Prosecution Insights
Last updated: August 15, 2026
Application No. 18/287,260

COMPOSITIONS AND METHODS FOR INHIBITING COMPLEMENT COMPONENT 3 EXPRESSION

Non-Final OA §102§103
Filed
Oct 17, 2023
Priority
Apr 20, 2021 — provisional 63/177,254 +1 more
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Astrazeneca Ireland Limited
OA Round
1 (Non-Final)
60%
Grant Probability
Moderate
1-2
OA Rounds
9m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 60% of resolved cases
60%
Career Allowance Rate
35 granted / 58 resolved
At TC average
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
47 currently pending
Career history
107
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
38.6%
-1.4% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
28.6%
-11.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 58 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claims to priority from US Provisional Application No. 63/177,254 filed 04/20/2021 and from International Application No. PCT/US2022/025648 filed 04/20/2022 is hereby acknowledged. Election/Restrictions Applicant’s election without traverse of Invention Group I (claims 1-2, 7-8, 11, 22, 25, 29, 38, 47, 50, 61, 64, 66, 88 and 92, drawn to an RNAi oligonucleotide, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition or a kit comprising said RNAi oligonucleotide, for reducing complement component C3 (C3) expression) and Species Group A (claims 61 and 64, drawn to an oligonucleotide with a sense strand and a corresponding antisense strand with SEQ ID NOs: 1 and 3) in the reply filed on 06/17/2026 is acknowledged. Claims 67-68, 76 and 82 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 06/17/2026. Application Status The instant Application is a National Entry stage Application under 35 U.S.C. 371 of International Application PCT/US2022/025648 filed 04/20/2022. Preliminary amendments to claims filed 05/20/2024 are hereby acknowledged. Claims 3-6, 9-10, 12-21, 23-24, 26-28, 30-37, 39-46, 48-49, 51-60, 62-63, 65, 69-75, 77-81, 83-87, 89-91 and 93 are cancelled. Claims 2, 7-8, 11, 22, 25, 29, 38, 47, 50, 61, 64*, 66-68, 76, 82, 88 and 92 are currently amended (* claim was clearly amended as compared to claims filed 10/17/2023). Therefore, claims 1-2, 7-8, 11, 22, 25, 29, 38, 47, 50, 61, 64, 66-68, 76, 82, 88 and 92 are pending. Claims 67-68, 76 and 82 are withdrawn, therefore claims 1-2, 7-8, 11, 22, 25, 29, 38, 47, 50, 61, 64, 66, 88 and 92 are under consideration in this Office Action. Information Disclosure Statement The information disclosure statements (IDSs) submitted on 01/17/2025 and 06/17/2026 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Drawings The Drawings filed 10/17/2023 are objected to for the reason described below. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings (Fig. 1E, Fig. 4A) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specification The Specification is objected to for the following reason: The use of the terms “Luxol fast blue” (page 15, line 1; page 76, lines 18-19), “Megalign” (page 26, line 20), “Cremophor EL” (page 58, line 24), “Lipofectin”, “Oligofectamine”, “FuGene”, “Lipofectamine” (page 59, lines 24-26), “High-Capacity” page 61, line 15), “Maestro Software” (page 61, line 18), “GraphPad Prism” (page 61, line 19), “Amersham Source 15Q” (page 70, line 29), which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-2, 22, 25, 38, 47, 50, 66 and 92 are rejected under 35 U.S.C. § 102(a)(1) as being anticipated by Hinkle (Hinkle, G. et al. WO 2019/089922 A1, published May 9, 2019; cited on IDS filed 06/17/2026). Regarding claim 1, Hinkle teaches an RNAi oligonucleotide, or a pharmaceutically acceptable salt thereof, for reducing complement component C3 (C3) expression (see title and abstract; see page 61, lines 27-28 and page 74, lines 35-36). Hinkle also teaches that the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a C3 mRNA target sequence of instant SEQ ID NO: 13, and wherein the region of complementarity is at least 15 contiguous nucleotides in length (see Hinkle’s claims 1 and 2; see Table 3, page 113). In Table 3, page 113, Hinkle teaches a double-stranded oligonucleotide AD-76584, composed of sense strand of SEQ ID NO: 222 and an antisense strand of SEQ ID NO: 490. Alignment of Hinkle’s SEQ ID NO: 222 (Db; Database) with instant Application’s SEQ ID NO: 13 (Qy; Query) is shown below: Query Match 90.0%; Score 18; DB 1; Length 19; Best Local Similarity 77.8%; Matches 14; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 3 CAACTCACCTGTAATAAA 20 ||||:||||:|:||:||| Db 1 CAACUCACCUGUAAUAAA 18 The alignment clearly shows an RNA sequence corresponding to the targeted sequence of C3 mRNA set forth in instant SEQ ID NO: 13, having similarity over 18 contiguous nucleotides. Regarding claim 2, Hinkle teaches RNAi oligonucleotides that have a sense strand between 15 and 50 nucleotides in length and an antisense strand between 15 to 30 nucleotides in length; see Table 3. Hinkle’s AD-76584 has a sense strand that is 19 nucleotides in length and an antisense strand that is 19 nucleotides in length as well (see page 113; SEQ ID Nos: 222 and 490). Regarding claim 22, Hinkle teaches RNAi oligonucleotides that comprise at least one modified nucleotide (see Table 4, page 121; AD-76584, SEQ ID Nos: 758 and 1026; and see Hinkle’s claim 3). Regarding claim 25, Hinkle teaches RNAi oligonucleotides wherein the modified nucleotide comprises a 2’-modification, wherein the 2’-modification is a modification selected from 2’-aminoethyl, 2’-fluoro, 2’-O-methyl, and 2’-O-methoxyethyl, (see Hinkle’s claim 6). Regarding claim 38, Hinkle teaches RNAi oligonucleotides comprising at least one modified internucleotide linkage (see Hinkle’s claims 8 and 9). Regarding claims 47 and 50, Hinkle teaches RNAi oligonucleotides conjugated to one or more targeting groups that are liver-specific and are GalNAc moieties, specifically trivalent GalNAc moiety (see page 4, lines 14-20; see Hinkle’s claims 20-24). Regarding claim 66, Hinkle teaches RNAi oligonucleotides, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent (see page 58, lines 19-23; page 75, lines 19-23; page 82, lies 7-35). Regarding claim 92, Hinkle teaches RNAi oligonucleotides comprising a pharmaceutically acceptable salt that is a sodium salt ( see page 27, lines 20-30; page 61, lines 1-9). Claims 1-2, 7, 22, 25, 29, 38, 47, 50, 66, 88 and 92 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Keating (Keating, M. et al. US 2022/0364088 A1, published November 17, 2022, benefitting from priority of Application No. PCT/US2020/056563 filed October 21, 2020, and from Provisional Application No. 62/924,210, filed on October 22, 2019). Regarding claim 1, Keating teaches an RNAi oligonucleotide, or a pharmaceutically acceptable salt thereof, for reducing complement component C3 (C3) expression (see title and abstract). Keating also teaches that the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a C3 mRNA target sequence of instant SEQ ID NO: 14, and wherein the region of complementarity is at least 15 contiguous nucleotides in length (see alignment below and [0011]-[0013]; see Keating’s claim 2). A search of instant SEQ ID NO: 14 (Qy; Query) leads to results such as the one below: RESULT 28 US-17-721-530-4076/c (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 4076, US/17721530 Publication No. US20220364088A1 GENERAL INFORMATION APPLICANT: ALNYLAM PHARMACEUTICALS, INC. TITLE OF INVENTION: COMPLEMENT COMPONENT C3 IRNA COMPOSITIONS AND METHODS OF USE TITLE OF INVENTION: THEREOF FILE REFERENCE: 121301-10502 CURRENT APPLICATION NUMBER: US/17/721,530 CURRENT FILING DATE: 2022-04-15 PRIOR APPLICATION NUMBER: PCT/US2020/056563 PRIOR FILING DATE: 2020-10-21 PRIOR APPLICATION NUMBER: 62/924,210 PRIOR FILING DATE: 2019-10-22 NUMBER OF SEQ ID NOS: 4652 SEQ ID NO 4076 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: NAME/KEY: source OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" FEATURE: NAME/KEY: source OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" Query Match 100.0%; Score 19; Length 23; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGAAATTCTACTACATCTA 19 ||||||||||||||||||| Db 21 AGAAATTCTACTACATCTA 3 The alignment shows that Keating’s SEQ ID NO: 4076 (Db; Database) is 23 nucleotides in length and has 100% complementarity to a target sequence of instant SEQ ID NO: 14 (Qy; Query). Keating teaches that “in some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target complement component C3 sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 1 selected from the group of nucleotides 475-497,…,4061-4083,…of SEQ ID NO: 1, such as about 85%, about 90%, about 91%...or about 99% complementary” (see [0123]; [0013]). Keating teaches in Table 30, a double-strand oligonucleotide, AD-1181600.1, corresponding to the duplex between a sense strand set forth in Keating’s SEQ ID NO: 3897 and an antisense strand set forth in Keating’s SEQ ID NO: 4076 (Table 30, page 150). Keating claims all dsRNAs within Tables 2-7,15,18,20-23, 30 and 31 (see Keating’s claim 2) Regarding claim 2, Keating teaches RNAi oligonucleotides that have a sense strand between 15 to 50 nucleotides in length and an antisense that is between 15 and 30 nucleotides in length (see [0025]-[0028]; see Table 30; see Keating’s claims 17 and 22). Regarding claim 7, Keating teaches RNAi oligonucleotides that have 19 contiguous nucleotides as region of complementarity (see alignment of SEQ ID NO: 4076 with instant SEQ ID NO: 14 above). Regarding claim 22, Keating teaches RNAi oligonucleotides that comprise at least one modified nucleotide (see [0017]-[0024]; see Keating’s claims 9 and 10). Regarding claim 25, Keating teaches RNAi oligonucleotides wherein the modified nucleotide comprises a 2’-modification, wherein the 2’-modification is a modification selected from 2’-aminoethyl, 2’-fluoro, 2’-O-methyl, and 2’-O-methoxyethyl, (see [0020]-[0022]; Keating’s claim’s 12). Regarding claim 29, Keating teaches RNAi oligonucleotides, wherein every nucleotide in the sense strand and the antisense strand of the dsRNAi agent is a modified nucleotide; in some embodiments, each residue is independently modified with 2’-O-methyl or 3’-Fluoro in an alternating motif (see [0192]; [0208]-[0210]). Regarding claim 38, Keating teaches RNAi oligonucleotides comprising at least one modified internucleotide linkage (see [0037]-[0040]; see Keating’s claim 36). Regarding claims 47 and 50, Keating teaches RNAi oligonucleotides conjugated to one or more targeting groups that are GalNAc moieties, specifically trivalent GalNAc moiety (see [0032]-[0036]; Keating’s claims 31-35). Regarding claim 66, Keating teaches RNAi oligonucleotides, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent (see [0143], [0583, [0607]). Regarding claim 88, Keating teaches compositions comprising RNAi oligonucleotides provided within a kit (see [0059]). Regarding claim 92, Keating teaches RNAi oligonucleotides that are comprised within pharmaceutical compositions and are in a salt form that is a sodium salt (see [0042]-[0044], [0158]). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 8 and 11 are rejected under 35 U.S.C. § 103 as being unpatentable over Hinkle (Hinkle, G. et al. WO 2019/089922 A1, published May 9, 2019; cited on IDS filed 06/17/2026), as applied to claim 1 above, and further in view of Brown (Brown, B. WO 2010/033225 A2, published March 25, 2010). It is noted that claim 1 is anticipated by Hinkle, since: Regarding claim 1, Hinkle teaches an RNAi oligonucleotide, or a pharmaceutically acceptable salt thereof, for reducing complement component C3 (C3) expression (see title and abstract; see page 61, lines 27-28 and page 74, lines 35-36). Hinkle also teaches that the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a C3 mRNA target sequence of instant SEQ ID NO: 13, and wherein the region of complementarity is at least 15 contiguous nucleotides in length (see Hinkle’s claims 1 and 2; see Table 3, page 113). In Table 3, page 113, Hinkle teaches a double-stranded oligonucleotide AD-76584, composed of sense strand of SEQ ID NO: 222 and an antisense strand of SEQ ID NO: 490. Alignment of Hinkle’s SEQ ID NO: 222 (Db; Database) with instant Application’s SEQ ID NO: 13 (Qy; Query) is shown below: Query Match 90.0%; Score 18; DB 1; Length 19; Best Local Similarity 77.8%; Matches 14; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 3 CAACTCACCTGTAATAAA 20 ||||:||||:|:||:||| Db 1 CAACUCACCUGUAAUAAA 18 The alignment clearly shows an RNA sequence corresponding to the targeted sequence of C3 mRNA set forth in instant SEQ ID NO: 13, having similarity over 18 contiguous nucleotides. Regarding claims 8 and 11, Hinkle teaches that the two strands forming the duplex structure of the RNAi may be different portions of one larger RNA molecule, connected by an uninterrupted chain of nucleotides between the 3’ end of one strand and the 5’ end of the respective other strand forming the duplex structure, wherein the connecting RNA chain is referred to as a “hairpin loop” (see page 14, lines 4-7). Hinkle teaches that in some embodiments the hairpin loop can be 10 or fewer nucleotides; in some embodiments the hairpin loop can be 4-10 unpaired nucleotides, or 4-8 nucleotides (page 14, lines 7-13). Hinkle teaches that in one embodiment, a dsRNA is joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure (see page 55, lines 24-25). Hinkle does not teach specifically a structure S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length (claim 8), nor a L tetraloop of SEQ ID NO: 8, i.e., “5’-GAAA-3’” (claim 11(a)). However, Brown teaches these elements. Brown teaches compositions and methods for the specific inhibition of gene expression by dsRNA possessing modifications (see title and abstract; and Figure 1A). Brown teaches that an oligonucleotide with stem-loop structure as shown in Figure 1A maximizes potency, enhances Dicer processing, improves stability while evading the immune system, and is not toxic (see page 2, lines 1-4). Brown teaches dsRNA constructs comparing the effect of a dsRNA without tetraloop with dsRNA comprising different types of RNA tetraloops (i.e., UUGG, UUCG, GAAA) (see page 7, lines 33-34, and page 8, lines 1-7). Brown teaches hairpin stem-loop constructs with a structure corresponding to S1-L-S2, wherein L is a motif of 4 unpaired nucleotides in length (see Figure 7). Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the hairpin structure taught by Hinkle in the dsRNAi targeting C3 mRNA and added a “GAAA” sequence as taught by Brown and obtained a S1-L-S2 structure. One with ordinary skills in the art motivated in optimizing the siRNA agent for potency, Dicer processing, and improved stability, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention. Claim 61 is rejected under 35 U.S.C. § 103 as being unpatentable over Hinkle (Hinkle, G. et al. WO 2019/089922 A1, published May 9, 2019; cited on IDS filed 06/17/2026), as applied to claim 1 above, and further in view of Parker (Parker, M.D. et al. US 2010/0028848 A1; published February 4, 2010), Brown (Brown, B. WO 2010/033225 A2, published March 25, 2010) and Dudek (Dudek, H. et al. WO 2019/204021 A1; published October 24, 2019). It is noted that claim 1 is anticipated by Hinkle, since: Regarding claim 1, Hinkle teaches an RNAi oligonucleotide, or a pharmaceutically acceptable salt thereof, for reducing complement component C3 (C3) expression (see title and abstract; see page 61, lines 27-28 and page 74, lines 35-36). Hinkle also teaches that the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a C3 mRNA target sequence of instant SEQ ID NO: 13, and wherein the region of complementarity is at least 15 contiguous nucleotides in length (see Hinkle’s claims 1 and 2; see Table 3, page 113). In Table 3, page 113, Hinkle teaches a double-stranded oligonucleotide AD-76584, composed of sense strand of SEQ ID NO: 222 and an antisense strand of SEQ ID NO: 490. Alignment of Hinkle’s SEQ ID NO: 222 (Db; Database) with instant Application’s SEQ ID NO: 13 (Qy; Query) is shown below: Query Match 90.0%; Score 18; DB 1; Length 19; Best Local Similarity 77.8%; Matches 14; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 3 CAACTCACCTGTAATAAA 20 ||||:||||:|:||:||| Db 1 CAACUCACCUGUAAUAAA 18 The alignment clearly shows an RNA sequence corresponding to the targeted sequence of C3 mRNA set forth in instant SEQ ID NO: 13, having similarity over 18 contiguous nucleotides. Regarding claim 61, Hinkle teaches that the two strands forming the duplex structure of the RNAi may be different portions of one larger RNA molecule, connected by an uninterrupted chain of nucleotides between the 3’ end of one strand and the 5’ end of the respective other strand forming the duplex structure, wherein the connecting RNA chain is referred to as a “hairpin loop” (see page 14, lines 4-7). Hinkle teaches that in some embodiments the hairpin loop can be 10 or fewer nucleotides; in some embodiments the hairpin loop can be 4-10 unpaired nucleotides, or 4-8 nucleotides (page 14, lines 7-13). Hinkle teaches that in one embodiment, a dsRNA is joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure (see page 55, lines 24-25). Hinkle does not teach specifically the whole sequence of instant SEQ ID NO: 13, nor a structure S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, nor a L tetraloop of SEQ ID NO: 8, i.e., “5’-GAAA-3’” , which are part of the sequence set forth in SEQ ID NO: 1: i.e., 5’-aucaacucaccuguaauaaagcagccgaaaggcugc-3’ and SEQ ID NO: 3, i.e., 5’-uuuauuacaggugaguugaugg-3’. An alignment of both instant sequences SEQ ID Nos: 1 and 3 is shown below: Query Match 55.6%; Score 20; DB 1; Length 22; Best Local Similarity 75.0%; Matches 15; Conservative 5; Mismatches 0; Indels 0; Gaps 0; Qy 1 AUCAACUCACCUGUAAUAAA 20 |:||||:||||:|:||:||| Db 20 ATCAACTCACCTGTAATAAA 1 The alignment clearly shows that only 20 nucleotides of both strands are perfectly complementary, and that there is an extra sequence “gcagccgaaaggcugc” in SEQ ID NO: 1, comprising S1 region “gcagcc” that is complementary to a S2 region “ggcugc” and a GAAA unpaired nucleotide sequence forming a loop L, all corresponding to a hairpin with a tetraloop. Also, the alignment shows that there is an extra “GG” as an overhang in SEQ ID NO: 3. However, Parker teaches composition and methods using siRNA to target various genes, including C3 gene (see title, abstract; Figure 2; [0008], [0015]-[0018]). Parker also teaches the exact sequence of instant SEQ ID NO: 13, as a target sequence set forth in Parker’s SEQ ID NO: 11 in Table 1, as one of 25 target sequences proposed. SEQ ID NO: 11 of Parker, i.e., 5’-AAGATCAACTCACCTGTAATAAA-3’, corresponds to SEQ ID NO: 3 on 20 contiguous nucleotides, but lacking the GG overhang. Brown teaches compositions and methods for the specific inhibition of gene expression by dsRNA possessing modifications (see title and abstract; and Figure 1A). Brown teaches that an oligonucleotide with stem-loop structure as shown in Figure 1A maximizes potency, enhances Dicer processing, improves stability while evading the immune system, and is not toxic (see page 2, lines 1-4). Brown teaches dsRNA constructs comparing the effect of a dsRNA without tetraloop with dsRNA comprising different types of RNA tetraloops (i.e., UUGG, UUCG, GAAA) (see page 7, lines 33-34, and page 8, lines 1-7). Brown teaches hairpin stem-loop constructs with a structure corresponding to S1-L-S2, wherein L is a motif of 4 unpaired nucleotides in length (see Figure 7). Brown teaches a generic sequence composed of “N” as bases in the stem-loop hairpin that encompasses any hairpin structure. See Figure 1A: PNG media_image1.png 164 434 media_image1.png Greyscale Brown also teaches that the dsRNA can have an overhang on the 3’ end of the antisense strand. The overhang can be 1-4 nucleotides, or just 2 nucleotides (see page 35, lines 9-11; Brown’s claims 6-8 on page 86). Dudek teaches RNAi molecules with enhanced resistance to nucleases and lower immunogenicity (see abstract). Dudek’s disclosure is also a reference using teachings from Brown (WO2010033225) (see [00064]). A search for instant SEQ ID NO: 7 leads to Dudek’s SEQ ID No: 1266, sequence used multiple times as a hairpin/stem-loop structure for different siRNAs (see Table 4, on page 77). Dudek also teaches that L is a 4 nucleotides in length and comprises a sequence as GAAA (see Dudek’s claims 23 and 24, page 82). Dudek teaches that “oligonucleotides comprise separate sense and antisense strands that are both in the range of 17 to 40 nucleotides in length. In some embodiments, oligonucleotides incorporating such sequences are provided that have a tetraloop structure within a 3’ extension of their sense strand, and two terminal overhang nucleotides at the 3’ end of the separate antisense strand. In some embodiments, the two terminal overhang nucleotides are GG. Typically, one or both of the two terminal GG nucleotides of the antisense strand is or are not complementary to the target” (see [00065]). In KSR Int 'l v. Teleflex, the Supreme Court, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability”. KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007). It would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention, to have used the exact sequence for target provided by Parker and used it in the design of dsRNA for targeting C3 mRNA as taught by Hinkle. It would have been obvious to one with ordinary skills to have modified the siRNA, taught by Hinkle/Parker using the teachings of Brown and Dudek, adding a hairpin comprising a tetraloop with GAAA and a GG overhang at the end of the antisense strand. One with ordinary skills in the art motivated in using a hairpin sequence that is used repetitively in a disclosure relying on Brown for tetraloop and hairpin design for optimizing potency and immunogenicity of the siRNA, could have performed these modifications with a reasonable expectation of success and would have arrived at the claimed invention. Allowable Subject Matter Claim 64 is objected to as being dependent upon a rejected base claim but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion Claims 1-2,7-8,11,22,25,29,38,47,50,61,66,88 and 92 are rejected. Claim 64 is objected to. No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 17, 2023
Application Filed
Jul 29, 2026
Non-Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680098
Modified antisense oligonucleotide for inhibition of FoxP3 expression
4y 0m to grant Granted Jul 14, 2026
Patent 12655421
NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS
5y 9m to grant Granted Jun 16, 2026
Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
1y 12m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
5y 0m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
5y 1m to grant Granted Jan 06, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
60%
Grant Probability
96%
With Interview (+35.7%)
3y 7m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 58 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month