Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1. Election of group I with traverse is acknowledged. The traversal is based on the prior art cited in the international search report is not qualified as a prior art and the lack of unity based only on said prior art is not proper. The arguments were fully considered and found unpersuasive. The International search report indicates the said prior art as X category reference. The lack of unity based on the following prior art is proper.
Status of the Application
2. Claims 1, 2 (in-part) and 4-8, 9-13 (in-part) along with the elected SEQ ID Nos.1-3 are considered for examination. Claims 3 and 14-20 and non-elected SEQ Nos. are withdrawn from further consideration.
Priority
3. This application filed on September 29, 2023 is a 371 of PCT/US2022/023670 filed on April 06, 2021 which claims priority benefit of US 63/231,424 filed on August, 10, 2021; US 63/191,484 filed on May 21, 2021; and US 63/171,377 filed on April 06, 2021.
Objection to the Specification
4. The disclosure is objected to because of the following informalities:
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see at least para 00052, 00056). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Appropriate correction is required.
Claim Rejections - 35 USC § 103
5. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
A. Claims 1 and 4-7 are rejected under 35 U.S.C. 103 as being unpatentable over Ahmed et al. (MedRxiv, page 1-13, published online March 28, 2021) in view of Wangh et al (US 2004/0053254).
Ahmed et al. teach a method of claims 1, 4-7, for detecting SARS-CoV-2 mutations wherein the method comprises detecting mutations of codon 484 and 501 by real-time RT-PCR using a molecular beacon reporter probe (page 2, paragraph under methods section, page 4-5, paragraphs under methods section).
However, Ahmed et al. did not specifically teach asymmetric real-time PCR.
Wangh et al. teach an asymmetric real-time PCR comprising unequal primer concentrations of limiting primer and excess primers in the amplification process that result in single-stranded amplification products and detection of amplification products during amplification with one or more temperature dependent molecular beacon probes and melting curve analysis, which improves the detection of allele-discriminating sequences or variant sequences (para 0040-0043, 0046-0048, 0025-0010-0020, 0034-0035).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the invention to modify the method of Ahmed et al. with asymmetric real-time PCR as taught by Wangh et al. to develop an improved method for detecting variants. The ordinary person skilled in the art would have motivated to combine the method of Ahmed et al. with asymmetric real-time PCR as taught by Wangh et al. and have a reasonable expectation of success that the combination would result in an improved method for identifying allele variants because Wangh et al. explicitly taught that the method provides enhanced discrimination of allelic variants and real-time detection of low copy number variants (para 0040-0048) and such a modification of the claims is considered obvious over the cited art.
B. Claims 8 and 10-12 are rejected under 35 U.S.C. 103 as being unpatentable over Ahmed et al. (MedRxiv, page 1-13, published online March 28, 2021) in view of Wangh et al (US 2004/0053254) as applied to claims 1, 4-7 above, and further in view of Amendola et al. (Emerging Infectious Diseases, Vol. 27(2), p.648-650, February, 2021) and Lowe et al. (Nucleic Acids Research, Vol. 18, No. 7, page 1757-1761, 1990).
Ahmed et al. and Wangh et al. teach a method for detecting mutations of SARS-CoV-2 virus as discussed above. However, Ahmed et al. and Wangh et al. did not teach primer sequences of SEQ ID NO: 1 and 2.
Amendola et al. teach a method for detecting SARS-Cov-2 virus in a clinical sample, wherein Amendola et al. teach a nucleic acid sequence of S gene comprising the sequences of SEQ ID NO: 1 and 2 (page 649, paragraphs 2-3 indicating MW303957, which comprises the primer sequences of SEQ ID NO: 1 and 2, see the following sequence alignment).
For SEQ ID No: 1
MW303957
LOCUS MW303957 409 bp RNA linear VRL 10-DEC-2020
DEFINITION Severe acute respiratory syndrome coronavirus 2 isolate
SARS-CoV-2/human/ITA/SARS-CoV-2_Milan_Dec2019/2019 surface
glycoprotein (S) gene, partial cds.
ACCESSION MW303957; VERSION MW303957.1
KEYWORDS SOURCE Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2); ORGANISM Severe acute respiratory syndrome coronavirus 2 Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes; Nidovirales; Cornidovirineae; Coronaviridae; Orthocoronavirinae; Betacoronavirus; Sarbecovirus; Betacoronavirus pandemicum.
REFERENCE 1 (bases 1 to 409); AUTHORS Amendola,A., Bianchi,S., Gori,M., Colzani,D., Canuti,M., Borghi,E., Raviglione,M.C., Zuccotti,G.V. and Tanzi,E.
TITLE Evidence of SARS-CoV-2 RNA in an Oropharyngeal Swab Specimen, Milan, Italy, Early December 2019
JOURNAL Emerg Infect Dis 27 (2) (2021) In press;
Query Match 100.0%; Score 32; Length 409; Best Local Similarity 100.0%; Matches 32; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGAGAGATATTTCAACTGAAATCTATCAGGC 32
||||||||||||||||||||||||||||||||
Db 21 GAGAGAGATATTTCAACTGAAATCTATCAGGC 52
For SEQ ID NO: 2
Query Match 100.0%; Score 27; Length 409; Best Local Similarity 100.0%;
Matches 27; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AAAGTACTACTACTCTGTATGGTTGGT 27
|||||||||||||||||||||||||||
Db 168 AAAGTACTACTACTCTGTATGGTTGGT 142
Lowe et al. teach a method for designing primers and evaluating their performance wherein Lowe et al. disclose a computer program for rapid selection of oligonucleotide primers for polymerase chain reaction (see page 1757, col. 1, abstract). Lowe et al. teach that all primers designed for over 10 gene products were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size and also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1780, col. 2, paragraph 1).
It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the invention to modify the method of Ahmed et al. and Wangh et al. with the known gene sequence comprising the primer sequences of SEQ ID NO: 1 and 2 as taught by Amendola et al. and designing primers/ probes from a known sequence as taught by Lowe et al. to improve the specificity of detecting target nucleic acid variants in a sample. The ordinary person skilled in the art before the effective filling date of the invention would have motivated to generate primers and probe from a known sequence as taught by Lowe et al. and have a reasonable expectation of success that such primers/ probe generated using known sequence as taught by Amendola et al. would detect target nucleic acid. The claimed primers/probe are functional equivalents of the oligonucleotide sequence taught by Amendola et al. and Lowe et al. because primer sequences are known as taught by Amendola et al. and Lowe et al. explicitly taught generating primers/probe from a known sequence using the computer program which would specifically amplify the target sequence and all primers designed for over 10 gene products from known sequences were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1760, col. 2, paragraph 1) and such a modification of the known sequences to generate primers is considered obvious over the prior art.
Conclusion
Claims 2, 9 and 13 with elected SEQ NO 3 are free of prior art.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Suryaprabha Chunduru
Primary Examiner
Art Unit 1681
/SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681
Prosecution Insights