of table 1) into a pX330 (addgene) and a pM427 GFP reporter vector for in vitro validation (see paragraphs [0171] to [0173]).
Regarding claim 13 and 14, Brodsky et al teaches, “To test the efficiency of the sgRNAs to cut their target sequence, HEK293T, cells were co-transfected with 150 ng of the pM427 GFP reporter plasmid containing sgRNA target sequences, 50 ng of the specific pX330 sgRNA plasmid, 50 ng Cas9 expressing plasmid, and 100 ng of a mCherry plasmid (to monitor transfection efficiency) using Polyfect transfection reagent (Qiagen, 301105).”, (see paragraph [0173]). Further, Brodsky et al teaches cloning the sgRNAs into lentiCRISPRv2GFP (Addgene, 82416) (see paragraph [0174]).
Wherein Polyfect transfection reagent reads on a pharmaceutically acceptable carrier.
Therefore, claim(s) 1, 5, 9-10, and 13-14 are anticipated by Brodsky et al.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights