Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on May 13, 2024. Claims 1-4, 6-7, 9, 14-15, 20, 22-23, 25-28, 31-32, 34-36, 41-42, 45, 47, 50, 57, 63, 66, 68 and 72 are pending and currently examined.
Claim Objections
Claims 1 and 23 are objected to because of the following informalities: these claims recite abbreviations for gene names (e.g., ITAM, NFAT, AP1, etc.) that are not so apparent without spelling them out first when they appear in the claims set. Appropriate correction is required.
Claims Analysis
The differences between claims 1 and 3 are: (1) claim 3 specifies that an intracellular signaling region comprising an ITAM-containing domain is comprised by the recombinant receptor, while claim 1 specifies that an intracellular signaling region comprising an ITAM-containing domain can be comprised or “complexed with” the recombinant receptor; and (2) claim 1 recites “d) determining, based on the measured detectable signal, the titrated amount of the test viral vector that results in a half-maximal detectable signal” while claim 3 recites “d) determining, based on the measured detectable signal, the relative potency of the viral test viral vector by comparing the half-maximal detectable signal to a half-maximal detectable signal of a reference viral vector standard in the same assay”.
Both base claims 1 and 3 encompass a method comprising: a) introducing a test viral vector encoding a recombinant receptor into reporter T-cells, wherein each of the reporter T cells comprises a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, and wherein the recombinant receptor comprises an extracellular binding domain specific to a target, a transmembrane domain and comprises or is complexed with an intracellular signaling region comprising an ITAM-containing domain; b) incubating the viral-vector introduced reporter T cells in the presence of a recombinant receptor stimulating agent; c) measuring reporter T cells for the detectable signal from the reporter molecule; and d) determining, based on the measured detectable signal, the potency of the viral test viral vector. The claims require that a titrated amount of test viral vector and a plurality of populations of receptor T cells are used.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 2-4 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
Claim 2 recites “wherein the potency is a relative potency and the method further comprises comparing the half-maximal detectable signal of the test viral vector to a half-maximal detectable signal of a reference viral vector standard in the same assay.” Claim 3 recites “determining, based on the measured detectable signal, the relative potency of the viral test viral vector by comparing the half-maximal detectable signal to a half-maximal detectable signal of a reference viral vector standard in the same assay.” These limitations render the claims indefinite since it is unclear how to interpret “a reference viral vector standard” which is not clearly and definitively defined in the specification.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-4, 6-7, 9, 14-15, 20, 22-23, 25-28, 31-32, 34-36, 41-42, 45, 47, 50, 57, 63, 66, 68 and 72 are rejected under 35 U.S.C. 103 as being unpatentable over Amin et al. (WO 2019/089982 A1, published om May 9, 2019; submitted in IDS filed on May 13, 2024) in view of Geraerts et al. (BMC Biotechnology 2006, 6:34).
These claims are described above.
Amin teaches an invention relating to reporter T-cells in which the reporter is operably linked to the Nur77 locus, and methods of using the T-cells for screening for the activity of a recombinant receptor, including recombinant receptors containing an extracellular antigen-binding domain and an intracellular signaling domain, such as a chimeric antigen receptor (CAR). The methods include assessing activity of a cell expressing the recombinant receptor based on a detectable expression of a reporter molecule that is responsive to a signal through the intracellular signaling region of the recombinant receptor. In some embodiments, the activity assessed is an antigen- dependent or an antigen-independent activity. In some embodiments, the methods can be used to screen a plurality of reporter cells each containing a nucleic acid molecule encoding a candidate recombinant receptor, e.g. CAR, and assessing such cells or plurality of cells for one or more property or activity. The methods can be high- throughput. Also provided are reporter cells, cell compositions, nucleic acids and kits for use in the methods. See Abstract.
Amin teaches that the invention may include: a) producing a plurality of polynucleotides each encoding a recombinant receptor, wherein each polynucleotide includes i) a vector backbone containing a nucleic acid sequence encoding an intracellular signaling region and ii) a nucleic acid sequence encoding a binding domain; and b) introducing one of the plurality of polynucleotides encoding a recombinant receptor into a reporter T cell containing a reporter molecule, wherein the expression of said reporter molecule is responsive to a signal through the intracellular signaling region, and the encoded recombinant receptor present in the reporter T cell is distinct from the encoded recombinant receptor present in at least one of the other reporter T cells in the plurality. See [0014]. Amin teaches that the vector backbone can be a viral vector, which may be a retroviral vector or a lentiviral vector. See [0036].
Amin teaches that, in some embodiments, the methods employ a reporter cell, e.g., a reporter T cell, that contains a reporter that is responsive to a signal through the intracellular signaling region of the recombinant receptor, such as a primary activation signal in a T cell, a signaling domain of a T cell receptor (TCR) component, and/or a signaling domain comprising an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the methods can be used to assess the activity of a plurality of recombinant receptors, e.g., a plurality of candidate recombinant receptors. In some embodiments, the methods can be used as or can include a screening method. See [0069].
Amin teaches that the nucleic acid sequence encoding the reporter molecule can be within the genome of the cell or is targeted for integration in-frame with the endogenous Nur77 coding sequence, optionally separated by a nucleic acid sequence encoding a ribosome skip element selected from among a T2A, a P2A, a E2A or a F2A; that the reporter molecule can be or include a fluorescent protein (a red fluorescent protein (RFP) or tdTomato), a luciferase, a b-galactosidase, a chloramphenicol acetyltransferase (CAT), or a b-glucuronidase (GUS). See [0027].
Amin teaches that the reporter cells or cell lines or one or more of the plurality of reporter T cells can be assessed for expression of the reporter molecule after incubating the reporter cells that is engineered to express a recombinant receptor, e.g., CAR, in the presence of an agent that binds the binding domain of the recombinant receptor, and that the agent can be or comprise an antigen or an epitope thereof, e.g., an antigen that specifically binds and/or is recognized by the binding domain of the recombinant receptor. See [0360]-[0361].
Accordingly, Amin teaches a method for measuring the activity of a recombinant receptor, such as a chimeric antigen receptor (CAR), comprising an extracellular domain, a transmembrane domain, and an intracellular domain comprising or complexed with an ITAM-containing domain, stimulated by a stimulating binding agent (e.g., an antigen), comprising: a) contacting a viral vector (e.g., a lentiviral vector) encoding the recombinant receptor to a plurality of reporter T-cells that produce reporter molecules in response to the signals produced via stimulation of the recombinant receptor, b) incubating the reporter cells of a) in the presence of a recombinant receptor stimulating agent, and c) measuring reporter molecules produced in b).
Amin is silent on the association of the measured activity of the recombinant receptor in response to a stimulating agent with “potency” of the viral vector delivering it. Since the same factors are measured using in the same process, the receptor activity results of Amin are considered to be the same as “potency” of the viral vector delivering the recombinant receptor gene into report cells.
However, Amin is silent on if viral vectors used in delivering recombinant receptor genes are in “a titrated amount”.
Geraerts teaches a study on comparison of lentiviral vector titration methods. Geraerts that lentiviral vectors are efficient vehicles for stable gene transfer in dividing and nondividing cells. Methods are required to analyze the quality of lentiviral vector production, the efficiency of gene transfer and the extent of therapeutic gene expression. The authors compared lentiviral vector titration methods that measure pg p24/ml, RNA equivalents/ml, transducing units (TU/ml) or mRNA equivalents. The amount of genomic RNA in vector particles proves to be reliable to assess the production quality of vectors encoding nonfluorescent proteins. However, the RNA and p24 titers of concentrated vectors are rather poor in predicting transduction efficiency, due to the high variability of vector production based on transient transfection. Moreover, they demonstrate that transgenic mRNA levels correlate well with TU and can be used for functional titration of non-fluorescent transgenes. See Abstract.
Accordingly, teachings of Geraerts indicate that titration of gene-transfer viral vectors is routine and necessary for analyzing the quality of lentiviral vector production.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to introduce a titration process for viral vectors taught in Geraerts into the study of Amin, if it has not already done so. One would have been motivated to do so to analyze the quality and quantity of viral vectors so that vectors of proper quality and quantity can be used in the study of Amin.
As to the limitation of the step “d) determining, based on the measured detectable signal, the titrated amount of the test viral vector that results in a half-maximal detectable signal” of claim 1, and “d) determining, based on the measured detectable signal, the relative potency of the viral test viral vector by comparing the half-maximal detectable signal to a half-maximal detectable signal of a reference viral vector standard in the same assay” of claim 3, since the assay results are obtained, it is well within the purview of one skilled in the art to decide how the results are accessed, including the way as claimed.
Regarding claims 6, 7, 9 and 14-15, Geraerts teaches a method of titrating a viral vector including serial dilution. See Figure 1.
Regarding claim 20, Amin teaches that reporter T-cells may be Jurkat cells or derivative thereof. See [0010].
Regarding claims 22-23, 25-28 and 31-32, Amin teaches that the nucleic acid encoding the reporter is present within the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77.In some embodiments, the one or more target site(s) comprise, and/or the nucleic acid is present within the genome at a site comprising, the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO:65) and/or GCCTGGGAACACGTGTGCA (SEQ ID NO:66). See [0026].
Regarding claims 34-36, Amin teaches that, in some embodiments, the nucleic acids encoding the reporter may encode a marker which can be a selection marker, such as an antibiotic resistance gene, in addition to other reporter molecules, such as fluorescence proteins and luciferase. See [0278]-[0279].
Regarding claims 41-42, Amin teaches that a plurality of backbone vector constructs were generated to contain spacers of different lengths (e.g., short, e.g., SEQ ID NO:20; medium, e.g., SEQ ID NO:22; and long, e.g., SEQ ID NO:24) and common sequences for other components of the CAR, such as a transmembrane domain (e.g., human CD28 transmembrane domain) and an intracellular signaling region containing a costimulatory signaling region (e.g., derived from human 4-lBB or human CD28) and a signaling domain (e.g. derived from human CD3zeta). See [0469].
Regarding claim 50, Amin teaches that, in some embodiments, the purified or isolated antigen for stimulating the recombinant receptor can be immobilized on a support, e.g., on a surface, such as a plate, a bead or a column. See [0362].
Regarding claim 57, Amin teaches that the expression the Nur77 reporter in the presence of a particular recombinant receptor, can be assessed in the presence of the specific antigen (e.g., in the presence of or co-culture with antigen-expressing cells, or in the presence of recombinant and/or purified antigen) and the absence of the specific antigen, to compare antigen-dependent signaling and antigen-independent signaling via the recombinant receptor. See [0365].
Regarding claims 63 and 66, Amin teaches that reporter T cells, expressing a candidate receptor, can be physically separated from each other, such as by formatting in a spatial array, such as a multiwell plate or plates, and multiwell plates can include, but are not limited to, 12-well, 24-well, 48-well, 96-well plates, 384-well plates, and 1536-well plates (see [0391]), and that the reporter can be detectable and can be monitored visually, or by using a spectrophotometer, luminometer, fluorometer or other related methods (see [0107]).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN, on (571) 270-3497, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/NIANXIANG ZOU/
Primary Examiner, Art Unit 1671
Prosecution Insights