Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Status of the Claims Claims 1 – 26 are currently pending and are the subject of this Office Action. This is the first Office Action on the merits of the claims. Information Disclosure Statement The information disclosure statements filed on 10/09/2023 and 07/16/2024 do not fully comply with the requirements of 37 CFR 1.98(b) because: on the 10/09/2023, the first foreign patent document listed, JP4521748B2, is not in English. On the 07/16/2024 IDS, the references lined through do not include publication dates. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. In particular, FIGs. 8 – 10 and 19 – 2 2 include nucleotide sequences each having 10 or more nucleotides without sequence identifiers. In addition, the MSECs of present claim 1 that have 10 or more nucleotides should each have a sequence identifier. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Objections Claims 3 , 9 and 20 are objected to because of the following informalities: Claims 3 and 9 recite t he abbreviations , such as ACTA1, CKM, TNNT2, and TNNT , without defining the acronym. At the first use in the claims, these abbreviations should be written out in expanded form to improve clarity and readability of the claims. Appropriate correction is required. Claim 20 recites “copies the” i n the second line , and the phrase seems to be missing a linking word or a preposition , such as “of” , between “copies” and “the”. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 23 – 26 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) does/do not fall within at least one of the four categories of patent eligible subject matter because the claimed recitation of a use, without setting forth any steps involved in the process, results in an improper definition of a process, i.e., results in a claim which is not a proper process claim under 35 U.S.C. 101. See for example Ex parte Dunki , 153 USPQ 678 ( Bd.App . 1967) and Clinical Products, Ltd. v. Brenner , 255 F. Supp. 131, 149 USPQ 475 (D.D.C. 1966). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1 and 23 – 26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, specific MSECs are recited which, according to FIG. 27 of the present drawings represent specific sequences. However, claim 1 also recites “ an MSEC having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to MSEC-74” , which is broader than , for example, “ an artificial MSEC having a sequence as set forth in FIG. 27 for MSEC- 74 ”, which i s in similar language to how the other MSECs are claimed. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 1 recites the broad recitation of sequences that can be at least “ an MSEC having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to MSEC-74” , and the claim also recites specific MSECs representing specific sequences which is the narrower statement of the range/limitation. Also the range in the latter part of the claim is broader (90%) and narrower (99%) within itself , which adds to the indefiniteness of claim 1. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. In addition, the sequence identifiers of the MSECs listed in claim 1 should be recited in the claims. See Nucleotide and/or Amino Acid Sequence Disclosures above. Also, claim 1 depends on a figure ( FIG. 27 ) and is thus not complete in itself . “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parte Fressola , 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).” See 2173.05(s). Regarding c laims 23 – 26 , each claim attempts to claim a process without setting forth any steps involved in the process and is indefinite because it merely recites a use without any active, positive steps delimiting how this use is actually practiced. See MPEP 2173.05(q). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim 1 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by CHAMBERLAIN (WO 2002/06495-A2, published 01/24/2002 ; see PTO-892: Notice of References Cited ). The present application is directed to an artificial muscle-specific expression cassette (MSEC) having a sequence as set forth in FIG. 27 for MSEC-3363, . . . or MSEC-1027. According to the present specification, MSEC-3363 is represented by the sequence of SEQ ID NO: 372 (FIG. 27, p. 118 – 119 of the drawings). CHAMBERLAIN provides mutant muscle-specific enhancers, genetic cassettes, and vectors useful in gene therapy, diagnostic assays, and other gene expression systems (see p. 2, lines 10 – 12). CHAMBERLAIN teaches the employment of mutant MCK enhancers and genetic cassettes (which include the mutant enhancers) to drive the expression of various therapeutic nucleic acid sequences (e.g. heterologous genes) useful to a recipient subject (see p. 26, lines 13 – 16). Regarding claim 1, CHAMBERLAIN teaches the sequence of present SEQ ID NO: 372 with 100% identity. See Appendix. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 2 – 3, 9, 12 – 17 , and 23 – 26 are rejected under 35 U.S.C. 103 as being unpatentable over CHAMBERLAIN. The teachings of CHAMBERLAIN are discussed above and fully incorporated here. Although CHAMBERLAIN teaches the employment of mutant MCK enhancers and genetic cassettes (which include the mutant enhancers) to drive the expression of various therapeutic nucleic acid sequences (e.g. heterologous genes) useful to a recipient subject (see p. 26, lines 13 – 16), CHAMBERLAIN does not expressly teach the MSEC of present claim 2 as recited. Nonetheless, CHAMBERLAIN teaches a composition comprising nucleic acid, wherein said nucleic acid comprises a mutant muscle-specific enhancer region, a promoter region, a heterologous DNA sequence (see CHAMBERLAIN ’s claims 1, 8 – 9, 11 ). Because CHAMBERLAIN teaches the expression of various sequences (heterologous), transcription would result in a heterogenous cell population. Thus, it would have obvious to arrive to the MSEC of present claim 2 with the teachings of CHAMBERLAIN . Regarding claim s 3 and 9 , according to the present specification, CKM is an acronym for M-Creatine Kinase ( paragraph 0008 of the pre-grant publication ). CHAMBERLAIN teaches that the mouse muscle creatine kinase (MCK) gene includes a 206 base pair muscle-specific enhancer and a 358 base pair proximal promoter (see p. 18, last paragraph – p. 19, first paragraph of CHAMBERLAI N ) , rendering the CKM proximal promoter of present claim 3 and the mouse CKM 5’ enhancer of present claim 9 obvious. Regarding claim s 12 and 14 , CHAMBERLAIN teaches v arious methods for systemic administration of viral vectors (see p. 1, lines 17 – 20). Regarding claim 13, CHAMBERLAIN teaches vectors useful in gene therapy, diagnostic assays, and other gene expression systems (see abstract). Regarding claim 15, CHAMBERLAIN teaches that the expression vector is an adeno-associated virus (see CHAM B ERLAIN ’s claim 14). Regarding claim 16, CHAMBERLAIN teaches that the gene being encoded encompasses both cDNA and genomic forms of a given gene (see p. 11, lines 6 – 7). Regarding claim 17, CHAMBERLAIN teaches that gene expression products include reporter products, mRNA, protein, and the like (see p. 17, lines 14 – 15). Regarding claim 23, CHAMBERLAIN teaches that the disclosed regulatory elements drive expression in muscle cells, specifically (see p. 2, lines 3 – 6). Regarding claim 24 – 25, CHAMBERLAIN teaches that the disclosed regulatory elements that are tissue specific (e.g., muscle cell-specific) (see p. 2, lines 3 – 6), including, but not limited to, cells derived from skeletal muscle, smooth muscle (e.g. from the digestive tract, urinary bladder, and blood vessels), and cardiac muscle (see p. 17, lines 25 – 27). Regarding claim 26, CHAMBERLAIN teaches that the disclosed therapeutic nucleic acids include, but are not limited to, those encoding for proteins used for the treatment of musculoskeletal disorders (see p. 26, lines 21 – 24). It would have been prima facie obvious to the person of ordinary skill in the art to arrive at the claimed invention from the disclosure of CHAMBERLAIN . The artisan would have been motivated to make and use the invention as claimed because CHAMBERLAIN teaches mutant muscle-specific enhancers, genetic cassettes, and vectors useful in gene therapy, diagnostic assays, and other gene expression system . The artisan would have had a reasonable expectation of success because CHAMBERLAIN ’s MSEC is similar in structure. Claims 4 – 6 , 10 and 1 8 – 22 are rejected under 35 U.S.C. 103 as being unpatentable over CHAMBERLAIN as applied to claims 1 – 3, 9, 12 – 17, and 23 – 26 above, and further in view of QIAO ( WO 2021/021661 A1 , published 0 2 / 04 /2021; see PTO-892). The teachings of CHAMBERLAIN are discussed above and fully incorporated here. CHAMBERLAIN fails to teach the miniaturized and multimerized promoter s or enhancer s of present claims 4 – 6 and 10 – 11. QIAO is directed to nucleic acid expression cassettes that are engineered to enhance gene expression and teaches novel method of engineering tandem enhancer/ promoter elements and expressing transgenes for example within muscle cells, and delivery of therapeutics for treating various disorders. QIAO teaches that the cassettes are useful for delivery of transgenes to target cells and confers desirable properties for muscle-directed gene therapy. See abstract. QIAO teaches that regulatory elements can be a reduced or shortened version and referred to a s a “minimal promoter”. It would have been prima facie obvious to the person of ordinary skill in the art to arrive at the claimed invention from the disclosures of CHAMBERLAIN and QIAO . The artisan would have been motivated to make and use the MSECs of claims 4 – 5 because CHAMBERLAIN teaches an MSEC useful in gene therapy, diagnostic assays, and other gene expression systems and QIAO teaches muscle promoters that have been miniaturized (minimized) and are multimerized (in tandem) useful for delivery of transgenes to target cells and confers desirable properties for muscle-directed gene therapy. The artisan would have a reasonable expectation of success because QIAO successfully reduced to practice miniaturized and multimerized promoters that are efficient in gene expression. Regarding claim 6, QIAO teaches at least two promoters arranged in tandem (see claim 1 of QIAO ). Regarding claim 10, QIAO teaches that a minimal promoter comprises at least the transcriptionally active domain of the full-length version and is therefore still capable of driving expression (see paragraph 0068). Thus, it would have been obvious to one having ordinary skill in the art to produce a minimal/miniaturized enhancer via routine experimentation. Regarding claim 18, QIAO teaches two protein coding regions (see paragraph 0035) or teaches a cassette for the expression of two transcripts (see paragraph 00167). Regarding claim s 19 – 2 1 , QIAO teaches that the rAAVs can be used for in vivo delivery of transgenes for scientific studies such as gene knock-down with miRNAs, recombinase delivery for conditional gene deletion, gene editing with CRISPRs, and the like (see paragraph 00150), and teaches the expression of two transcripts (see paragraph 00167), it would have been obvious to add second coding sequence that encodes at least 1 miRNA target site. Furthermore , it would have been obvious from QIAO ’s teaching s that the disclosed expression cassette may be used to arrive to the MSEC of claim 21 where the microRNA target site that reduces the expression of another coding sequence ( such as the first coding sequence ) . Regarding claim 22, QIAO teaches the expression of at least two transcripts and the expression of microRNAs, recombinase delivery for conditional gene deletion, gene editing with CRISPRs, it would have been obvious that the two transcripts could be two different microRNAs. Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over CHAMBERLAIN as applied to claims 1 – 3, 9, 12 – 17, and 23 – 26 above, and further in view of Patikoglou ( Patikoglou GA, et al. TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. Genes Dev. 1999 Dec 15;13(24):3217-30 ; see PTO-892). The teachings of CHAMBERLAIN are discussed above and fully incorporated here. CHAMBERLAIN fails to teach a promoter that includes a TATA box mutation. PATIKOGLOU is directed to cocrystal structures of wild-type TATA box-binding protein (TBP) recognizing 10 naturally occurring TATA elements have been determined at 2.3–1.8 Å resolution, and compared with the 1.9 Å resolution structure of TBP bound to the Adenovirus major late promoter ( AdMLP ) TATA box (5′-TATAAAAG-3′). See abstract. PATIKOGLOU teaches how each position of the TATA box affects the structure and thus , the TBP - binding , of the TATA box (see TATA definition , p. 3226 – 3227 ). It would have been prima facie obvious to the person of ordinary skill in the art to arrive at the claimed invention from the disclosures of CHAMBERLAIN and PATIKOGLOU . The artisan would have been motivated to make and use the MSEC of claim 7 because CHAMBERLAIN teaches an MSEC useful in gene therapy, diagnostic assays, and other gene expression systems and PATIKOGLOU teaches a TATA box mutation that results in a more efficient interaction with the TBP. The artisan would have a reasonable expectation of success because PATIKOGLOU successfully produced promot e rs with TATA box mutations that caused better binding with TBP. Claim 8 is rejected under 35 U.S.C. 103 as being unpatentable over CHAMBERLAIN as applied to claims 1 – 3, 9, 12 – 17, and 23 – 26 above, and further in view of CHAN ( Chan RY, et al. An intronic enhancer containing an N-box motif is required for synapse- and tissue-specific expression of the acetylcholinesterase gene in skeletal muscle fibers. Proc Natl Acad Sci U S A. 1999 Apr 13;96(8):4627-32; see PTO-892). The teachings of CHAMBERLAIN is discussed above and fully incorporated here. CHAMBERLAIN fails to teach an MSEC w herein the promot e r has an N box ligation. CHAN is directed to deletion analysis that revealed that a 499-bp fragment located in the first intron of the AChE gene is essential for expression in muscle fibers and that disruption of an N-box motif located within this DNA fragment reduced by more than 80% the expression of the reporter gene in muscle . See abstract. It would have been prima facie obvious to the person of ordinary skill in the art to arrive at the claimed invention from the disclosures of CHAMBERLAIN and CHAN . The artisan would have been motivated to make and use the invention as claimed because CHAMBERLAIN teaches an MSEC useful in gene therapy, diagnostic assays, and other gene expression systems and CHAN teaches that the N-box of the muscle-specific enhancer is essential to expression of a gene . The artisan would have had a reasonable expectation of success based on the cumulative disclosures of these prior art references because CHAN shows better expression of the gene in muscle cells when the promoter has the N box. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over CHAMBERLAIN in view of QIAO as applied to claims 1 – 6, 10 and 12 – 26 above, and further in view of TAI (Tai PW, et al. Differentiation and fiber type-specific activity of a muscle creatine kinase intronic enhancer. Skelet Muscle. 2011 Jul 7;1:25 ; see PTO-892). The teachings of CHAMBERLAIN and QIAO are discussed above and fully incorporated here. Although CHAMBERLAIN teaches the MSEC of present claim 2 and QIAO teaches a miniaturized enhancer, n either CHAMBERLAIN nor QIAO teaches the CKM intron- 1 MR1 enhancer of present claim 11. TAI is directed to the m odulatory region 1 (MR1) , which is a 1-kb regulatory region within MCK intron 1 that is highly active in terminally differentiating skeletal myocytes in vitro and to the discovery that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers. See abstract. Regarding claim 11, because CHAMBERLAIN teaches an MSEC of claim 2; QIAO teaches the miniaturization of promoters and enhancer s that confers desirable properties for muscle-directed gene therapy ; and TAI teaches that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers, it would have been obvious that the enhancer in the MSEC is a miniaturized CKM intron- 1 MR1 enhancer. It would have been prima facie obvious to the person of ordinary skill in the art to arrive at the claimed invention from the disclosures of CHAMBERLAIN , QIAO , and TAI . The artisan would have been motivated to make and use the invention as claimed because CHAMBERLAIN teaches an MSEC useful in gene therapy, diagnostic assays, and other gene expression systems ; QIAO teaches miniaturized muscle enhancers that are useful for delivery of transgenes to target cells and confer desirable properties for muscle-directed gene therapy ; and TAI teaches that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers . The artisan would have had a reasonable expectation of success based on the cumulative disclosures of these prior art references because the references show enhancement of gene expression in muscle cells with the taught promoters and/or enhancers. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT Estella Gustilo whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (703)756-1706 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT Monday - Friday 9:30 AM - 5:30 PM . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT Gregory Emch can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT 571-272-8149 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ESTELLA M. GUSTILO/ Examiner, Art Unit 1646 /GREGORY S EMCH/ Supervisory Patent Examiner, Art Unit 1678 APPENDIX Alignment with SEQ ID NO: 372 (MSEC-3363) RESULT 2 AAL44595 (NOTE: this sequence has 6 duplicates in the database searched. See complete list at the end of this report) ID AAL44595 standard; DNA; 3357 BP. XX AC AAL44595; XX DT 11-JUN-2007 (revised) DT 26-APR-2002 (first entry) XX DE Murine muscle creatine kinase MCK transcriptional regulatory region. XX KW Muscle-specific enhancer; gene therapy; regulatory element; haemostatic ; KW antibacterial; antiviral; antitumour ; antiinflammatory ; anti-HIV; KW cytostatic; antilipemic; antidiabetic; antianaemic ; MCK; MCK-R; KW muscle creatine kinase control element; mouse; ds. XX OS Mus sp. XX FH Key Location/Qualifiers FT misc_signal 1.. 3350 FT /*tag= a FT /note= "transcriptional regulatory region" XX CC PN WO200206495-A2. XX CC PD 24-JAN-2002. XX CC PF 13-JUL-2001; 2001WO-US022092. XX PR 14-JUL-2000; 2000US-0218436P. XX CC PA (UNMI ) UNIV MICHIGAN. XX CC PI Chamberlain JS, Hauschka SD; XX DR WPI; 2002-171809/22. DR PC:NCBI; gi10129974. XX CC PT Composition comprising nucleic acid which comprises mutant muscle- CC PT specific enhancer region having two muscle creatine kinase-R control CC PT elements, useful in gene therapy, drug screening, and diagnostic assays. XX CC PS Example 2; Fig 1; 61pp; English. XX CC The present invention relates to a composition comprising a nucleic acid, CC where the nucleic acid contains a mutant muscle-specific enhancer region CC which comprises at least 2 muscle creatine kinase (MCK)-R control CC elements. The nucleic acid can be used in gene therapy, particularly CC where the therapy is directed at muscle cells and in the treatment of CC endocrine, metabolic, haematologic , cardiovascular, neurologic, CC musculoskeletal, urologic, pulmonary and immune disorders such as CC inflammatory diseases, autoimmune disease, chronic and infectious CC diseases such as AIDS, cancer, hypercholesterolaemia , insulin disorders CC such as diabetes, growth disorders, various blood disorders including CC anaemia , thalassaemia , haemophilia , genetic defects such as cystic CC fibrosis, Gaucher's disease, Hurler's disease, adenosine deaminase (ADA) CC deficiency, and emphysema. The present sequence is the murine MCK CC transcriptional regulatory region CC CC Revised record issued on 11-JUN-2007 : Enhanced with precomputed CC information from BOND. XX SQ Sequence 3357 BP; 858 A; 898 C; 809 G; 792 T; 0 U; 0 Other; Query Match 100.0%; Score 3355; Length 3357; Best Local Similarity 100.0%; Matches 3355; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATCCTGGTCTATAGAGAGAGTTCCAGAACAGCCAGGGCTACAGATAAACCCATCTGGAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3 ATCCTGGTCTATAGAGAGAGTTCCAGAACAGCCAGGGCTACAGATAAACCCATCTGGAAA 62 Qy 61 AACAAAGTTGAATGACCCAAGAGGGGTTCTCAGAGGGTGGCGTGTGCTCCCTGGCAAGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 63 AACAAAGTTGAATGACCCAAGAGGGGTTCTCAGAGGGTGGCGTGTGCTCCCTGGCAAGCC 122 Qy 121 TATGACATGGCCGGGGCCTGCCTCTCTCTGCCTCTGACCCTCAGTGGCTCCCATGAACTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 123 TATGACATGGCCGGGGCCTGCCTCTCTCTGCCTCTGACCCTCAGTGGCTCCCATGAACTC 182 Qy 181 CTTGCCCAATGGCATCTTTTTCCTGCGCTCCTTGGGTTATTCCAGTCTCCCCTCAGCATT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 183 CTTGCCCAATGGCATCTTTTTCCTGCGCTCCTTGGGTTATTCCAGTCTCCCCTCAGCATT 242 Qy 241 CCTTCCTCAGGGCCTCGCTCTTCTCTCTGCTCCCTCCTTGCACAGCTGGCTCTGTCCACC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 243 CCTTCCTCAGGGCCTCGCTCTTCTCTCTGCTCCCTCCTTGCACAGCTGGCTCTGTCCACC 302 Qy 301 TCAGATGTCACAGTGCTCTCTCAGAGGAGGAAGGCACCATGTACCCTCTGTTTCCCAGGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 303 TCAGATGTCACAGTGCTCTCTCAGAGGAGGAAGGCACCATGTACCCTCTGTTTCCCAGGT 362 Qy 361 AAGGGTTCAATTTTTAAAAATGGTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 363 AAGGGTTCAATTTTTAAAAATGGTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTT 422 Qy 421 TTTCAAGACAGGGCTCCTCTGTGTAGTCCTAACTGTCTTGAAACTCCCTCTGTAGACCAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 423 TTTCAAGACAGGGCTCCTCTGTGTAGTCCTAACTGTCTTGAAACTCCCTCTGTAGACCAG 482 Qy 481 GTCGACCTCGAACTCTTGAAACCTGCCACGGACCACCCAGTCAGGTATGGAGGTCCCTGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 483 GTCGACCTCGAACTCTTGAAACCTGCCACGGACCACCCAGTCAGGTATGGAGGTCCCTGG 542 Qy 541 AATGAGCGTCCTCGAAGCTAGGTGGGTAAGGGTTCGGCGGTGACAAACAGAAACAAACAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 543 AATGAGCGTCCTCGAAGCTAGGTGGGTAAGGGTTCGGCGGTGACAAACAGAAACAAACAC 602 Qy 601 AGAGGCAGTTTGAATCTGAGTGTATTTTGCAGCTCTCAAGCAGGGGATTTTATACATAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 603 AGAGGCAGTTTGAATCTGAGTGTATTTTGCAGCTCTCAAGCAGGGGATTTTATACATAAA 662 Qy 661 AAAAAAAAAAAAAAAAAAACCAAACATTACATCTCTTAGAAACTATATCCAATGAAACAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 663 AAAAAAAAAAAAAAAAAAACCAAACATTACATCTCTTAGAAACTATATCCAATGAAACAA 722 Qy 721 TCACAGATACCAACCAAAACCATTGGGCAGAGTAAAGCACAAAAATCATCCAAGCATTAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 723 TCACAGATACCAACCAAAACCATTGGGCAGAGTAAAGCACAAAAATCATCCAAGCATTAC 782 Qy 781 AACTCTGAAACCATGTATTCAGTGAATCACAAACAGAACAGGTAACATCATTATTAATAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 783 AACTCTGAAACCATGTATTCAGTGAATCACAAACAGAACAGGTAACATCATTATTAATAT 842 Qy 841 AAATCACCAAAATATAACAATTCTAAAAGGATGTATCCAGTGGGGGCTGTCGTCCAAGGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 843 AAATCACCAAAATATAACAATTCTAAAAGGATGTATCCAGTGGGGGCTGTCGTCCAAGGC 902 Qy 901 TAGTGGCAGATTTCCAGGAGCAGGTTAGTAAATCTTAACCACTGAACTAACTCTCCAGCC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 903 TAGTGGCAGATTTCCAGGAGCAGGTTAGTAAATCTTAACCACTGAACTAACTCTCCAGCC 962 Qy 961 CCATGGTCAATTATTATTTAGCATCTAGTGCCTAATTTTTTTTTATAAATCTTCACTATG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 963 CCATGGTCAATTATTATTTAGCATCTAGTGCCTAATTTTTTTTTATAAATCTTCACTATG 1022 Qy 1021 TAATTTAAAACTATTTTAATTCTTCCTAATTAAGGCTTTCTTTACCATATACCAAAATTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1023 TAATTTAAAACTATTTTAATTCTTCCTAATTAAGGCTTTCTTTACCATATACCAAAATTC 1082 Qy 1081 ACCTCCAATGACACACGCGTAGCCATATGAAATTTTATTGTTGGGAAAATTTGTACCTAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1083 ACCTCCAATGACACACGCGTAGCCATATGAAATTTTATTGTTGGGAAAATTTGTACCTAT 1142 Qy 1141 CATAATAGTTTTGTAAATGATTTAAAAAGCAAAGTGTTAGCCGGGCGTGGTGGCACACGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1143 CATAATAGTTTTGTAAATGATTTAAAAAGCAAAGTGTTAGCCGGGCGTGGTGGCACACGC 1202 Qy 1201 CTTTAATCCCTGCACTCGGGAGGCAGGGGCAGGAGGATTTCTGAGTTTGAGGCCAGCCTG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1203 CTTTAATCCCTGCACTCGGGAGGCAGGGGCAGGAGGATTTCTGAGTTTGAGGCCAGCCTG 1262 Qy 1261 GTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAACCCC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1263 GTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAACCCC 1322 Qy 1321 CCACCCCCCAAAAAAAGCAAAGTGTTGGTTTCCTTGGGGATAAAGTCATGTTAGTGGCCC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1323 CCACCCCCCAAAAAAAGCAAAGTGTTGGTTTCCTTGGGGATAAAGTCATGTTAGTGGCCC 1382 Qy 1381 ATCTCTAGGCCCATCTCACCCATTATTCTCGCTTAAGATCTTGGCCTAGGCTACCAGGAA 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1383 ATCTCTAGGCCCATCTCACCCATTATTCTCGCTTAAGATCTTGGCCTAGGCTACCAGGAA 1442 Qy 1441 CATGTAAATAAGAAAAGGAATAAGAGAAAACAAAACAGAGAGATTGCCATGAGAACTACG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1443 CATGTAAATAAGAAAAGGAATAAGAGAAAACAAAACAGAGAGATTGCCATGAGAACTACG 1502 Qy 1501 GCTCAATATTTTTTCTCTCCGGCGAAGAGTTCCACAACCATCTCCAGGAGGCCTCCACGT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1503 GCTCAATATTTTTTCTCTCCGGCGAAGAGTTCCACAACCATCTCCAGGAGGCCTCCACGT 1562 Qy 1561 TTTGAGGTCAATGGCCTCAGTCTGTGGAACTTGTCACACAGATCTTACTGGAGGTGGTGT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1563 TTTGAGGTCAATGGCCTCAGTCTGTGGAACTTGTCACACAGATCTTACTGGAGGTGGTGT 1622 Qy 1621 GGCAGAAACCCATTCCTTTTAGTGTCTTGGGCTAAAAGTAAAAGGCCCAGAGGAGGCCTT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1623 GGCAGAAACCCATTCCTTTTAGTGTCTTGGGCTAAAAGTAAAAGGCCCAGAGGAGGCCTT 1682 Qy 1681 TGCTCATCTGACCATGCTGACAAGGAACACGGGTGCCAGGACAGAGGCTGGACCCCAGGA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1683 TGCTCATCTGACCATGCTGACAAGGAACACGGGTGCCAGGACAGAGGCTGGACCCCAGGA 1742 Qy 1741 ACACCTTAAACACTTCTTCCCTTCTCCGCCCCCTAGAGCAGGCTCCCCTCACCAGCCTGG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1743 ACACCTTAAACACTTCTTCCCTTCTCCGCCCCCTAGAGCAGGCTCCCCTCACCAGCCTGG 1802 Qy 1801 GCAGAAATGGGGGAAGATGGAGTGAAGCCATACTGGCTACTCCAGAATCAACAGAGGGAG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1803 GCAGAAATGGGGGAAGATGGAGTGAAGCCATACTGGCTACTCCAGAATCAACAGAGGGAG 1862 Qy 1861 CCGGGGGCAATACTGGAGAAGCTGGTCTCCCCCCAGGGGCAATCCTGGCACCTCCCAGGC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1863 CCGGGGGCAATACTGGAGAAGCTGGTCTCCCCCCAGGGGCAATCCTGGCACCTCCCAGGC 1922 Qy 1921 AGAAGAGGAAACTTCCACAGTGCATCTCACTTCCATGAATCCCCTCCTCGGACTCTGAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1923 AGAAGAGGAAACTTCCACAGTGCATCTCACTTCCATGAATCCCCTCCTCGGACTCTGAGG 1982 Qy 1981 TCCTTGGTCACAGCTGAGGTGCAAAAGGCTCCTGTCATATTGTGTCCTGCTCTGGTCTGC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1983 TCCTTGGTCACAGCTGAGGTGCAAAAGGCTCCTGTCATATTGTGTCCTGCTCTGGTCTGC 2042 Qy 2041 CTTCCACAGCTTGGGGGCCACCTAGCCCACCTCTCCCTAGGGATGAGAGCAGCCACTACG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2043 CTTCCACAGCTTGGGGGCCACCTAGCCCACCTCTCCCTAGGGATGAGAGCAGCCACTACG 2102 Qy 2101 GGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2103 GGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAA 2162 Qy 2161 TTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTCACCCCC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2163 TTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTCACCCCC 2222 Qy 2221 ACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2223 ACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATA 2282 Qy 2281 ACCCTGTCCCTGGTGGATCCAGGGTGAGGGGCAGGCTGAGGGCGGCCACTTCCCTCAGCC 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2283 ACCCTGTCCCTGGTGGATCCAGGGTGAGGGGCAGGCTGAGGGCGGCCACTTCCCTCAGCC 2342 Qy 2341 GCAGGTTTGTTTTCCCAAGAATGGTTTTTCTGCTTCTGTAGCTTTTCCTGTCAATTCTGC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2343 GCAGGTTTGTTTTCCCAAGAATGGTTTTTCTGCTTCTGTAGCTTTTCCTGTCAATTCTGC 2402 Qy 2401 CATGGTGGAGCAGCCTGCACTGGGCTTCTGGGAGAAACCAAACCGGGTTCTAACCTTTCA 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2403 CATGGTGGAGCAGCCTGCACTGGGCTTCTGGGAGAAACCAAACCGGGTTCTAACCTTTCA 2462 Qy 2461 GCTACAGTTATTGCCTTTCCTGTAGATGGGCGACTACAGCCCCACCCCCACCCCCGTCTC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2463 GCTACAGTTATTGCCTTTCCTGTAGATGGGCGACTACAGCCCCACCCCCACCCCCGTCTC 2522 Qy 2521 CTGTATCCTTCCTGGGCCTGGGGATCCTAGGCTTTCACTGGAAATTTCCCCCCAGGTGCT 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2523 CTGTATCCTTCCTGGGCCTGGGGATCCTAGGCTTTCACTGGAAATTTCCCCCCAGGTGCT 2582 Qy 2581 GTAGGCTAGAGTCACGGCTCCCAAGAACAGTGCTTGCCTGGCATGCATGGTTCTGAACCT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2583 GTAGGCTAGAGTCACGGCTCCCAAGAACAGTGCTTGCCTGGCATGCATGGTTCTGAACCT 2642 Qy 2641 CCAACTGCAAAAAATGACACATACCTTGACCCTTGGAAGGCTGAGGCAGGGGGATTGCCA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2643 CCAACTGCAAAAAATGACACATACCTTGACCCTTGGAAGGCTGAGGCAGGGGGATTGCCA 2702 Qy 2701 TGAGTGCAAAGCCAGACTGGGTGGCATAGTTAGACCCTGTCTCAAAAAACCAAAAACAAT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2703 TGAGTGCAAAGCCAGACTGGGTGGCATAGTTAGACCCTGTCTCAAAAAACCAAAAACAAT 2762 Qy 2761 TAAATAACTAAAGTCAGGCAAGTAATCCTACTCGGGAGACTGAGGCAGAGGGATTGTTAC 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2763 TAAATAACTAAAGTCAGGCAAGTAATCCTACTCGGGAGACTGAGGCAGAGGGATTGTTAC 2822 Qy 2821 ATGTCTGAGGCCAGCCTGGACTACATAGGGTTTCAGGCTAGCCCTGTCTACAGAGTAAGG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2823 ATGTCTGAGGCCAGCCTGGACTACATAGGGTTTCAGGCTAGCCCTGTCTACAGAGTAAGG 2882 Qy 2881 CCCTATTTCAAAAACACAAACAAAATGGTTCTCCCAGCTGCTAATGCTCACCAGGCAATG 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2883 CCCTATTTCAAAAACACAAACAAAATGGTTCTCCCAGCTGCTAATGCTCACCAGGCAATG 2942 Qy 2941 AAGCCTGGTGAGCATTAGCAATGAAGGCAATGAAGGAGGGTGCTGGCTACAATCAAGGCT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2943 AAGCCTGGTGAGCATTAGCAATGAAGGCAATGAAGGAGGGTGCTGGCTACAATCAAGGCT 3002 Qy 3001 GTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3003 GTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGA 3062 Qy 3061 CTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAG 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3063 CTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAG 3122 Qy 3121 ACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGG 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3123 ACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGG 3182 Qy 3181 CCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGA 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3183 CCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGA 3242 Qy 3241 GCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCA 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3243 GCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCA 3302 Qy 3301 CACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 3355 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3303 CACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 3357