DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 49, 52, 53, 55, 57-58, 67, 68, 82, 86, 93, 96, 105, 106, 114, 115, 130, 136-138 are pending and examined here.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Priority to Foreign App. AU2021901027, filed on 04/08/2021 is acknowledged (has ~140 sequences ) and AU20219303431, filed 10/27/2021 is acknowledged (has ~119 sequences). Currently all the claims have been given priority to the ‘027 filing.
However, it should be noted that the instant claimed invention has 213 sequences, thus it is possible the instant application has disclosed additional sequences not disclosed in prior applications. Thus based on examination of a specific sequence, the priority will be reassessed and will be given priority to the date when it was disclosed.
The claimed trinucleotide motifs are not disclosed in ‘027 (see pg. 113 of ‘027 for CUU, CUT, CTT, which do not appear to be claimed in instant application). However, the trinucleotide motifs appear to be disclosed in ‘431 filing, thus all claims enjoy the priority to 10/27/2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 10/06/2023, 01/06/2026, 01/09/2026 were filed before the mailing of this action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings or in the specification or claims are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Figures: The following figures have sequences greater than 9 nt. and require SEQ ID NOs (sequence identifiers): Figs. 2A, 2E, 2J, 4B, 4E, 4F, 4I, 4K, 6A, 6B, 6C, 6D, 6E, 16, 23, 30 and 40.
Claims: The claims lack sequence identifiers for sequences greater than 9 nt.: cl. 49, 82.
Specification: See page 22, line 36 to page 23, line 8; page 25, line 33 to page 26, line 5; page 27, lines 4 and 7; pages 28-30; which lack sequence identifiers for sequences greater than 9 nt.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 82, 49, 52, 53, 55, 57-58, 67, 68, 86, 93, 96, 105, 106, 114, 115, 130, 136-138 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Briefly, a skilled artisan cannot envision the claimed structure, the claimed sequence with the motif/sequence comprising a modified nucleotide (nt.), that results in fulfilling the claimed functional limitation of inhibiting TLR7 activity, thus, the specification lacked possession of the claimed invention, see discussion below.
Regarding instant cl. 82, the claim recites a functional limitation of “wherein the oligonucleotide inhibits TLR7 activity” (last line, cl. 82) that is based on an oligonucleotide comprising or consisting of the claimed motif or sequence (or at least about 75% sequence identity; based on specification about is defined as +/- 10%) and that the motif has at least one modified sugar or internucleotide linkage (INL) and the unmodified nt. is either RNA or DNA with phosphodiester INL. Thus, under BRI, the claim encompasses any oligonucleotide of indeterminate length comprising the specific motif/sequence or a variant with at least 65% identity with the motif/sequence comprising a modified nt. The recited functional characteristic does not follow from (is not an inherent property of) the structure recited in the claim; the >212 motifs/sequences claimed.
Under BRI, .e.g., a 3 nt. motif would require a 2 nt. identify that does not have to be contiguous, i.e. any 2 nt. identical anywhere along the 3 nt. motif/sequence, e.g. for GUA, it can be GU, GnA, nUA, etc. . .
Sarvestani et al. (2014, Nucleic Acids Res., 43, pg. 1177-1188 and 6 pg. of supplemental material, in IDS) illustrates the contrasting relationship of oligonucleotides containing the claimed modified motifs. The article illustrates that oligonucleotides comprising the modified motif does not result in the required inhibition of TLR7 activity.
TLR7 and TLR8 are Toll-like receptors 7 and 8, respectively, and are responsible for detecting pathogenic RNA by immune phagocytes (pg. 1178). Sarvestani discloses TLR7 and TLR8 “activation leads to the induction of a potent immune response mediated by pro-inflammatory cytokines, including interferon-alpha (IFN-α) and tumour necrosis factor alpha (TNF-α)” (pg. 1178). Further, 2OMe modified oligonucleotides, which “appear to bind more avidly to TLR7,” antagonize sensing of immunostimulatory RNAs (pg. 1178).
In their studies to identify motifs in 2OMe-modified or LNA/DNA-phosphorothioate antisense miRNA-oligonucleotides (AMOs) with ability to regulate TLR7 activity, the authors administered a stimulatory RNA (B-406AS-1) and subsequent treatment with modified AMOs to inhibit TLR7/8 sensing (pg. 1178). The results in vitro mice cells are noted below from Fig. 2:
PNG
media_image1.png
642
704
media_image1.png
Greyscale
Each AMO, targeting the miRNA noted on the x-axis above, has one or more of the claimed modified motif/sequences (see supplemental pg. 3 for Table S1, again, although only 2 nt. is required, most sequences have 3 or more; miR 200b-3p comprises modified GUAU). The authors note: “[t]he results from these experiments could be grouped into four classes of AMOs: (i) AMOs that had no impact on immunostimulatory ssRNA sensing, with either chemistry; (ii) AMOs that only had an inhibitory effect with the 2OMe chemistry; (iii) AMOs that only had an inhibitory effect with the LNA/DNA chemistry; and (iv) AMOs that had an inhibitory effect with both chemistries” (pg. 1180). According to the claimed language, all the sequences should be in class (iv), but they are not. Further, the activity also appears to be species dependent; the human cells used also provided distinct results. The results indicate that there are other factors besides the claimed motif sequences that are affecting TNF-alpha production.
Applicant' s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163).
In conclusion, the claimed broad genus of sequences with the claimed functional limitation is not deemed sufficient to reasonably convey to one skilled in the art that Applicant was in possession of the claimed broad genus at the time the application was filed. Thus cl. 82 and their dependents and claim 49 are rejected.
35 U.S.C. 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 68 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 68, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Further claim 68, recites “a phosphodiester” as a modified internucleotide linkage; phosphodiester is not known as a modified internucleotide linkage.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 49, 82, 86, 52, 53, 57, 58, 67, 68, 136, 137 rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature or a natural phenomenon without significantly more.
Claims 82, 57, and 58 recite an “oligonucleotide comprising or consisting of a motif or sequence GUA” (and other three nucleotide motifs) with a nucleotide (nt.) in the motif comprising a modified sugar and/or internucleotide linkage (INL) and U may be T or T may be U and unmodified nt. is either an RNA or DNA with phosphodiester linkage.
Here, although the claimed subject matter is a composition of matter, it is directed to the judicial exception as a law of nature or a natural phenomenon, i.e. a nature based product. The claimed characteristics are not markedly different from the product’s naturally occurring counterpart in the natural state; e.g., it can be naturally modified tRNAs.
Under BRI, the claimed oligonucleotide does not have an upper length limit (see also specification par. 510: oligonucleotide is at least 100 nt. in length), and the “about” of “about 75% sequence identity” is defined as +/- 10%, so a 3 nt. motif requires 2 nt. to match. The claimed oligonucleotide encompassing the modified three nucleotide motifs (GAC-194) can exist as or encompass a natural occurring oligonucleotide or a fragment or full length of a tRNA and the C of GAC is 2’-O-methyl modified (see arrow below on Lorenz Fig. 1A, and Fig. 2 noting that “m” after the nt. designation represents methylation at 2’-OH of the ribose). tRNA is recognized by endosomal TLR7 (see, e.g., Kaiser et al. (2014, RNA, 20, 1351-1355: A modified dinucleotide motif species tRNA recognition by TLR7, title)).
Fig. 1A from Lorenz et al. (2017, Biomolecules, 7, pg. 1-29, doi:10.3390/biom7020035)
PNG
media_image2.png
377
277
media_image2.png
Greyscale
The claims do not recite additional elements individually or in combination to integrate the exception into a practical application nor are there additional elements that are sufficient to amount to significantly more than the judicial exception.
Claims 82, 57, and 58 do not recite any additional elements that integrate the judicial exception into a practical application. Claim 86 only requires a composition comprising the oligonucleotide, the composition can be water or buffered environment not markedly different from a natural cytoplasm. Claims 52 and 53 provide further functional limitation that do not appear to alter the structure of claim 82. Also as noted above one of the sugar modification of the tRNA is 2’-O-methyl (relevant to cl. 67). Each nucleotide (nt.) of the tRNA comprises a phosphodiester INL (relevant to cl. 68). For instant cl. 136, 137, a bacteria comprising a tRNA sequence along with other RNA sequence would be an immunogenic composition. Kaiser notes that “[i]mmune activation via TLR7 can be triggered by any unmodified tRNA, as well as by many bacterial tRNAs that contain few modifications in comparison to the eukaryotic tRNA counterparts” (pg. 1352).
For the method cl. 49, the claim recites “a method for increasing the TLR7 inhibitory activity of an oligonucleotide, the method comprising modifying the oligonucleotide such that the modified oligonucleotide comprises a motif including” a selected claimed sequence or a variant having at least 75% sequence identity and the motif has one or more nt. that has a modified sugar and/or INL and a U may be T or T may be U.
Similarly as the analysis above, the claim is directed to a process but is directed to a judicial exception of a natural process. A bacterial infection and its tRNA post-transcriptionally modified by a natural process and the “increasing the TLR7 inhibitory activity” would be a natural result of the naturally occurring product. The claim does not integrate the exception into a practical application that is beyond the judicial exception nor has additional elements that are sufficient to amount to significantly more.
Therefore, claims 82, 86, 52, 53, 57, 58, 67, 68, 136, 137, 49 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon or a laws of nature without significantly more.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 82, 52, 53, 55, 57, 58, 67, 68, 86, 114, 115, 49 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Sarvestani et al. (2014, Nucleic Acid Res., 43, 1177-1188, in IDS).
Regarding instant cl. 82, 57, 58, 67, Sarvestani discloses various 2’-O-methyl (2OMe) modified anti-miRNA oligonucleotide (AMO) that affect TNF-a production; one is AMO targeting miR-92a-3p and its inhibition reduced TNF-a production by ~50% suggesting its involvement in regulating TLR7-mediated immune induction (pg. X, Fig. 1A). However, treatment with non-targeting control (“NC1”) 2OMe modified AMO resulted in the most potent inhibition of TNF-a production, “indicative of an off-target effect of this molecule on immunostimulatory ssRNA sensing” (pg. 1179-1180, Fig. 1A, C, relevant to instant cl. 67). The NC1 (GzCGUAUUAUAGCCGAUUAACGzA, cap. Letters indicate 2OMe modified nt. and z is ZEN groups) comprises the sequence GUAU (#182, interchangeably written as GUAU-182 and other 3 nt. claimed motifs and each nt. is 2OMe modified (relevant to instant cl. 82, 57 and 58; e.g., GUA-188, GCG-197, GAU-195, AUU-201, etc. . , relevant to instant cl. 82; AUU-201 is also relevant to instant cl. 57).
Regarding instant cl. 86, Sarvestani discloses resuspension of oligonucleotides in various types of buffers (pg. 1178)
Regarding instant cl. 52, Sarvestani discloses that NC1 and other AMOs do not bind to or are not designed to bind a transcript that encodes TLR7.
Regarding instant cl. 53, Sarvestani discloses that AMOs bind or are designed a target transcript that does not encode TLR7, i.e. they bind to miRNAs. (The specification does not clearly define a “transcript,” which usually is a mRNA or pre-mRNA, and miRNAs are known to be encoded within introns of pre-mRNA).
Regarding instant cl. 55 and 68, Sarvestani discloses AMOs that were modified with LNA/DNA, which has a 5’ region comprising one or more mod. nt. and a middle region comprising DNA, and a 3’ region comprising one or more modified nt. (i.e. +N=LNA modified nt.; lowercase for DNA, *=PS, pg. 3 of supplemental material, relevant to instant cl. 55, 68). A middle region comprising DNA is underlined. +T, at 5’ region, and +G, at 3’ end, are in bold.
AMO for miR-17-5p: c*+T*a*c*+C*t*g*+C*a*c*+T*g*t*+A*a*g*+C*a*c*+T*t*t*+G
Regarding instant cl. 114 and 115, Sarvestani discloses a method of inhibiting TLR7 activity in a cell, administrating an effective amount of AMO to counter the activity of B-406AS-1, an immunostimulatory RNA sequence, see NC1 effect on B-406AS-1, fig. 1A, Fig. 1C (pg. 1180, 1178) .
Regarding instant cl. 49, Sarvestani discloses AMOs that contain the trinucleotide motifs/sequences and disclose modifying the sequence of AMO to incorporate a trinucleotide motif/sequence (see miR-200a-3p mut 2 in Supp. Table S1, noting addition of GGU).
Claim 82, 55, 57, 67, 68, 86, 93, 96, 105, 106, 114, 115, 138 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kandimalla et al. (US20100041734, pub. 2/18/2010, “Kandimalla”).
Kandimalla discloses modulation of TLR7 expression by antisense oligonucleotides that specifically target TLR7 transcript to down regulate its expression (title, abstract). Kandimalla demonstrates in vivo that the administration of 4-12-4 gapmer ASO of SEQ ID NO: 261 with 4 nt. 5’ and 3’ wings modified with 2OMe and each INL is a phosphorothioate (par. 83) results in ~94% inhibition of TLR7/8 agonist IL-12 activity (par. 112, Fig. 4).
Regarding instant cl. 82, 55, 57, 67, 68 Kandimalla discloses a 4-12-4 ASO gapmer of SEQ ID NO: 261 (tggttgcctctgaactcccag), which has a GGT motif at the 5’ end that is modified with 2OMe.
Regarding instant cl. 86, Kandimalla discloses a composition of ASO targeting TLR7 (cl. 2).
Regarding instant cl. 93, Kandimalla discloses a method for therapeutically treating a mammal having one or more disease mediated by TLR7 by administration of ASO targeting TLR7 (cl. 13).
Regarding instant cl. 96, 114, and 138 Kandimalla discloses ASOs that inhibits expression of TLR7 following administration of the ASO targeting TLR7 to mice that were later treated with TLR7 agonist and demonstrating decreased IL-2 production (cl. 1, Ex. 3, Fig. 4).
Regarding instant cl. 105 and 106, Kandimalla discloses administering ASO targeting TLR7 for treatment of hepatitis (cl. 21).
Kandimalla discloses that TLR 7 agonist include single stranded RNA virus (see Table 1, par. 7, relevant to instant cl. 115).
Claim(s) 82, 86, 136 and 137 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Pepini et al. (2017, J. of Immunology, 198, 4012-4024).
Regarding instant cl. 82, 136 and 137, Pepini discloses that self-amplifying mRNA (SAM) establishes a temporary state that limits the initial SMA-encoded Ag (antigen) response and notes that minimizing the early type I IFN responses may be useful strategy to increase primary SAM expression and the resulting vaccine potency (abstract). They noted that a TLR7 antagonist, a fully methylated with phosphorothioate R006 sequence (5’-UUGUUGUUGUUGUUGUUGUUGUUGUU-3’), co-delivered with SAM vaccine impaired IFN-α and proinflammatory cytokines induction in hPBMCs and IFN-α in pDCs, suggesting a role for engagement of the TLR7 signaling pathways (pg. 4013, 4019, relevant to instant cl. 82, GUU-187 motif, cl. 136, and 137).
Regarding instant cl. 86, Pepini disclose delivering RNA/SAM with DOTAP or lipofectamine (pg. 4013).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 130 is rejected under 35 U.S.C. 103 as being unpatentable over Kandimalla et al. (US20100041734, pub. 2/18/2010, “Kandimalla”) and Ohlmann et al., 2014, Translation, 2, e960242, 1-12.
Kandimalla discloses ASOs that inhibits expression of TLR7 following administration of the ASO targeting TLR7 to mice that were later treated with TLR7 agonist and demonstrating decreased IL-2 production (cl. 1, Ex. 3, Fig. 4). Kandimalla discloses that TLR 7 agonist include single stranded RNA virus (see Table 1, par. 7).
Kandimalla does not disclose RNA is an exogenous mRNA molecule.
Ohlmann discloses that HIV-1 virus comprises of RNA that has a dual role as mRNA and genomic RNA (pg. 1).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have understood that Kandimalla’s ASO targeting TLR7 would also reduce IL-2 production in view of Ohlmann and arrive at the claimed invention with a reasonable expectation of success. Based on the teaching of Kandimalla that ASO that targets TLR7 reduces its expression with a reduced IL-2 production after treatment with TLR7 agonist and a ssRNA is also an agonist of TLR7, and since HIV-1 mRNA Is also a single stranded RNA as taught by Ohlmann, a skilled artisan would reasonably expect similar observation as Kandimalla of reduced production of IL-2 following exposure to HIV mRNA. Thus, cl. 130 is obvious.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Rejection based on Pat. 12,448,622
Claims 82, 52-53, 55, 58, 67, 68, 86, 93, 49, 105, 106, 114-115, 130, and 138, are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1,2, 15 of U.S. Patent No. 12,448,622 (“Hudson”). Although the claims at issue are not identical, they are not patentably distinct from each other.
PNG
media_image3.png
554
727
media_image3.png
Greyscale
Claims 1 and 2 of Hudson teach several modified gapmer sequences that are claimed in instant cl. 82. Claim 2 teaches several gapmers sequences:
SEQ ID NO: 196 UCCCAACTCTTCTAACUCGU,
SEQ ID NO: 185 UCUCUCTGGTCCCATCCCUU,
SEQ ID NO: 179 UCCCATCCCTTCTGCUGCCA and
SEQ ID NO: 59 (UCUCCATGTCCCAGGCCUCC), corresponding to the base sequence of instant sequence #s 63, 71, 68 and 25, respectively (there maybe others) of claim 82. The gapmers have 5 nt. flanking sequence that are 2OMe modified the central gap region has phosphorothioate INL. As noted in the 112(b) rejection above, since some of the sequences taught by Hudson are the same as instant claimed sequences, thus, possessing the same structural motif/sequences, they will necessarily perform the same function of TLR7 inhibition.
Regarding instant cl. 52, SEQ ID NO: 196 of Hudson is not fully complementary to a target region of TLR7 transcript NM_016562.4, thus is not designed to target TLR7.
Regarding instant cl. 53, SEQ ID NO: 59 of Hudson is the same as instant SEQ ID NO: 216, thus as evidenced by instant specification, SEQ ID NO: 216 targets CDKN2B.
Claim 2 gapmers correspond to instant cl. 55.
Claim 2 gapmer SEQ ID NO: 59, e.g., comprises the motif CCA, corresponding to instant cl. 57.
Claim 2 gapmer SEQ ID NO: 153 has a 2OMe modified GGU motif at the 3’ end, corresponding to instant cl. 58.
Claim 2 gapmer SEQ ID NO: 52, e.g. comprises 2OMe modification and phosphorothioate INL, corresponding to instant cl. 67, 68, respectively.
Claim 15 is a composition comprising claim 1 and a pharmaceutically acceptable carrier, it would be obvious to make composition of cl. 2 and a pharmaceutically acceptable carrier, corresponding to instant cl. 86.
Regarding instant cl. 49, 93, 105, 106, 114, 115, 130, and 138:
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
Here, Hudson is not a divisional of instant application and there is not a patentable distinction between instant method claims and Hudson’s product claims. Thus, claims 49, 93, 105, 106, 114, 115, 130, and 138 are obvious.
Claim 96 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim of U.S. Patent No. 12448622 (“Hudson”) as evidenced by Lu et al. (2/11/2021, Aging, 13, pg. 5650-5673). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding instant cl. 96, Hudson’s SEQ ID NO: 4 of cl. 2, as evidenced by instant specification targets cGAS expression (Table 1, ASO2-168) and as evidenced by Lu et al. (2/11/2021, Aging, 13, pg. 5650-5673) cGAS can result in up-regulated expression of TLRs, including TLR7 (Fig. 9 caption, pg. 5664); thus inhibition of cGAS by Hudson’s SEQ ID NO: 4 would also indirectly result in decrease of TLR7 expression.
Claims 136 and 137 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 16 of U.S. Patent No. 12448622 (“Hudson”) in view of Pepini et al. (2017, J. of Immunology, 198, 4012-4024).
Disclosure re Hudson concerning instant cl. 82, 86 is noted above. Claim 16 of Hudson discloses composition of claim 15, which further comprises an immune response modifier.
Hudson does not disclose an immunogenic composition comprising mRNA molecule and the oligonucleotide.
Pepini discloses that self-amplifying mRNA (SAM) establishes a temporary state that limits the initial SMA-encoded Ag (antigen) response and notes that minimizing the early type I IFN responses may be useful strategy to increase primary SAM expression and the resulting vaccine potency (abstract). They noted that a TLR7 antagonist, a fully methylated with phosphorothioate R006 sequence (5’-UUGUUGUUGUUGUUGUUGUUGUUGUU-3’), co-delivered with SAM vaccine impaired IFN-α and proinflammatory cytokines induction in hPBMCs and IFN-α in pDCs, suggesting a role for engagement of the TLR7 signaling pathways (pg. 4013, 4019, relevant to instant cl. 82, GUU-187 motif, cl. 136, and 137). Pepini disclose delivering RNA/SAM with DOTAP or lipofectamine (pg. 4013).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have combined a modified sequence of Hudson in view of Pepini and arrive at the claimed invention with a reasonable expectation of success. Pepini demonstrated that co-delivery of 2OMe and phosphorothioate modified R0006 RNA sequence with SAM vaccine impaired IFN-α and proinflammatory cytokines induction in hPBMCs and IFN-α in pDCs, suggesting a role for engagement of the TLR7 signaling pathways, and Hudson has a modified sequence comprising GUU motif, thus a skilled artisan would reasonably expect success in combining a modified sequence comprising GUU with the SAM vaccine to impair IFN-a induction in noted cells. Thus, cl. 136 and 137 are obvious.
Allowable Subject Matter
No claim allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Jennifer Dunston/ Supervisory Patent Examiner, Art Unit 1637