DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of Group II, claim 93, in the reply filed on 05/04/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). All claims of Group I are cancelled.
Species election of SEQ ID NOs: 58, 93, 246-253 is acknowledged. Claims 117-123 and 132-141 are withdrawn from consideration, because they are drawn to non-elected species.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 93, 112, 115-116, 124-131 are rejected under 35 U.S.C. 101 because the claimed invention is directed to natural product without significantly more.
The claim(s) recite(s) antisense oligonucleotides to a portion of human gene. Such oligonucleotides are compositions of matter, therefore satisfying Step 1 of eligibility analysis. Specification defines antisense oligonucleotide as oligonucleotide that hybridizes with a target nucleic acid sequence (see paragraph [0064]). Such oligonucleotide can be a portion of natural double-stranded DNA, forming any human gene, or portion of RNA transcribed from a gene. Such nucleic acid pieces are not structurally different if they are isolated from human genome. Therefore, the claimed antisense oligonucleotides are products of nature, satisfying Step 2A Prong One of eligibility analysis. Association for Molecular Pathologyv. Myriad Genetics Inc., 569 U.S. 576, 589-90 (2013) (naturally occurring things are "products of nature" which cannot be patented). Accordingly, the claims recite a judicial exception, and the analysis must therefore proceed to Step 2A Prong Two. For analysis in this Step this judicial exception is not integrated into a practical application because claims are drawn to simple products. Because the recited judicial exception is not integrated into practical application, the claims are still directed to judicial exception. Proceeding to Step 2B of eligibility analysis the claim(s) do not include additional elements that are sufficient to amount to significantly more than the judicial exception because other limitations in the claims simply define length or sequence of particular oligonucleotide, which are not sufficient to amount to significantly more.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 93, 112-114 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Cowan et al (WO 2017/077386, May 2017. It is noted that only first 100 pages of the very lengthy document are provided).
Concerning claims 93 and 112 Cowan disclose an oligonucleotide of SEQ ID NO: 63163 (see paragraph [00260], sequence listing), which is 22 nucleotides long and comprises 17 nucleotides of instant SEQ ID NO: 253:
SEQ ID NO: 253 1 CTATCCATCCATGTACTCACCCATC 25
|||| |||| ||| || ||||
SEQ ID NO: 63163 1 TCCACCCATCTACCCATTCATC 22
Concerning claims 113-114 Cowan disclose that the oligonucleotide can comprise 2’-methoxyethyl modification (see paragraph [00483]) and phosphorothioate linkages (see paragraph [0061]).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Prosecution Insights