DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 1-7, 21-23, 25-29, 31, 45-47 and 50 are pending.
Claims 7, 23, 25-27, 29, 31 and 45-47 are amended.
Claims 1-7, 21-23, 25-29, 31, 45-47 and 50 are currently under examination on the merits.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. The U.S. effective filing date of all claims under examination is set at 03/30/2021 based on the provisional application 63/168,210 (filed 03/30/2021).
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 05/24/2024 is being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings are objected to because:
Fig 18 nucleotide sequences are lacking SEQ ID NO identifiers;
Fig 24 amino acid sequences are lacking SEQ ID NO identifiers;
Fig 25 amino acid sequences are lacking SEQ ID NO identifiers;
Figs 24 and 25 are not fully clear and the indications of various domains of the CAR are not distinguishable.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiencies – Nucleotide and amino acid sequences appearing in the drawings, specifically Figures 18, 24 and 25, are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specification
The disclosure is objected to because of the following informalities:
Pg. 26 line 27-28: The description states that the primers used in the studies are in Fig. 18 disclosed as SEQ ID NOS 77-106, 89-90, and 107-108, respectively, in order of appearance. It is unclear which order of appearance is being referred to as it can be from top to bottom of the 2nd column of the table followed by top to bottom of the 3rd column, or the appearance can be from left to right of 2nd row, followed by left to right of 3rd row and so forth.
The description of the drawings of FIG 27A-27C states that the figures depict the molecular design of the inducible IL13Ra2-IFNϒ CAR. However, Fig 27A shows a schematic labelled without IFNϒ, rather it is labelled with comprising a CD19t at the C-terminal.
The specification appears to use the term “IL13Rα2-CAR” interchangeably with “IL13-CAR” to describe a CAR that comprises the ligand IL13 that can bind to IL13Rα2 on cancer cells. Similarly, the term “IL13Rα2-IFNϒ CAR” appears to be used interchangeably with “IL13-IFNϒ CAR” to describe a CAR T cell that (i) expresses a CAR that comprises the ligand IL13 that can bind to IL13Rα2 on cancer cells; and (ii) co-expresses IFNϒ. It is suggested that if this is the case, Applicants should provide a definition that clarifies these terms are used interchangeably throughout the specification or Applicants can unify the usage of one term to describe each specific construct for consistency and clarity.
Appropriate correction is required.
Claim Objections
Claims 25-26 are objected to because of the following informalities:
Claims 25 and 26 appear to be identical. Applicant is advised that should claims 25 and 26 be found allowable, claim 26 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 50 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 50 recites the phrase “a weaker constitutive promoter”. The word “weaker” is a relative term. The term “weaker” in the claim is a relative term which renders the claim indefinite. The term “weaker” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The “constitutive promoter” in the claim has been rendered indefinite by the use of the term “weaker”. In an effort to expedite prosecution, the following amendment to claim 50 is suggested to obviate this rejection: “…and the second promoter is a constitutive promoter weaker than the first promoter.”
Claim Rejections - 35 USC § 102/103 (first)
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Xiao et al. (US20200155598A1 Date Published 2021-02-16) and as evidenced by Qin et al. (PLoS One. 2010 May 12;5(5):e10611), Kiani et al. (Blood (2001) 98 (5): 1480–1488), Kim et al. (PLoS One. 2011 Apr 29;6(4):e18556) and Wang et al. (Molecular Medicine Reports 9: 715-719, 2014).
Xiao et al. teaches compositions and methods for enhancing T cell response which increases the efficacy of CAR T cell therapy for treating cancer (Abstract). They teach modified cells comprising an isolated nucleic acid comprising a first nucleic acid encoding a chimeric antigen receptor (CAR) and a second nucleic acid encoding a therapeutic agent comprising IFNγ that is expressed and secreted (Abstract and paragraph [0474] Embodiment #246). They also teach in FIG. 8 a schematic diagram of a modified cell that (i) expresses a CAR molecule that is anchored at the cell surface that comprises a scFv targeting domain, a hinge domain, a transmembrane domain, a co-stimulatory domain, and a CD3 zeta domain; and (ii) expresses and secretes IFNγ as a therapeutic agent. FIG. 8 also shows at the top a schematic of a nucleic acid molecule wherein the expression of the CAR is under the control of the EF1a promoter, while the expression of IFNγ is under the control of an NFAT-binding promoter.
As evidenced by Qin et al., the EF1a promoter is a constitutive promoter in mammalian cells (Abstract). In addition, as evidenced by Kiani et al., NFAT can regulate the expression of a variety of inducible genes including IFNγ (Abstract). Therefore, Xiao et al. teaches a first promoter of EF1a that controls expression of the CAR that is a constitutive promoter, and the second promoter that is regulated by NFAT controls the expression of IFNγ in an inducible manner.
Xiao et al. also teaches in FIG. 18 the vector construct named 6221 (hCD19CAR-6xNFAT-IL6-2a-IFNg) that comprises a nucleotide sequence that encodes for a CAR targeting human CD19 whose expression is under the control of an EF1a promoter, and further encodes for an IL6, a 2A sequence and IFNγ that are under the control of the NFAT transcription modulator (i.e. the vector comprises nucleic acid that includes a promoter comprising a binding site for the NFAT transcription modulator), used to transfect a population of 105 T cells obtained from patients (FIG. 18 and paragraphs [0113], [0514] and [0516]). They teach that the nucleic acid sequence for 2A is SEQ ID NO: 327 (gccacgaact tctctctgtt aaagcaagca ggagacgtgg aagaaaaccc cggtcct sequence obtained from Application US 16/445,965); and the amino acid sequence for IFNγ is SEQ ID NO: 328 (paragraph [0473] and Table 2). They also teach that the 2A peptide comprises P2A or T2A, which is a cleavable moiety (paragraph [0115]).
Translation of the nucleic acid sequence of SEQ ID NO: 327 of Xiao et al. produces an amino acid sequence of ATNFSLLKQAGDVEENPGP which matches to a P2A sequence as evidenced by Kim et al. (Figure 1(B). Therefore, Xiao et al. teaches a P2A skip sequence. With respect to the SEQ ID NO: 328 of Xiao et al., this amino acid sequence aligns and matches 100% with instant SEQ ID NO: 29 recited in claim 7 as comprising the amino acid sequence of the human IFNγ or a variant thereof. Further, as evidenced by Wang et al., the native secretion signal peptide of hIFN-γ is encoded by the nucleic acid sequence of ATGAAGTATACTAGTTACATCTTAGCCTTTCAATTGTGCATTGTTCTTGGTTCTTTGGGATGTTATTGT (Pg. 716 column left paragraph first “Construction of expression vectors”), which translates to the 23 amino acid sequence of MKYTSYILAFQLCIVLGSLGCYC (translation performed using Expasy Translate tool). This 23 amino acid signal peptide sequence matches the first 23 amino acid sequence of SEQ ID NO: 328 as taught by Xiao et al. Therefore, Xiao et al. teaches a polypeptide comprising human IFNγ that comprises the native signal peptide sequence for secretion of human IFNγ.
Xiao et al. further teaches that the population of cells is used in autologous CAR T cell therapy and in allogenic CAR T cell therapy (paragraph [0149]). They teach a method of treating cancer, the method comprising: administrating an effective amount of the composition of T cells comprising one or more CARs, wherein the cell is engineered to express and secrete a therapeutic agent that is or comprises IFNγ and wherein the one or more CARs comprise a CAR targeting a tumor cell (paragraphs [0302], [0303] and [0314]).
Therefore, Xiao et al. anticipates instant claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47 and are rejected here.
Claim Rejections - 35 USC § 103 (first)
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 2-7, 21, 23, 25-29, 31, 45. 47, and 50 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), as applied to claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47, and in further view of Qin et al. (PLoS One. 2010 May 12;5(5):e10611).
The teachings of Xiao et al. have already been described in the first 102/103 rejection above.
However, Xiao et al. does not specifically teach a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor comprises: a targeting domain, a spacer, a transmembrane domain, a co-stimulatory domain, and a CD3ζ signaling domain; and a nucleotide sequence encoding a polypeptide comprising a human interferon gamma or a variant thereof, wherein the nucleic acid molecule comprises a promoter that controls expression of both the CAR and human interferon gamma.
They also do not specifically teach a population of human T cells harboring: a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor or polypeptide comprises: a targeting domain, a spacer, a transmembrane domain, a co-stimulatory domain, and a CD3ζ signaling domain; and a nucleotide sequence encoding a polypeptide comprising a human interferon gamma or a variant thereof, wherein the nucleic acid molecule comprises a promoter that controls expression of both the CAR and human interferon gamma.
They further do not specifically teach the nucleic acid molecule, wherein a first promoter is a constitutive promoter that controls expression of the CAR and a second promoter is a constitutive promoter that controls expression of the human interferon gamma or variant thereof, and wherein the first promoter is a strong constitutive promoter and the second promoter is a weaker constitutive promoter.
However, these deficiencies are remedied by the teachings of Qin et al.
Qin et al. further teaches that the SV40 promoter is also a fairly strong promoter, even though it is generally somewhat weaker than the EF1A promoter (Pg. 1 column right lines 22-23).
One of ordinary skill in the art would have been motivated, with a reasonable expectation of success, to generate a nucleic acid molecule of Xiao et al. that comprises a promoter that controls expression of both the CAR and human interferon gamma to generate a “polyprotein” that is cleavable to generate separate CAR and interferon gamma molecules; or to generate a population of human T cells harboring a nucleic acid molecule that comprises a promoter that controls expression of both the CAR and human interferon gamma to generate the polyprotein because Xiao et al. teaches an embodiment wherein the CAR and a therapeutic moiety (Abstract of Xiao et al. teaches interferon gamma as such a therapeutic moiety) are produced in the form of a polypeptide which is cleaved to generate separate CAR and therapeutic agent molecules ([0115], in particular) and one of ordinary skill in the art has a high level of skill and so can readily design, optimize and construct said nucleic acid molecule that can be harbored within a population of human T cells, wherein both the expression of CAR and human interferon gamma are controlled by a single promoter because Xiao et al. teaches that the promoter EF1a can be used to control expression of genes such as CARs in human T cells, and further Qin et al. teaches that EF1a is a strong constitutive promoter suitable for use in mammalian systems to drive ectopic gene expression (Abstract and Pg. 2 column right line 16).
In addition, one of ordinary skill in the art would have been motivated, with a reasonable expectation of success, to generate a nucleic acid molecule of Xiao et al. that comprises a first promoter that is the EF1a strong constitutive promoter as taught by Xiao et al. and Qin et al., and the second promoter is the SV40 promoter which is a weaker constitutive promoter compared to EF1a as taught by Qin et al. because Xiao et al. teaches that expression of CARs can be effectively regulated by the EF1a promoter and Qin et al. teaches that constitutive promoters such as SV40 and EF1a are routinely used to drive ectopic gene expressions in mammalian systems (Abstract).
This is an example of (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results.
Claim Rejections - 35 USC § 103 (second)
Claims 1, 3, 4, 5, 6, 7, 21-23, 27, 28, 29, 31, and 45-47are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), as applied to claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47, and in further view of Wang et al. (Molecular Medicine Reports 9: 715-719, 2014) and Zhang et al. (J Gene Med 2005; 7: 354–365).
The teachings of Xiao et al. have already been described in the first 102/103 rejection above.
However, Xiao et al. does not specifically teach a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor or polypeptide comprises: a targeting domain, a spacer, a transmembrane domain, a co-stimulatory domain, and a CD3ζ signaling domain; and a nucleotide sequence encoding a polypeptide comprising a human interferon gamma or a variant thereof, wherein the polypeptide comprising human interferon gamma comprises a signal sequence for secretion of human interferon gamma that differs from the native human interferon gamma signal sequence.
Xiao et al. also does not specifically teach a population of human T cells harboring: a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor or polypeptide comprises: a targeting domain, a spacer, a transmembrane domain, a co-stimulatory domain, and a CD3ζ signaling domain; and a nucleotide sequence encoding a polypeptide comprising a human interferon gamma or a variant thereof, wherein the polypeptide comprising human interferon gamma comprises a signal sequence for secretion of human interferon gamma that differs from the native human interferon gamma signal sequence.
However, these deficiencies are remedied by the teachings of Wang et al. and Zhang et al.
Teachings of Wang et al. are discussed above.
Zhang et al. teaches that the IL-2 signal peptide sequence, which is different from native human IFNϒ signal sequence, is a commonly used signal peptide to direct secretion of nascent peptides including those of investigated proteins placental alkaline phosphatase and endostatin (Abstract Background section). They further teach modifications that increase both the basicity and hydrophobicity of the IL-2 signal peptide can augment the secretion of AP and endostatin from mammalian expression cells in vitro (Abstract Results section).
One of ordinary skill in the art would have been motivated, with a reasonable expectation of success, to generate a population of human T cells of Xiao et al. harboring a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising human interferon gamma that comprises an IL-2 signal sequence for secretion of the human interferon gamma in place of the native human interferon gamma signal sequence as taught by Xiao et al. and Wang et al. because Zhang et al. teaches that the IL-2 signal sequence is commonly used as a signal peptide to direct secretion of nascent peptides in mammalian cells and that protein secretion can be augmented by optimizing the signal peptide so that therapeutic levels of secreted proteins can be increased in vivo (Abstract Background and Conclusions). This is an example of (B) Simple substitution of one known element for another to obtain predictable results. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Yie-Chia Lee (Tonya) whose telephone number is (571)272-0123. The examiner can normally be reached Monday - Friday 7.30a - 3.30p Eastern Time Zone.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached on 571-270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YIE-CHIA LEE (TONYA)/Examiner, Art Unit 1642
/SEAN E AEDER/Primary Examiner, Art Unit 1642