Prosecution Insights
Last updated: October 02, 2026
Application No. 18/284,413

CAR T CELL THERAPY AND IFN GAMMA

Final Rejection §103§112
Filed
Sep 27, 2023
Priority
Mar 30, 2021 — provisional 63/168,210 +1 more
Examiner
LEE, YIE CHIA
Art Unit
1642
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
City of Hope
OA Round
2 (Final)
69%
Grant Probability
Favorable
3-4
OA Rounds
6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 69% — above average
69%
Career Allowance Rate
27 granted / 39 resolved
+9.2% vs TC avg
Strong +47% interview lift
Without
With
+46.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
33 currently pending
Career history
68
Total Applications
across all art units

Statute-Specific Performance

§101
4.4%
-35.6% vs TC avg
§103
30.7%
-9.3% vs TC avg
§102
12.2%
-27.8% vs TC avg
§112
34.1%
-5.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 39 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims / Response to Amendments The Amendments and Remarks filed 05/29/2026 in response to the Office Action of 03/06/2026 are acknowledged and have been entered. Claims 1, 4, 21-23, 28, 45-47 and 50 are currently pending. Claims 1, 23 and 50 have been amended by Applicant. Claims 1, 4, 21-23, 28, 45-47 and 50 are currently under examination in the instant Office Action. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office Action. This Office Action contains New Rejections Necessitated by Amendments. Objections Withdrawn The drawings objections are withdrawn. The nucleotide and/or amino acid sequence disclosures objections are withdrawn. The specification objections are withdrawn. The claim objections are withdrawn. Claim Rejections Withdrawn The rejection of claim 50 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AlA), second paragraph has been withdrawn. The rejection of claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47 under AIA 35 U.S.C. 102(a)(2) and (a)(2) as being anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Xiao et al. (US20200155598A1 Date Published 2021-02-16) and as evidenced by Qin et al. (PLoS One. 2010 May 12;5(5):e10611), Kiani et al. (Blood (2001) 98 (5): 1480–1488), Kim et al. (PLoS One. 2011 Apr 29;6(4):e18556) and Wang et al. (Molecular Medicine Reports 9: 715-719, 2014) has been withdrawn. The rejection of claims 1, 2-7, 21, 23, 25-29, 31, 45. 47, and 50 under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), as applied to claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47, and in further view of Qin et al. (PLoS One. 2010 May 12;5(5):e10611) has been withdrawn. The rejection of claims 1, 3, 4, 5, 6, 7, 21-23, 27, 28, 29, 31, and 45-47 under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), as applied to claims 1, 3, 4, 5, 6, 7, 21, 23, 27, 28, 29, 31, 45 and 47, and in further view of Wang et al. (Molecular Medicine Reports 9: 715-719, 2014) and Zhang et al. (J Gene Med 2005; 7: 354–365) has been withdrawn. Specification - New The disclosure (Specification submitted 05/29/2026) is objected to because of the following informalities: On Pg 3 of the specification, the sequence of a variant of human IL-13 comprising SEQ ID NO: 30 is shown. Likewise, an identical amino acid sequence of SEQ ID NO: 30 is shown in the Sequence Listing dated 09/27/2023. It is noted that the amino acid residues of instant SEQ ID NO: 30 numbered 95 to 105 are “QFVKDLLLLHL”, specifically there are four Leu or L residues from residues 100 to 103. Further, the specification on Pg 4 discloses that “the IL-13 CAR can include a variant IL13 comprising, for example, SEQ ID NO: 30……..A useful CAR can comprise any of SEQ ID NO: 70-76.” A close inspection of instant SEQ ID NOs: 70-76 showed that all of the amino acid sequences comprise an IL-13 variant from amino acid residues 1-112, wherein residues numbered 93 to 102 are “QFVKDLLLHL”, specifically there are only three LEU or L residues from residues 98 to 100. A comparison of SEQ ID NO: 30 and SEQ ID NO: 76 is shown below in Alignment A to clearly illustrate the “insertion” of the additional L residue in SEQ ID NO: 30 that is highlighted. It appears that the addition of a fourth L residue in SEQ ID NO: 30 may be a typographical error. Alignment A: Alignment of instant SEQ ID NO: 30 (top), a variant IL-13, with instant SEQ ID NO: 76, a IL-13 CAR PNG media_image1.png 252 962 media_image1.png Greyscale Appropriate correction is required if the typographical error were present in SEQ ID NO: 30. Alternatively, appropriate explanation is required regarding the above observation of an additional L residue in SEQ ID NO: 30. Rejections Necessitated by Amendments Claim Rejections - 35 USC § 112(b) – Necessitated by Amendments Claims 4, 28 and 50 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AlA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AlA 35 U.S.C. 112, the applicant), regards as the invention. Claim 4 is dependent on canceled claim 3. While claim 50 is dependent on claim 4. The metes and bound of the claims are unclear because it is unclear which nucleic acid molecule claims 4 and 50 are further limiting. Claim 4 would be appropriately recited if it were amended to depend on claim 1. In addition, for the purpose of compact prosecution, claim 4 is considered to depend on claim 1 in the rejections set-forth below. Claim 28 is dependent on canceled claim 27. The metes and bound of claim28 are unclear because it is unclear which population of human T cells the claim is further limiting. Claim 28 would be appropriately recited if it were amended to depend on claim 23. In addition, for the purpose of compact prosecution, claim 28 is considered to depend on claim 23 in the rejections set-forth below. Claim Rejections - 35 USC § 103 – Necessitated by Amendments (First) Claims 1, 23 and 47 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16) in view of Brown et al. (US20160340649A1 Date Published 2016-11-24) and Damask et al. (US20170029894A1 Date Published 2017-02-02). Xiao et al. teaches compositions and methods for enhancing T cell response which increases the efficacy of CAR T cell therapy for treating cancer (Abstract). They teach on the same isolated nucleic acid, a first nucleic acid encoding a chimeric antigen receptor (CAR) and a second nucleic acid encoding a therapeutic agent that is IFNγ (Abstract, paragraphs [0105] and [0474] and FIG. 8). Xiao et al. also teaches that the CAR can bind IL-13Rα2 which is an antigen of a solid tumor (paragraphs [0113] and [0126]). They further teach in FIG. 8 a schematic diagram of a modified cell that: (i) expresses a CAR molecule that comprises a scFv targeting domain, a hinge domain, a transmembrane domain, a co-stimulatory domain, and a CD3 zeta domain; and (ii) expresses and secretes IFNγ as a therapeutic agent. They further teach in FIG. 8 (top), a schematic of a nucleic acid molecule wherein the expression of the CAR is under the control of the EF1a promoter, while the expression of IFNγ is under the control of an NFAT-binding promoter. Xiao et al. also teaches a population of CAR cells comprising the isolated nucleic acid, wherein the CAR cells comprise lymphocyte, leukocyte, or PBMC (paragraph [0134]). They teach that vectors comprising the isolated nucleic acid were generated and used to transfect a population of 105 T cells obtained from healthy donors or patients (paragraphs [0514] and [0516]). They also teach that the amino acid sequence for IFNγ is SEQ ID NO: 328 (paragraph [0473] and Table 2) which aligns and matches 100% with instant SEQ ID NO: 29 recited in instant claim 1 as comprising the amino acid sequence of human IFNγ. Xiao et al. further teaches that the population of T cells is used in autologous CAR T cell therapy and in allogenic CAR T cell therapy (paragraph [0149]). They teach a method of treating cancer, the method comprising: administrating an effective amount of the composition of T cells comprising one or more CARs, wherein the cells are engineered to express and secrete a therapeutic agent that is IFNγ and wherein the one or more CARs comprise a CAR targeting a tumor cell (paragraphs [0302], [0303] and [0314]). However, Xiao et al. does not specifically teach that the nucleic acid molecule comprises a nucleotide sequence encoding a CAR targeting IL-13Rα2 that comprises amino acid sequences recited in instant claim 1 for the targeting domain, the spacer, the transmembrane domain, the co-stimulatory domain, and the CD3 zeta signaling domain. However, these deficiencies are remedied by the teachings of Brown et al. and Damask et al. Brown et al. teaches a nucleic acid molecule encoding a CAR that binds IL-13Rα2, wherein the CAR comprises: human IL-13 or a variant thereof; a transmembrane domain; a costimulatory domain; and CD3ζ signaling domain or a variant thereof (Abstract and paragraph [0006]). They teach that the extracellular domain enables the CAR, when expressed on the surface of a T cell, to direct T cell activity to those cells expressing IL-13Rα2, a receptor expressed on the surface of tumor cells including glioma, glioblastomas and other cancers that express IL-13R α2 (paragraphs [0005], [0014] and [0054]). They also teach that the IL-13Rα2 binding portion of the CAR includes an amino acid modification that is a Glu to Thr (E to Y) mutation on IL-13 of SEQ ID NO: 3, which increases binding specificity (paragraphs [0005] and [0098] and Figures 19 to 26 where the mutation to Y has been highlighted). They further teach a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence that is identical to SEQ ID NO: 10 (paragraphs [0012] and [0095] and Fig 17). Even further, they teach a population of human T cells transduced by a vector comprising an expression cassette encoding a CAR comprising SEQ ID NO: 10 (claims 1 and 3 and paragraph [0096]; SEQ ID NO:10 comprises the 112 amino acid IL-13 sequence set forth in SEQ ID NO: 3), wherein the T cells can be autologous or allogenic and administered to patients to achieve anti-cancer therapy (paragraph [0076]). Alignment of SEQ ID NO: 10 as taught by Brown et al. with instant SEQ ID NOs: 30 and 31 (targeting domain), instant SEQ ID NO: 11 (spacer); instant SEQ ID NO: 16 (transmembrane domain), instant SEQ ID NO: 24 (co-stimulatory domain) and instant SEQ ID NO: 21 (CD3 zeta signaling domain) showed identity matches that are summarized in Table 1 and Alignments 1 and 2 below. Table 1: Summary of matches from the alignment of SEQ ID NO: 10 as taught by Brown et al. with instant SEQ ID NOs: 30, 31, 11, 16, 24 and 21. PNG media_image2.png 380 956 media_image2.png Greyscale Alignment 1: Alignment of SEQ ID NO: 10 of Brown et al. (top) with instant SEQ ID NO: 30 PNG media_image3.png 243 662 media_image3.png Greyscale As noted in the “Specification Objection” of this instant Office Action (Pg 4), instant SEQ ID NO: 30 may appear to have a typographical error resulting in an additional L residue in position 100. If this is in fact the case, then instant SEQ ID NO: 30 residues 3 to 115 would match with 100% identity to residues 1-112 of SEQ ID NO: 10 as taught by Brown et al. Alignment 2: Alignment of SEQ ID NO: 10 of Brown et al. (top) with instant SEQ ID NO: 31 PNG media_image4.png 241 638 media_image4.png Greyscale Damask et al. teaches IL-13 antagonists for treating asthma (Abstract). They teach that IL-13 is a cytokine produced by type 2 helper T cells (Th2), mast cells, eosinophils, and basophils, shown to be a central mediator of allergic asthma in an animal model (paragraph [0004]). They also teach the amino acid sequence of human IL-13 is as set forth in SEQ ID NO: 1 (paragraph [0038] and Sequence Listing). Alignment of SEQ ID NO: 1 as taught by Damask et al. with instant SEQ ID NO: 31 shows that it is an exact match (see Alignment 3 below). Alignment 3: Alignment of SEQ ID NO: 1 of Damask et al. (top) with instant SEQ ID NO: 31 PNG media_image5.png 397 945 media_image5.png Greyscale One of ordinary skill in the art would have been motivated, with a reasonable expectation of success to perform a combined method of making a nucleic acid molecule comprising a nucleotide sequence encoding: (i) a CAR targeting IL-13Rα2; and (ii) a human IFNγ, wherein a first promoter of EF1a controls expression of the CAR and a second promoter of NFAT controls expression of the human IFNγ as taught by Xiao et al., and substituting the CAR taught by Xiao et al. with the CAR comprising the amino acid sequence as set forth in SEQ ID NO: 10 as taught by Brown et al. which comprises a human IL-13 variant that targets IL-13Rα2; a transmembrane domain; a costimulatory domain; and CD3ζ signaling domain, because this is a substitution of one CAR for another CAR that comprises domains that have the same characteristics and/or functions because Brown et al. teaches that T cells expressing a CAR targeting IL-13Rα2 can be useful in the treatment of cancers such as glioblastoma, as well as other cancer that expresses IL13Rα2 (paragraph [0014]; and further substituting the IL-13 variant comprised in the CAR as taught by Brown et al. with the human IL-13 as taught by Damask et al. because this is also a substitution which meets the same functional requirement of targeting IL-13Rα2. This is an example of (B) Simple substitution of one known element for another to obtain predictable results. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results. Regarding instant claim 23, it would have been obvious for one of ordinary skill in the art to perform a combined method to make a population of human T cells harboring the nucleic acid of the above combined method, because said population of human T cells would have the advantageous therapeutic effectiveness of targeting IL13-Rα2, a solid tumor antigen on gliomas and glioblastomas, and have antitumor efficacy as taught by Brown et al. (paragraph [0089]) and further comprising a secretable human IFNγ as a therapeutic agent as taught by Xiao et al. would have the potential and advantage to induce or enhance T cell response, or enhance cancer treatment as taught by Xiao et al. (paragraphs [0111], [0118], [0138] and [0543]). Regarding instant claims 23 and 47, it would have been obvious for one of ordinary skill in the art to perform a combined method to make a population of human T cells harboring the nucleic acid of the above combined method, and to be used for a method of treating a cancer in a patient comprising administering a population of autologous or allogeneic human T cells that is transduced by a vector as taught by Xiao et al. and Brown et al., wherein the vector comprises the nucleic acid molecule made from the above combined method, and wherein the cancer is targeted by the targeting domain of the CAR as taught by Xiao et al. and Brown et al. because said population of autologous or allogeneic human T cells would have advantageous therapeutic effectiveness of targeting IL13-Rα2, a tumor antigen expressed on gliomas and glioblastomas, and have antitumor efficacy as taught by Brown et al. (paragraph [0089]); and further, comprising a secretable human IFNγ as a therapeutic agent as taught by Xiao et al. would have the potential and advantage to induce or enhance T cell response, or enhance cancer treatment as taught by Xiao et al. (paragraphs [0111], [0118], [0138] and [0543]); and even further because administering autologous T cells provides high compatibility and safety from the patient's own body, while allogeneic T cells offer scalable, ready-to-use "off-the-shelf" treatments from healthy donors, and because Brown et al. teaches that a CAR that targets IL-13α2 exhibited anti-tumor efficacy in in vivo mouse models (Example 7, paragraphs [0083] and [0084] and Figure 8). Claim Rejections - 35 USC § 103 – Necessitated by Amendments (Second) Claims 1, 4, 23, 28, 47 and 50 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), Brown et al. (US20160340649A1 Date Published 2016-11-24) and Damask et al. (US20170029894A1 Date Published 2017-02-02) as applied to claims 1, 23 and 47 above and further in view of Qin et al. (PLoS One. 2010 May 12;5(5):e10611) and Kiani et al. (Blood (2001) 98 (5): 1480–1488). The teachings of Xiao et al., Brown et al. and Damask et al. have been described in the first 103 rejection above as applied to claims 1, 23 and 47. However, they also do not specifically teach that the nucleic acid molecule of the combined method comprises a first promoter that is a constitutive promoter and a second promoter that is an inducible promoter; or that the population of human T cells harboring the nucleic acid molecule of the combined method comprises a first promoter that is a constitutive promoter and a second promoter that is an inducible promoter. However, these deficiencies are remedied by the teachings of Qin et al. and Kiani et al. Qin et al. teaches that the EF1a promoter is a constitutive promoter in mammalian cells (Abstract). Therefore, Qin et al. confirms that the first promoter of EF1a in FIG. 8 for controlling the expression of the CAR as taught by Xiao et al. is a constitutive promoter Kiani et al. teaches that the NFAT promoter can regulate the expression of a variety of inducible genes that are cytokines (Abstract). They teach that NFAT is a major regulator of IFNγ production in T cells in vivo (Abstract). Therefore, Kiani et al. confirms that the second promoter of NFAT for controlling the expression of IFNγ as taught by Xiao et al. in FIG. 8 is an inducible promoter. One of ordinary skill in the art would have been motivated, with a reasonable expectation of success to perform the above combined method wherein the nucleic acid molecule comprises a first promoter that controls the expression of the CAR that is a constitutive promoter of EF1a as taught by Xiao et al. and Qin et al. and a second promoter that controls the expression of human IFNγ is under the control of an inducible promoter that is the NFAT-binding promoter as taught by Xiao et al. and Kiani et al. because of the advantage that a EF1α constitutive promoter affords in providing a steady, baseline expression of the CAR on the T cell surface of T cells harboring the nucleic acid molecule of the combined method, and because the inducible NFAT-binding promoter remains switched off until the CAR engages a tumor, thus IFN-γ expression and secretion of T cells harboring the nucleic acid molecule of the combined method is only triggered precisely at the tumor site when the CAR-T cell is engaged with its target antigen on cancer cells, maximizing local antitumor activity while keeping healthy cells safe. This is an example of (A) Combining prior art elements according to known methods to yield predictable results; and (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results. Claim Rejections - 35 USC § 103 – Necessitated by Amendments (Third) Claims 1, 21, 23, 45 and 47 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), Brown et al. (US20160340649A1 Date Published 2016-11-24) and Damask et al. (US20170029894A1 Date Published 2017-02-02) as applied to claims 1, 23 and 47 above and further in view of Wang et al. (Molecular Medicine Reports 9: 715-719, 2014). The teachings of Xiao et al., Brown et al. and Damask et al. have been described in the first 103 rejection above as applied to claims 1, 23 and 47. However, they do not specifically teach that the nucleic acid molecule of the combined method comprises a nucleotide sequence that encodes human IFNγ comprising a signal sequence for secretion; or that the population of human T cells harboring the nucleic acid molecule of the combined method comprises a nucleotide sequence encoding human IFNγ comprising a signal sequence for secretion. However, these deficiencies are remedied by the teachings of Wang et al. Wang et al. teaches that the native secretion signal peptide of hIFN-γ is encoded by the nucleic acid sequence of: ATGAAGTATACTAGTTACATCTTAGCCTTTCAATTGTGCATTGTTCTTGGTTCTTTGGGATGTTATTGT (Pg. 716 column left paragraph first “Construction of expression vectors”). It is noted that this nucleic acid sequence translates to the 23 amino acid sequence of MKYTSYILAFQLCIVLGSLGCYC (translation performed using Expasy Translate tool). Further, it is noted that the translated 23 amino acid signal peptide sequence of Wang et al. matches the first 23 amino acid sequence of SEQ ID NO: 328 taught by Xiao et al., which in turn matches instant SEQ ID NO: 29. Therefore, Wang et al. teaches that SEQ ID NO: 328 as taught by Xiao et al. as human IFNγ comprises a native signal peptide sequence for secretion. One of ordinary skill in the art would have been motivated, with a reasonable expectation of success to perform the above combined method wherein the nucleic acid molecule encodes IFNγ that comprises a signal sequence for secretion as taught by Wang et al. and Xiao et al. because Wang et al. teaches that the first 23-amino acid sequence of human IFNγ is the native secretion signal peptide, which means the nucleotide acid molecule of the combined method which comprises said signal peptide would have the advantage of having the intrinsic property of efficiently guiding the nascent human IFNγ to the endoplasmic reticulum (ER) ensuring proper folding, and directing secretion into the extracellular space upon expression within the T cells of the combined method. This is an example of (A) Combining prior art elements according to known methods to yield predictable results; and (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results. Claim Rejections - 35 USC § 103 – Necessitated by Amendments (Fourth) Claims 1, 21, 22, 23, 45, 46 and 47 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao et al. (US20200155598A1 Date Published 2021-02-16), Brown et al. (US20160340649A1 Date Published 2016-11-24), Damask et al. (US20170029894A1 Date Published 2017-02-02) and Wang et al. (Molecular Medicine Reports 9: 715-719, 2014).as applied to claims 1, 21, 23, 45 and 47 above and further in view of Zhang et al. (J Gene Med 2005; 7: 354–365). The teachings of Xiao et al., Brown et al., Damask et al. and Wang et al. have been described in the third 103 rejection above as applied to claims 1, 21, 23, 45 and 47. However, they do not specifically teach that the nucleic acid molecule of the combined method comprises a nucleotide sequence that encodes human IFNγ comprising a signal sequence that differs from the native human IFNγ signal sequence; or that the population of human T cells harboring the nucleic acid molecule of the combined method comprises a nucleotide sequence encodes human IFNγ comprising a signal sequence that differs from the native human IFNγ signal sequence. However, these deficiencies are remedied by the teachings of Zhang et al. Zhang et al. teaches that the IL-2 signal peptide sequence, which is different from native human IFNγ signal sequence, is a commonly used signal peptide to direct secretion of nascent peptides including those of investigated proteins placental alkaline phosphatase (AP) and endostatin (Abstract Background section). They further teach that modifications that increase both the basicity and hydrophobicity of the IL-2 signal peptide can augment the secretion of AP and endostatin from mammalian expression cells in vitro (Abstract Results section). One of ordinary skill in the art would have been motivated, with a reasonable expectation of success, to perform the above combined method wherein the nucleic acid molecule encodes human IFNγ native signal peptide sequence as taught by Xiao et al. and Wang et al. that is substituted by the IL-2 signal sequence as taught by Zhang et al. because Zhang et al. teaches that the IL-2 signal sequence is commonly used as a signal peptide to direct secretion of nascent peptides in mammalian cells and so the population of human T cells that harbor the nucleic acid molecule of the combined method that includes the substitution of IL-2 signal sequence of Zhang et al. could have the advantage of optimized and increased secretion efficiency and overall production yields of human IFNγ. This is an example of (B) Simple substitution of one known element for another to obtain predictable results. See MPEP 2143. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art, absent unexpected results. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Yie-Chia (Tonya) Lee (Tonya) whose telephone number is (571)272-0123. The examiner can normally be reached Monday - Friday 8.30a - 5.30p Eastern Time Zone. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached on 571-270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /YIE-CHIA LEE (TONYA)/Examiner, Art Unit 1642 /SEAN E AEDER/Primary Examiner, Art Unit 1642
Read full office action

Prosecution Timeline

Sep 27, 2023
Application Filed
Mar 06, 2026
Non-Final Rejection mailed — §103, §112
May 29, 2026
Response Filed
Sep 02, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723088
ANTIGEN BINDING MOLECULES AND METHODS THEREOF II
3y 1m to grant Granted Sep 01, 2026
Patent 12723099
TUMOR ACTIVATED ANTIBODIES TARGETING TROP2 AND USES THEREOF
3y 3m to grant Granted Sep 01, 2026
Patent 12703755
ANTIBODY TARGETING BCMA, BISPECIFIC ANTIBODY, AND USE THEREOF
4y 4m to grant Granted Aug 11, 2026
Patent 12692321
Antibodies and Antigen Binding Fragments Against CD155 Methods of Use Thereof
4y 11m to grant Granted Jul 28, 2026
Patent 12686708
PEPTIDE MARKERS TO TRACK GENETICALLY ENGINEERED CELLS
4y 7m to grant Granted Jul 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
69%
Grant Probability
99%
With Interview (+46.6%)
3y 6m (~6m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 39 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month