DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 04/13/2026. Claims 1-20 are currently pending. Claims 15-18 are withdrawn from prosecution as being drawn to nonelected
subject matter. Accordingly, claims 1-14, 19-20 are examined herein. The restriction requirement mailed on 04/02/2026 is still deemed proper. Applicant's elected Group I without traverse in the reply filed on 04/13/2026.
Election/Restrictions
Applicant's election without traverse of Group I in the reply filed on 04/13/2026 is acknowledged.
Claims 15-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being
drawn to a nonelected Group II, there being no allowable generic or linking claim.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Acknowledgment is made of applicant's claim for foreign priority based on an application filed in EP 21305513.0 on 04/19/2021. This application is a 371 of PCT/EP2022/060187 filed on 04/15/2022.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Drawings
The drawing is objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG.”. In the current case, the view number for Figure 1A-1F is preceded by the word "Figure" instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on pages 2, 31, 32. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The use of the terms Obatoclax, CoMMpass, MMRF, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 5-6, 10-11, 20 are rejected under 35 U.S.C. 103 as being unpatentable over Havens (Nucleic Acids Res. 2016;44(14):6549-63) in view of Decker (Mol Cancer Ther. 2014;13(5):1231-45), further in view of the PIM2 sequence NG_016262.2 (2020; NG_016262.2_2020.pdf listed in PTO-892).
Havens (2016) teaches that Inhibition of splicing using splice switching antisense oligonucleotides (SSOs) can be achieved by targeting the molecule to base-pair (i.e. target) at a splice site and that SSO-induced exon skipping can create a frame-shift in an mRNA in order to down-regulate (i.e. reduce) the expression of the mRNA (Page 6553, left column, 2nd ¶, first and last 4 lines; Figure 1), and highly conserved 5’ and 3’ splice sites on the 5’ and 3’ ends of introns (Page6549, right column, lines 18-19). Havens further teaches various administration routes for delivery of SSOs in patients, i.e. subjects in need thereof (Page 6551, right column, ¶2-4; 4th ¶ lines 13-14; Page 6554, Figure 3) and summarizes successful splice modulation by SSOs in vivo (Page 6552, Table 1). Havens does not teach reducing expression of PIM2 by administering an effective amount of at least one SSO targeting a splice site of an exon encoding the PIM2.
However, Decker (2014) teaches that PIM2 is elevated in malignant chronic lymphocytic leukemia (CLL) cells (Page 1235, Figure 1). Decker further teaches that three different small molecule PIM inhibitors induce apoptosis/cell death in CLL cancer cells (Page 1237, Figure 3), indicating that reducing PIM2 expression may have therapeutic impact on malignant B cell CLL.
Neither Havens nor Decker teaches the sequence or splice sites associated with exon-intron junctions of PIM2.
However, the PIM2 sequence NG_016262.2 (2020; NG_016262.2_2020.pdf listed in PTO-892) teaches the sequences of 6 exons encoding PIM2: Exon1 (5113-5363, 251nt=3x83+2nt), Exon2 (5492-5601, 110nt=3x36+2nt), Exon3 (6306-6356, 51nt=3x17nt), Exon 4 (8745-9117, 373nt=3x124+1nt), Exon5 (9566-9742, 177nt=3x59nt), Exon6 (9843-10955, 1113nt-3x371nt), and the nucleotide junction positions between adjacent exon and intron). Splice sites can be determined based on Havens’ teaching above.
Regarding claim 1, it would have been obvious to persons of ordinary skill in the art (PHOSITAs) before the effective filing date of the claimed invention to have taken Havens’ method for reducing gene expression by exon skipping and applied it to reduce expression of PIM2 by exon skipping because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to have induced exon skipping in PIM2 because Decker teaches that reducing PIM2 expression may have a therapeutic impact on malignant B cell CLL based on the successful demonstration of using small molecule PIM inhibitors, as discussed above. Since the prior art NG_016262.2 taught the PIM2 sequence including splice sites, then one would have had sufficient information to design the antisense oligonucleotide to target those splice sites. One would have had a reasonable expectation of success in reducing PIM2 expression in vivo because Havens describes successful splice modulation by antisense oligonucleotides in vivo.
Regarding claim 2, Decker further teaches that PIM2 is overexpressed in B-cell chronic lymphocytic leukemia (B-CLL), and PIM kinase inhibitors are an effective therapeutic option for CLL, in part by impairing PIM2/3-mediated CLL cell survival (Page 1231, Abstract), thereby providing motivation to apply SSO-induced exon skipping as a method of reducing expression of PIM2 in malignant B cells.
Regarding claim 3, as discussed above, Decker provides motivation for reducing PIM2 levels in malignant cells, such as malignant cells in B-cell CLL.
Regarding claim 5, Figure 2 (Page 6553) of Havens teaches RNA, DNA, and synthetic PMO-based building blocks for ASO and SSOs, indicating that some embodiments can be RNA-based.
Regarding claim 6, Havens teaches “The first SSO to be tested in a clinical trial for the treatment of DMD was a 31-mer oligodeoxynucleotide phosphorothioate (DNA/PS)” (Page 6555, left column, 2nd¶, lines 3-5), which provides an example of success and motivation for adopting DNA-based SSOs.
Regarding claim 10, the instant specification teaches that “stabilized” refers to “SSO stabilization can be accomplished via phosphate backbone modifications” (Page 9, lines 16-17). Havens (2016) further teaches a variety of chemical modifications including oligonucleotides with PS backbone modifications and other modification types (Page 6551, left column, section Common chemical modifications of splice-switching oligonucleotides).
Regarding claim 11, as discussed above, Decker (2016) teaches that “B-cell chronic lymphocytic leukemia (B-CLL) is the most prevalent adult leukemia” (Page 1231, Introduction, first 2 lines) and demonstrates that PIM2 is elevated in malignant CLL cells (Page 1235, Figure 1) collected from subjects suffering from the blood cell cancer, involving a human CLL cell line (Page 1232, under section Cell lines).
Regarding claim 20, as discussed above, B cell-CLL encompasses normal and malignant B cells based on the different PIM2 levels shown by Decker (2016; Figure 1, where normal lymphocytes that contain normal B cells are used as control).
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Havens (2016) in view of Decker (2014) and the PIM2 gene sequence NG_016262.2 (2020), as applied to claim 1-3, 5-6, 10-11, 20 above, and further in view of Smith (Bioessays. 2015; 37(6):612-23).
PNG
media_image1.png
857
506
media_image1.png
Greyscale
The teachings of Havens, Decker, and NG_016262.2 have been discussed above and applied herein. Havens (2016) further teaches the general mechanisms of exon skipping in Figure 1 (Page 6550, see below), which demonstrates that SSOs mediate the exon-skipping for a pre-mRNA having at least 3 exons with a targeted internal exon because the 1st and the last exons are required to ligate in order to complete the “skipping” of an internal exon, which must be 1 at the minimum (Figure 1, right panel). Decker further teaches a lack of target specificity by pan-PIM small molecule inhibitors (Page 1233, 1st¶), however, Havens teaches that “SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner” (Page 6549, Abstract, lines 15-17).
Neither Havens nor Decker teaches the mechanism of how exon-skipping reduces the expression of a target mRNA.
However, Smith (2015) teaches a process called nonsense-mediated RNA decay (NMD), through which mRNAs that terminate translation prematurely due to premature termination codons (PTCs) within their open reading frames (ORFs) are targeted for rapid degradation thereby preventing accumulation of truncated polypeptides, i.e. as a result of shortened ORFs (Page 612, Introduction, 1st ¶). Smith further teaches that “Skipping … of an exon of a nucleotide length that is not divisible by 3” results in frameshifts, PTCs, and NMD (Page 616, Figure 3).
Regarding claim 4, it would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have applied Havens’ SSO-induced exon skipping method to reduce PIM2 expression in cancer cells, based on the success of PIM inhibitors and clinical SSOs taught by Decker and Havens. According to NG_016262.2, the PIM2 splice sites are known and there are internal exons encoding PIM2 with nucleotide length not divisible by 3, hence there is reasonable expectation of success in obtaining SSOs to induce a reading frameshift, produce a PTC, shorten an ORF, and/or trigger NMD, thereby reducing PIM2 expression. Because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. Using base-pairing SSOs to improve the specificity of pan-PIM small molecule inhibitors further provides motivation.
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Havens (2016) in view of Decker (2014), Smith (2015), and NG_016262.2 (2020), as applied to claims 1-6, 10-11, 20 above, further in view of Lueck (Nat Commun. 2019;10(1):822).
The teachings of Havens (2016), Decker (2014), Smith (2015), and NG_016262.2 (2020) have been discussed above and applied herein. None of Havens, Decker, Smith or NG_016262.2 teaches what is a premature termination codon, i.e. PTC.
NG_016262.2 (2020) teaches that PIM2 has 6 exons, Exon1, Exon2, and Exon4 have nucleotide lengths not divisible by 3. However, only 4 exons are internal exons: Exon2, Exon3, Exon4, and Exon5.
Exon1 (5113-5363, 251nt=3x83+2nt), Exon2 (5492-5601, 110nt=3x36+2nt),
Exon3 (6306-6356, 51nt=3x17nt), Exon 4 (8745-9117, 373nt=3x124+1nt),
Exon5 (9566-9742, 177nt=3x59nt), Exon6 (9843-10955, 1113nt-3x371nt).
PNG
media_image2.png
68
662
media_image2.png
Greyscale
Hence, Exon2 and Exon4 are both eligible internal exon candidates for SSO-induced exon skipping in order to introduce a frameshift in the ORF of PIM2 mRNA after splicing. NG_016262.2 further teaches that the TAA codon immediately following the last amino acid of the PIM2 protein sequence is the normal termination codon corresponding to the nucleotide positions 10004-10006 in the Exon6 sequence of the PIM2 gene (see below). NG_016262.2 does not teach what is a PTC.
However, Lueck (2019) teaches that “Premature termination codons (PTCs) arise from single nucleotide mutations that convert a canonical triplet nucleotide codon into one of three stop codons, e.g., TAG, TGA, or TAA” (Page 2, first 2 lines). The term “premature” is interpreted as referring to any stop codon appearing, as a result of an exon-skipping-induced reading frameshift, ahead of the normal termination codon at nucleotide position 10004-10006 in the PIM2 gene (see above).
Since a reading frameshift does not guarantee that a PTC is produced. PHOSITAs could have performed the following exon-skipping induced reading frame shift analysis and would have predicted whether the SSO-induced skipping of an internal exon of PIM2, e.g. Exon2, but not Exon4, could have produced a PTC. PHOSITAs would have been motivated to use at least one SSO to target the Exon2 donor splice site to verify the prediction based on the reading frameshift analysis for Exon2 below:
Exon 3: 6306-6356
g tgg cca tca aag TGA ttc ccc gga atc gtg tgc tgg gct ggt ccc cct tg
Exon4: 8745-9117
8745 t cag act cag tca cat
8761 gcc cac tcg aag tcg cac tgc tat gga aag tgg gtg cag gtg gtg ggc acc ctg gcg tga
8821 tcc gcc tgc ttg act ggt ttg aga cac agg agg gct tca tgc tgg tcc tcg agc ggc ctt
8881 tgc ccg ccc agg atc tct ttg act ata tca cag aga agg gcc cac tgg gtg aag gcc caa
8941 gcc gct gct tct ttg gcc aag TAG tgg cag cca tcc agc act gcc att ccc gtg gag ttg
9001 tcc atc gtg aca tca agg atg aga aca tcc TGA tag acc tac gcc gtg gct gtg cca aac
9061 tca ttg att ttg gtt ctg gtg ccc tgc ttc atg atg aac cct aca ctg act ttg atg
Exon5: 9566-9742
9566 gga caa ggg tgt aca gcc ccc cag agt gga tct ct
9601 c gac acc agt acc atg cac tcc cgg cca ctg tct ggt cac tgg gca tcc tcc tct atg ac
9661 a tgg tgt gtg ggg aca ttc cct ttg aga ggg acc agg aga ttc tgg aag ctg agc tcc ac
9721 t tcc cag ccc atg tct ccc cag
Exon6: 9843-10955
9843 act gct gtg ccc TAA tcc gcc ggt gcc tgg ccc cca aac ctt ctt ccc gac cct cac t
9901 gg aag aga tcc tgc tgg acc cct gga tgc aaa cac cag ccg agg atg tac ccc tca acc c
9961 ct cca aag gag gcc ctg ccc ctt tgg cct ggt cct tgc tac ccT AAg cct ggc ctg gcc t
…
TAA (10004-10006) was the normal stop codon, but no longer so after reading frameshift
Regarding claim 7, it would have been obvious to PHOSITAs, before the effective filing date of the claimed invention, to have applied Havens’ SSO-induced exon skipping method to reduce PIM2 expression in cancer cells, based on the success of PIM inhibitors and clinical SSOs taught by Decker and Havens. Aided with the knowledge on splice sites, reading frameshift, PTCs, and NMD provided by NG_016262.2, Smith, and Lueck, PHOSITAs would have tested SSO-induced Exon2 and/or Exon4 skipping by using at least one SSO to target the Exon2 or Exon4 donor splice site, i.e. using a finite number of possible solutions to solve a known problem with predictable results, and would have arrived at the claimed invention with an “obvious to try” rationale with reasonable expectation for success.
Claims 8-9, 12-14, 19 are rejected under 35 U.S.C. 103 as being unpatentable over Havens (2016), in view of Decker (2014), Smith (2015), NG_016262.2 (2020), and Lueck (2019), as applied to claims 1-7, 10-11, 20 above, and further in view of Roca (Genes Dev. 2013 Jan 15;27(2):129-44), Hua (Am J Hum Genet. 2008 Apr;82(4):834-48) and Wang (J Cancer. 2021 Mar 5;12(9):2570-2581).
The teachings of Havens, Decker, Smith, NG_016262.2, and Lueck have been discussed above and applied herein. Havens further teaches that “SSOs are ASOs that are typically 15–30 nucleotides long and designed to base-pair … to the pre-mRNA” (Page 6550, Figure 1). None of Havens, Decker, Smith, NG_016262.2, or Lueck teaches the following limitations:
the minimal coverage required to target Exon2 donor splice site sequence, or
that an SSO is complementary to the nucleic acid sequence as shown in SEQ ID NO:2, or
that an SSO targets a PIM2 exon 2 donor splice site and comprises the sequence as set forth in SEQ ID NO:3, or
that PIM2 expression may serve as a therapeutic target in patients suffering from liver cancer or specific B-cell or plasma cell related malignancies, such as multiple myeloma, lymphoma, plasma disorder etc.
PNG
media_image3.png
166
409
media_image3.png
Greyscale
However, Roca (2013) teaches a 11nt consensus 5’ splice site (5’ss) motif from a recent collection of 201,541 human 5’ss sequences (Page 2, Figure 1B; see figure below); PHOSITAs would have been able to identify the minimum target region of 11nt DNA sequence of nucleotides 5599-5609 of the PIM2 gene Exon2 (NG_016262.2), caggtatccgt, encompassing the Exon2-Intron2 junction as the minimal required Exon2 donor splice site.
Hua (2008; full citation above) teaches a method of identifying effective ASOs by systematic tiling or a ASO Walk assay. The ASO Walk assay uses tiered coarse walk and finetuned high-resolution walk strategies to efficiently identify effective ASOs or SSOs that modulate splicing (Page 835, right column, 2nd ¶, lines 17-20). The high-resolution walk assay tiles base-pairing ASOs starting at every nucleotide along a minimal target region. Alternatively, a coarse walk assay that tiles ASOs at every 5-10 nucleotides (Page 835, right column, first 3 lines; Page 837, Figure 1; Page 843, Figure 7), which is considered a routine laboratory optimization option available for PHOSITAs. Neither Hua nor Roca teaches that reducing PIM2 expression may treat patients suffering from liver cancer, B-cell, or plasma cell related malignancies, such as multiple myeloma, lymphoma, plasma disorder etc.
However, Wang (2021) teaches a variety of cancers with overexpressed PIM2, including hepatocellular carcinoma (HCC) (Page 2, left column, first 4 lines, lines 7-8), CCL, Multiple Myeloma, cancers in liver, ovaries, prostate, breast, stomach, lung, etc. (Page 5, Table 1), both acute and chronic lymphoblastic leukemia (ALL and CLL, involving malignant B cells based on Decker), and Multiple Myeloma involving malignant plasma cells (Page 6, under sections: Leukemia, Multiple Myeloma).
Regarding claim 8, It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have applied Havens’ 15-30nt SSO-induced exon skipping method to reduce PIM2 expression in cancer cells, based on the success of prior arts Decker and Havens. Aided with the knowledge of the minimal target region of splice sites based on Roca, reading frameshift, PTCs, and NMD, provided by NG_016262.2, Smith, and Lueck, PHOSITAs could have followed the ASO walk strategies from Hua and would have tested SSO-induced Exon2 skipping by designing 15-30nt SSOs that tile the minimal region of the target splice site (see the list of designs of various lengths below), and identify a target region that offers the optimal exon skipping effect to reduce PIM2 expression, i.e. using a finite number of known possible solutions to solve a known problem by yielding predictable results. PHOSITAs would have arrived at the claimed invention with at least one SSO sequence complementary to the claimed target region sequence SEQ ID NO: 2, with an “obvious to try” rationale.
See the following known possible target regions with predictable results:
30nt x 20 (covering nucleotides 5580-5628 of NG_016262.2)
29nt x 19 (covering nucleotides 5581-5627)
28nt x 18 (covering nucleotides 5582-5626)
27nt x 17 (covering nucleotides 5583-5625)
26nt x 16 (covering nucleotides 5584-5624)
25nt x 15 (covering nucleotides 5585-5623)
24nt x 14 (covering nucleotides 5586-5622)
23nt x 13 (covering nucleotides 5587-5621)
22nt x 12 (covering nucleotides 5588-5620)
21nt x 11 (covering nucleotides 5589-5619)
20nt x 10 (covering nucleotides 5590-5618)
19nt x 9 (covering nucleotides 5591-5617)
18nt x 8 (covering nucleotides 5592-5616)
17nt x 7 (covering nucleotides 5593-5615)
16nt x 6 (covering nucleotides 5594-5614)
15nt x 5 (covering nucleotides 5595-5613)
At least one 23nt target would have 100% complementarity to the claimed SEQ ID NO: 2, i.e. the target region would have 100% alignment (as shown below) with the claimed SEQ ID NO: 2.
SEQ ID NO:2 1 GACTCCAGGTATCCGTCATGAGG 23
|||||||||||||||||||||||
one 23nt SSO target: 5594 GACTCCAGGTATCCGTCATGAGG 5616
Regarding claim 9, based on the analysis and the “obvious-to-try” rationale discussed above, at least some embodiments of SSO designs would have comprised the sequence set forth in SEQ ID NO: 3, cctcatgacggatacctggagtc, see alignment below against the target Exon2 donor splice site.
SEQ ID NO: 3 1 CCTCATGACGGATACCTGGAGTC 23
|||||||||||||||||||||||
NG_016262.2 5616 CCTCATGACGGATACCTGGAGTC 5594
“acggatacctg” is reverse complementary to the 11nt Exon2 donor splice site “caggtatccgt”.
Regarding claim 12, Wang (2021) teaches liver cancers and HCC, as discussed above.
Regarding claim 13, Wang (2021) teaches Multiple Myeloma and lymphomas, see above.
Regarding claim 14, Wang (2021) teaches Multiple Myeloma in the context of patients and clinical findings, see summary in Table 1 (Pages 5-6), as discussed above.
Regarding claim 19, as discussed above, Decker (2016) teaches B-cell chronic lymphocytic leukemia (B-CLL). Wang (2021) teaches that the accumulation of cancerous plasma cells is a characteristic of Multiple myeloma (MM) (Page 2575, 2nd ¶, lines 1-4). These diseases involve normal and malignant B cells or plasma cells respectively.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
US Patent US 10,398,722 B2
Claims 1-14, 19-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8 of U.S. Patent No. US 10,398,722 B2, in view of Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021). Although the claims at issue are not identical, they are not patentably distinct from each other.
US 10,398,722 B2 teaches Use of antisense oligonucleotides for producing truncated Ig by exon skipping for the treatment of diseases involving B cells (Front page, Title). US 10,398,722 B2 does not teach a method of reducing PIM2 expression by exon skipping in a subject in need thereof.
However, the collective teachings of Havens (2016), Decker (2014), Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021), already discussed above in the §103 rejection, provide guidance, examples, and motivations to use SSOs to induce exon skipping as a method to reduce PIM2 expression in a broad variety of cells in subjects in need thereof.
It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 10,398,722 B2, Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021), could then have modified the ASOs of US 10,398,722 B2 using the methods of Havens, Smith, and Hua, in view of the knowledge provided by NG_016262.2, Roca, Decker, Lueck, and Wang, to design SSOs targeting the 5’ss of the Exon1-Intron2 junction and induce skipping of the Exon2 of PIM2 in order to reduce the expression levels of PIM2 in a variety of cancer cell types, such as malignant HCC and liver cancer cells, malignant B cells in CLL or related lymphoblastic cancers, and malignant plasma cells in Multiple Myeloma, among other types, in an attempt to treat these cancers, and would have arrived at the claimed inventions with reasonable expectation of success.
Claims 1-14, 19-20 correspond to the claims 1-8 of US 10,398,722 B2.
US Application 18/044,698
Claims 1-14, 19-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. US Application 18/044,698, in view of Havens (2016), Decker (2014), Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021). Although the claims at issue are not identical, they are not patentably distinct from each other.
US Application 18/044,698 teaches a method of reducing the expression of a NF-B component in the B cells of a subject in need thereof comprising administering to the subject an effective amount of at least one splice switching antisense oligonucleotide targeting a splice site of one exon, or a splicing regulatory sequence, in the pre-mRNA molecule encoding fer the NF-B component to alter splicing by blocking the recognition of said splice site by splicing machinery and thus inducing the exon skipping and reducing expression of the NF-B component. US Application 18/044,698 does not teach a method of reducing PIM2 expression by exon skipping in a subject in need thereof.
However, the collective teachings of Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021), already discussed above in the §103 rejection, provide guidance, examples, and motivations to use SSOs to induce exon skipping as a method to reduce PIM2 expression in a broad variety of cells in subjects in need thereof.
It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US Application 18/044,698, Havens (2016), Decker (2014), Smith (2015), NG_016262.2 (2020), Lueck (2019), Roca (2013), Hua (2008), and Wang (2021), could then have modified the ASOs of US Application 18/044,698 using the methods of Havens, Smith, and Hua, in view of the knowledge provided NG_016262.2, Roca, Decker, Lueck, and Wang, to design SSOs targeting the 5’ss of the Exon1-Intron2 junction and induce skipping of the Exon2 of PIM2 in order to reduce the expression levels of PIM2 in a variety of cancer cell types, such as malignant HCC and liver cancer cells, malignant B cells in CLL or related lymphoblastic cancers, and malignant plasma cells in Multiple Myeloma, among other types, in an attempt to treat these cancers, and would have arrived at the claimed inventions with reasonable expectation of success.
Claims 1-14, 19-20 correspond to the claims 1-23 of US Application 18/044,698.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights