DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
1. Formal Matters
A. In the response filed 4/30/26, Applicants election of Group I, drawn to the indicated species is acknowledged. In view of Applicants’ traversal, the restriction among Groups I, II and III is hereby withdrawn. However, upon further review, all species have been examined.
B. Claims 1-43 are pending. Claims 34-38 are withdrawn as being drawn to a non-elected invention. Claims 1-33 and 39-43 are the subject of this Office Action.
2. Claim Objections
Claims 13, 15 and 17 are objected to since it should recite “comprise”, since “both” is closer to “comprises” in the alternative phrase “one or both”.
3. Claim Rejections - 35 USC § 112(a) – written description
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
A. Claims 1-33 and 39-43 are rejected under 35 U.S.C. 112, first paragraph, as containing subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention.
These are genus claims. While the general goal in producing CARs with reduced retroviral recombination is to reduce repeated regions of highly similar sequences, other than requiring a reduction retroviral recombination, the specification and claims do not indicate what distinguishing attributes are shared by the members of the genus. Thus, the scope of the claims includes numerous structural variants, and the genus is highly variant because a significant number of structural differences between/among genus members is permitted. The specification and claims do not provide any guidance as to what changes should be made in order to retain a functional bicistronic CAR. Structural features that could distinguish compounds in the genus from others in the nucleic acid or protein class are missing from the disclosure. No common structural attributes identify the members of the genus.
The general knowledge and level of skill in the art do not supplement the omitted description because specific, not general, guidance is what is needed. Since the disclosure fails to describe the common attributes or characteristics that identify members of the genus, and because the genus is highly variant, the Hu19/Hu20 examples in Examples 2 and 3 of the specification, alone, are insufficient to describe the genus. An argument could be made that the claims are drawn to nucleic acids, not a functioning bicistronic CAR, and these arguments will be considered. However, currently, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus. Thus, Applicant was not in possession of the claimed genus at the time the invention was made.
B. Claim 15 is rejected under 35 U.S.C. 112, first paragraph, as containing subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention.
These are genus claims. Nucleic acid molecules which are “modified versions” of those wild-type intracellular signaling domains (ISDs) would have one or more nucleic acid substitutions, deletions, insertions and/or additions to said nucleic acids.
However, other than being an ISD, the specification and claims do not indicate what distinguishing attributes are shared by the members of the genus. Thus, the scope of the claims includes numerous structural variants, and the genus is highly variant because a significant number of structural differences between/among genus members is permitted. The specification and claims do not provide any guidance as to what changes should be made. Structural features that could distinguish compounds in the genus from others in the nucleic acid or protein class are missing from the disclosure. No common structural attributes identify the members of the genus.
The general knowledge and level of skill in the art do not supplement the omitted description because specific, not general, guidance is what is needed. Since the disclosure fails to describe the common attributes or characteristics that identify members of the genus, and because the genus is highly variant, the wild-type ISDs of claim 15, alone, are insufficient to describe the genus. One of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus. Thus, Applicant was not in possession of the claimed genus at the time the invention was made.
4. Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
A. Claims 1-3, 5-9, 11-13, 15, 16, 18, 20-22, 27-31 and 39-42 are rejected under 35 U.S.C. 103 as being unpatentable over Kochenderfer et al. (WO 2020/061048 – reference AH on the IDS filed 5/3/24) in view of Im et al. (reference AS on the IDS filed 5/3/24).
The claims are essentially drawn to a nucleic acid encoding 2 chimeric antigen receptors and a cleavage sequence, where the nucleic acid has been designed to reduce retroviral recombination.
Kochenderfer teaches a CD19/CD20 construct meeting all of the instant claim limitations, including those comprising SEQ ID NO:46 (“Hu1928-Hu20BB – original”) and those that do not (Figure 1D), meeting claims 1, 2, 5 and 6. Kochenderfer does not teach designing a nucleic acid to reduce retroviral recombination. However, Im does and states that –
a degenerate codon substitution strategy in the two-chain single-vector format efficiently suppressed intravector deletional loss with rescue of balanced gene coexpression by minimizing sequence homology between repeated domains and preserving the final protein sequence.
Therefore, claims 3 and 41 are met.
Claims 7 and 8 are met by SEQ ID NO:10 of Kochenderfer (SEQ ID NO:10; Table 1)
Claims 9, 11-13, 15, 16, 18, 22 are met by Figure 1D (see construct with Hu19 scFv)
Claims 20 and 21 are met by SEQ ID NO:36 –
ID BHN60178 standard; DNA; 1500 BP.
XX
CC PN WO2020061048-A1.
XX
CC PD 26-MAR-2020.
XX
CC PI Kochenderfer JN, Yang S;
XX
CC PS Disclosure; SEQ ID NO 36; 126pp; English.
XX
Query Match 100.0%; Score 63; Length 1500;
Best Local Similarity 100.0%;
Matches 63; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGCCCTGCCTGTGACAGCTCTGCTGCTGCCCCTGGCCCTGCTGCTGCATGCCGCCAGA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCCCTGCCTGTGACAGCTCTGCTGCTGCCCCTGGCCCTGCTGCTGCATGCCGCCAGA 60
Qy 61 CCT 63
|||
Db 61 CCT 63
Claims 27 and 28 met by paragraph [0122]
Claims 29-31 are met by paragraph [0130]
Claims 39, 40 and 42 are met by paragraphs [0191] – [0198].
B. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Kochenderfer et al. in view of Im et al. further in view of Wen et al.
Claim 4 recites SEQ ID NO:41, which is a linker– (GGGGS)4. Kochenderfer teaches a (GGGGS)3 linker (SEQ ID NO:12; Table 1). The teachings of Kochenderfer and Im are seen in paragraph A of this section. Neither teaches SEQ ID NO:41.
However, Wen (Abstract) does teach that “GGGGS [(G4S)n] linkers are commonly used when engineering a protein, because of their flexibility and resistance to proteases”. Therefore, it would have been obvious to one of ordinary skill in the art at the time of the instant invention to have made a GGGGS linker with the desirable length.
C. Claims 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Kochenderfer et al. in view of Im et al. further in view of Kochenderfer (WO 2015/187528 – copy not provided, as this is Applicants’ own work). The teachings of Kochenderfer (‘048) and Im are seen in paragraph A of this section. Neither teaches 47G4. However, Kochenderfer (‘528) does (Figure 5). It would have been obvious to one of ordinary skill in the art at the time of the instant invention to have substituted the CD19 CAR of Kochenderfer (‘528) for that of Kochenderfer (‘048) given their identical functions.
5. Conclusion
A. Claims 1-13, 15, 16, 18, 20-22, 27-31 and 39-42 are not allowable.
B. Claim 14 is objected to since it depends from rejected claim 1. However, SEQ 57 and 65 are free of the prior art. Claims 23-26, 33 and 43 are objected to for similar reasons.
C. Claim 17 is objected to since it depends from rejected claim 1. However, the closest matches for SEQ 58, 66 and 69 are more than 1200 bases, so no prima facie case can be made that the nucleic acids of the prior art have the same function. Claim 19, which recites SEQ ID NO:59 and 57, is objected to for similar reasons.
Advisory information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ROBERT S LANDSMAN whose telephone number is 571-272-0888. The examiner can normally be reached M-F 8 AM – 6 PM (eastern).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Joanne Hama, can be reached at 571-272-2911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
/ROBERT S LANDSMAN/Primary Examiner, Art Unit 1647
Prosecution Insights