Prosecution Insights
Last updated: October 02, 2026
Application No. 18/287,588

NANOPARTICLES FOR ANTIGEN-SPECIFIC CELL PROGRAMMING AND USES THEREOF

Non-Final OA §102§103§112§DP
Filed
Oct 19, 2023
Priority
Apr 20, 2021 — provisional 63/176,970 +2 more
Examiner
BOWLES, DAVID PAUL
Art Unit
1654
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
GEORGIA TECH RESEARCH Corporation
OA Round
1 (Non-Final)
73%
Grant Probability
Favorable
1-2
OA Rounds
6m
Est. Remaining
95%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allowance Rate
32 granted / 44 resolved
+12.7% vs TC avg
Strong +22% interview lift
Without
With
+22.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
40 currently pending
Career history
86
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
27.4%
-12.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
36.0%
-4.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claim 23 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/1/2026. Priority Priority to US 63/176,970, filed 4/202/2021, and US 63/312,483, filed 2/22/2022 is acknowledged. Information Disclosure Statement The information disclosure statements (IDS) were submitted on 10/19/2023, 2/2/2024, 6/19/2025, and 8/11/2025 before the mailing of a first office action. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Status Claims 1-6, 8-19, and 22-23, filed 10/19/2023 are pending. Claim 23 is withdrawn. Claims 1-6, 8-19, and 22 are under examination. Claim 23 has the incorrect status identifier. This claim should be marked as “Withdrawn”. Please correct this status. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 5, SEQ ID NOs: 18-20 refer to nucleic acid sequences. However, claim 5 further limits a claim regarding an MHC class I molecule, which is a polypeptide as described by the specification: “The term "MHC molecule" or "major histocompatibility complex molecule" herein refers to the highly polymorphic glycoproteins encoded by MHC class I and MHC class II genes, which are involved in the presentation of peptide antigens to T cells. The function of MHC molecules is to bind peptide fragments and display them on the cell surface for recognition by the appropriate T cells. There are two classes of MHC molecule-MHC class I molecules and MHC class II molecules. In addition to being bound by the T-cell receptor, the two classes of MHC molecule are differentially recognized by the two co-receptor molecules, CD8 and CD4, which characterize the two major subsets of T cells. CD8 T cells recognize MHC class I: peptide complexes. CD4 T cells recognize MHC class II: peptide complexes. It should be understood and herein contemplated that an MHC class I molecule comprises an A chain (also herein termed as "heavy chain") that is polymorphic and a beta2-microglobulin that is invariant. An MHC class I molecule comprises a peptide binding groove that binds peptides (also known as "epitopes"). An MHC class II molecule comprises an a and a R chain. The N-20 terminal domains each of the a and R chain are polymorphic and important in antigen presentation. In the case of MHC class II, the peptide-binding groove is formed by the interaction of the N-terminal domains of the a and R chains.” (Specification, page 21, line 7). It is not clear to which sequences claim 5 refers, since these sequences are not polypeptides. Clarification is required. Consequently, claim 5 is rejected. Claim 15 recites the limitation "lipids" in line 3. There is insufficient antecedent basis for this limitation in the claim. Claim 1 does not reference “lipids”. Consequently, claim 15 is rejected. Examiner Note: A 112(a) rejection was considered for claim 11. However, prior art such as Wieczorek et al. (Wieczorek, et al. Frontiers in immunology 8: 292 (2017) provide a person of ordinary skill in the art sufficient structural information to reasonably predict which residues are tolerant of mutation and which ones are critical. The Examiner further notes that the binding of MHC molecules to peptide epitopes is an extremely well-understood phenomenon and not the point of novelty in this application. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 2, 6, and 14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011)). Regarding claim 1, Clemente-Casares discloses a peptide-MHC-nanoparticle composition: “The rationale behind the development of the pMHC-nanoparticle (pMHC-NP) approach for the treatment of autoimmunity was based on this fundamental principle. We hypothesized that pMHC-coated NPs would dampen autoreactive T cell responses with significantly higher efficiency than soluble pMHC complexes, owing to (1) their multimeric valency; (2) the possible superior TCR cross-linking properties of pMHCs anchored onto the small NP scaffold [5–50 nm in diameter of the electron-dense core; from 1,000 to 100 of times smaller (in diameter) than a 5-μ cell, unlike the case for the so-called “artificial APCs”, which involve the use of micro- or cell-sized particles] (Fig. 2); and (3) protection of the NP-bound pMHC molecules from degradation, which would lengthen their half-life in the circulation.” (Clemente-Casares et al., page 733, col. 2, para. 3). Consequently, claim 1 is anticipated by Clemente-Casares and rejected. Regarding claim 2, claim 1 is anticipated as described above. Clemente-Casares discloses the coupling of MHC class II molecules: “We coupled several different type 1 diabetes (T1D)-relevant pMHC class I complexes to NPs and used the pMHC-NP pools to delete a significant fraction of the diabetogenic T cell repertoire.” (Clemente-Ceares et al., page 734, col. 1, para. 1). Consequently, claim 2 is anticipated by Clemente-Casares and rejected. Regarding claim 6, claim 1 is anticipated as described above. Clemente-Casares discloses the case wherein the peptide is bound to the MHC molecule: “Sharma et al. [2–5] were among the first to test the ability of soluble pMHC class II complexes (pMHCII) to blunt autoimmune responses. In 1991, these authors reported that administration of MHC class II molecules bearing proteolipid protein (PLP) or myelin basic protein (MBP) peptides could prevent the development of, or ameliorate established experimental autoimmune encephalomyelitis (EAE), a model of multiple sclerosis (MS) in man.” (Clemente-Casares et al., page 734, col. 2, para. 3). Consequently, claim 6 is anticipated by Clemente-Casares and rejected. Regarding claim 14, claim 1 is anticipated by Clemente-Casares as described above. Clemente-Casares discloses the case wherein the MHC molecule and therefore also the peptide are displayed on the surface of the nanoparticle: PNG media_image1.png 216 414 media_image1.png Greyscale (Clemente-Casares et al., page 734, Fig. 1). Consequently, claim 14 is anticipated by Clemente-Casares and rejected. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Xu et al. (Xu, et al. Diabetologia 60.12: 2418-2431 (2017)). Regarding claim 3, claim 1 is anticipated as described above. Clemente-Cesares does not specifically disclose the case wherein the MHC molecule comprises HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*07:02, HLA-A*11:01, or HLA-A*24:02. However, Xu discloses the usage of HLA-A*02:01 MHC molecules in the context of nanoparticles to treat diabetes: “Induction of antigen-specific immunological tolerance may provide an attractive immunotherapy in the NOD mouse model but the conditions that lead to the successful translation to human type 1 diabetes are limited. In this study, we covalently linked 500 nm carboxylated polystyrene beads (PSB) with a mixture of immunodominant HLA-A*02:01-restricted epitopes (peptides-PSB) that may have high clinical relevance in humans as they promote immune tolerance; we then investigated the effect of the nanoparticle–peptide complexes on T cell tolerance.” (Xu et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the MHC molecule disclosed by Xu in the general pMHC-nanoparticle scheme of Clemente-Casares to arrive at the claimed invention because Xu is also attaching a pMHC to a nanoparticle for the specific purpose of treating diabetes. A person of ordinary skill in the art would be motivated to make this combination to treat diabetes as disclosed by Xu and have a reasonable expectation of success because Xu shows that HLA-A*02:01 MHC molecules attached to nanoparticles have effects in vivo (Xu et al., pages 2420 and 2422, Figs 2 and 3). Consequently, claim 3 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Xu et al. and rejected. Claims 4, 16, and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Agarwal et al. (Agarwal, et al. Bioconjugate chemistry 26.2: 176-192 (2015) as evidenced by Bjorkman et al. (Bjorkman, et al. Annual review of biochemistry 59.1: 253-288 (1990)). Regarding claim 4, claim 2 is anticipated as described above. Clemente-Casares does not explicitly disclose a heavy chain that comprises a C-terminal cysteine. However, Bjorkman discloses that MHC molecules possess heavy chains: “HLA-A, B, and C heavy chains are homologous structures, showing only minor differences in the size of the transmembrane and cytoplasmic domains. Within the 274 residues of the a~, az, and a3 domains, a total of 165 positions or 61% of the total are invariant between the 25 HLA-A, 35 HLA-B, and 18 HLA-C sequences that have been determined (Figure 4). These positions include the invariant glycosylation site at position 86 in al, the cysteines at positions 101, 164, 203, and 259 that form the disulfide bonds of a2 and a3, and many of the residues involved in contacting /32m (Figure 4).” (Bjorkman et al., page 274, para. 2) Furthermore, Agarawal discloses the usage of C-terminal cysteines to provide conjugation points: “Alternatively, C-terminal cysteine residues could be treated with a maleimide reagent containing an aminothiol masked as its formaldehyde-derived thiazolidine. Following deblocking, conjugation of the aminothiol-containing proteins to an aldehyde-functionalized cematodin derivative provided site-specifically modified diabodies, although the reaction required up to 4 days at pH 4.5 to proceed. The thiazolidine linkages exhibited half-lives of roughly 2 days in PBS at 37 ?C. While the field has generally moved away from linkers that provide slow nonspecific cleavage of the ADC (such as the hydrazone linker used to prepare Mylotarg) due to concerns about toxicity arising from premature drug release, the rationale for engineering a half-life into the linker here was to use it with antibodies targeting poorly internalized antigens. With the advent of a system to ribosomally incorporate an unnatural amino acid containing a masked 1,2-aminothiol that can be deprotected without disrupting native disulfide bonds, (47) the thiazolidine ligation could also be useful for modification at interior sites on an antibody; alternatively, the 1,2-aminothiol moiety could be treated with a cyanobenzothiazole reagent to form a more stable linkage.” (Agarwal et al, page 181, col. 2, para. 2). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to insert a C-terminal cysteine as disclosed by Agarwal into the heavy chain of an MHC molecule as disclosed by Clemente-Casares to arrive at the claimed invention because Agarwal shows the usage of such cysteines in heavy chains (Agarwal et al., page 179, Fig. 2). A person of ordinary skill in the art would be motivated to substitute or insert a cysteine as disclosed by Agarwal to create a stable linkage to another molecule using a scheme that does not disrupt native disulfide bonds as described above. A person of ordinary skill in the art would have a reasonable expectation of success because Agarwal discloses that such cysteine conjugation schemes are well-known: “Cysteine conjugation is the testing ground on which much of our current knowledge about site-specific ADCs was built. In coming years, cysteine will continue to be a popular target for conjugation based on the new generation of cysteine-specific chemistries that promise to fix the problem of maleimide exchange. Cysteine alkylation reactions are typically quite fast, making these conjugation schemes an appealing choice.” (Agarwal et al., page 181, col. 2, para. 3). Consequently, claim 4 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Regarding claim 16, claim 1 is anticipated as described above. Clemente-Casares does not specifically disclose conjugation of the MHC to linker at the C-terminus. However, Agarwal discloses the usage of C-terminal cysteines to provide conjugation points: “Alternatively, C-terminal cysteine residues could be treated with a maleimide reagent containing an aminothiol masked as its formaldehyde-derived thiazolidine. Following deblocking, conjugation of the aminothiol-containing proteins to an aldehyde-functionalized cematodin derivative provided site-specifically modified diabodies, although the reaction required up to 4 days at pH 4.5 to proceed. The thiazolidine linkages exhibited half-lives of roughly 2 days in PBS at 37 ºC. While the field has generally moved away from linkers that provide slow nonspecific cleavage of the ADC (such as the hydrazone linker used to prepare Mylotarg) due to concerns about toxicity arising from premature drug release, the rationale for engineering a half-life into the linker here was to use it with antibodies targeting poorly internalized antigens. With the advent of a system to ribosomally incorporate an unnatural amino acid containing a masked 1,2-aminothiol that can be deprotected without disrupting native disulfide bonds, (47) the thiazolidine ligation could also be useful for modification at interior sites on an antibody; alternatively, the 1,2-aminothiol moiety could be treated with a cyanobenzothiazole reagent to form a more stable linkage.” (Agarwal et al, page 181, col. 2, para. 2). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to insert a C-terminal cysteine as disclosed by Agarwal into the heavy chain of an MHC molecule as disclosed by Clemente-Casares and use that cysteine to conjugate a linker as disclosed by Agarwal to arrive at the claimed invention because Agarwal describes that such a linker scheme is stable and does not disrupt the natural disulfide bonds. A person of ordinary skill in the art would be motivated to create a stable linkage to another molecule using a scheme as described by Agarwal that does not disrupt native disulfide bonds as described above. A person of ordinary skill in the art would have a reasonable expectation of success because Agarwal discloses that such cysteine conjugation schemes are well-known: “Cysteine conjugation is the testing ground on which much of our current knowledge about site-specific ADCs was built. In coming years, cysteine will continue to be a popular target for conjugation based on the new generation of cysteine-specific chemistries that promise to fix the problem of maleimide exchange. Cysteine alkylation reactions are typically quite fast, making these conjugation schemes an appealing choice.” (Agarwal et al., page 181, col. 2, para. 3). Consequently, claim 16 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Regarding claim 17, claim 16 is obvious as described above. Clemente-Casares discloses a nanoparticle covered in pMHC molecules: “The rationale behind the development of the pMHC-nanoparticle (pMHC-NP) approach for the treatment of autoimmunity was based on this fundamental principle. We hypothesized that pMHC-coated NPs would dampen autoreactive T cell responses with significantly higher efficiency than soluble pMHC complexes, owing to (1) their multimeric valency; (2) the possible superior TCR cross-linking properties of pMHCs anchored onto the small NP scaffold [5–50 nm in diameter of the electron-dense core; from 1,000 to 100 of times smaller (in diameter) than a 5-μ cell, unlike the case for the so-called “artificial APCs”, which involve the use of micro- or cell-sized particles] (Fig. 2); and (3) protection of the NP-bound pMHC molecules from degradation, which would lengthen their half-life in the circulation.“ (Clemente-Casares et al., page 733, col. 2, para. 3). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the conjugation scheme of Agarwal to attach pMHC molecules to the nanoparticle as disclosed by Clemente-Casares because Agarwal discloses that this attachment scheme creates a stable linkage and does not interfere with the native disulfide bonding. A person of ordinary skill in the art would be motivated to make this linkage in order to create the composition of Clemente-Casares and have a reasonable expectation of success because Agarwal discloses that this scheme creates a stable linkage and does not interfere with the native disulfide bonding. Consequently, claim 17 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Claims 8 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Bakker et al. (Bakker, et al. Proceedings of the National Academy of Sciences 105.10: 3825-3830 (2008)). Regarding claim 8, claim 1 is anticipated as described above. Clemente-Casares does not specifically disclose the case wherein the peptide is a viral protein. However, Bakker discloses the case wherein MHC class I molecules are bound to various peptides: “Based on these considerations, it seemed valuable to devise technologies that allow the high-throughput parallel generation of peptide-MHC class I complexes. As a step toward this goal, we recently designed an HLA-A2-specific peptide that contains a photocleavable moiety (8). When refolding reactions of HLA-A2 heavy chain and _2m are performed with this ligand, stable HLA-A2 complexes are formed. However, upon irradiation with long-wavelength UV, the ligand is cleaved and dissociates from the HLA-A2 complex. The resulting empty HLA-A2 complexes disintegrate rapidly, unless UV exposure is performed in the presence of a ‘‘rescue peptide.’’ In this case, the peptide-binding groove that has been vacated by UV exposure will be occupied by the rescue peptide, resulting in the formation of stable pMHC complexes with a distinct T cell specificity. The utility of this approach has been demonstrated by the identification of an HLA-A2-restricted CTL epitope from an H5N1 influenza strain isolated from a lethal case of avian influenza infection in humans (8).” (Bakker et al., page 3825, col. 2, para. 2). Bakker also discloses an influenza epitope: PNG media_image2.png 34 356 media_image2.png Greyscale (Bakker et al., page 3829, Table 1). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the viral peptide disclosed by Bakker with the composition disclosed by Clemente-Casares to arrive at the claimed invention because Bakker discloses MHC binding peptides against targets of interest and MHC-peptide complexes are part of the composition of Clemente-Casares. A person of ordinary skill in the art would be motivated to bind a viral protein such as influenza in order to observe T-cell reactions to the overall composition: “As a first step in the mapping of disease-associated T cell epitopes, peptide fragments of disease-associated proteomes may be analyzed for binding to MHC molecules of interest, and subsequent assays can then be used to determine whether T cell reactivity against such pMHC complexes does occur. As demonstrated in a landmark study by Altman and colleagues (1), such antigen-specific T cell reactivity can efficiently be detected by the staining of T cell populations with recombinant fluorescent multimeric MHC molecules.” (Bakker et al., page 3825, col. 1, para. 1). A person of ordinary skill in the art would have a reasonable expectation of success because both Bakker and Clemente-Casares reference MHC molecules and therefore the peptides should bind in either situation because the MHC molecules can be the same. Consequently, claim 8 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Bakker et al. and rejected. Regarding claim 9, claim 8 is obvious as described above. The viral peptide of Bakker is an influenza peptide. Consequently, claim 9 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Bakker et al. and rejected. Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Hawkins et al. (Hawkins, Journal of proteome research 7.4: 1445-1457. (2008)) Regarding claim 10, claim 1 is obvious as described above. Clemente-Casares does not specifically disclose the case wherein the peptide is a cancer protein. However, Hawkins discloses the discovery and binding of cancer peptide epitopes to HLA-A*02101 molecules: “Cellular immune mechanisms detect and destroy cancerous and infected cells via the human leukocyte antigen (HLA) class I molecules that present peptides of intracellular origin on the surface of all nucleated cells. The identification of novel, tumor-specific epitopes is a critical step in the development of immunotherapeutics for breast cancer. To directly identify peptide epitopes unique to cancerous cells, secreted human class I HLA molecules (sHLA) were constructed by deletion of the transmembrane and cytoplasmic domain of HLA A*0201. The resulting sHLA-A*0201 was transferred and expressed in breast cancer cell lines MCF-7, MDA-MB-231, and BT-20 as well as in the immortal, nontumorigenic cell line MCF10A. Stable transfectants were seeded into bioreactors for production of >25 mg of sHLA-A*0201. Peptides eluted from affinity purified sHLA were analyzed by mass spectroscopy. Comparative analysis of HLA-A*0201 peptides revealed 5 previously uncharacterized epitopes uniquely presented on breast cancer cells. These peptides were derived from intracellular proteins with either well-defined or putative roles in breast cancer development and progression: Cyclin Dependent Kinase 2 (Cdk2), Ornithine Decarboxylase (ODC1), Kinetochore Associated 2 (KNTC2 or HEC1), Macrophage Migration Inhibitory Factor (MIF), and Exosome Component 6 (EXOSC6). Cellular recognition of the MIF, KNTC2, EXOSC6, and Cdk2 peptides by circulating CD8+ cells was demonstrated by tetramer staining and IFN-γ ELISPOT. The identification and characterization of peptides unique to the class I of breast cancer cells provide putative targets for the development of immune diagnostic tools and therapeutics.” (Hawkins et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use cancer epitope peptides as disclosed by Hawkins in the composition of Clemente-Casares to arrive at the claimed invention because Hawkins is binding cancer epitopes to the same kinds of MHC I molecules as discussed broadly in Clemente-Casares: “Here, we directly compare class I HLA A*0201 presented peptide epitopes of breast cancer cell lines to those presented by a nontumorigenic line. The class I HLA A*0201 allele was selected for its high frequency in the population. Tumorigenic cell lines, MDA-MB-231, MCF-7, BT-20, and the nontumorigenic cell line MCF10A were transfected with the sHLA-A*0201 construct. Peptides were purified from 25 mg of harvested sHLA-A*0201 produced by each cell line. Comparative mapping of thousands of sHLA-A*0201 derived peptides by mass spectrometry identified 5 previously uncharacterized epitopes unique to the tumorigenic cell lines. Through characterization of protein expression, and by testing immune recognition of the epitopes, we provide preliminary validation for these 5 putative breast cancer epitopes. The nature of these peptides and their potential for immune targeting is discussed.” (Hawkins et al., page 1446, col. 1, para. 3). A person of ordinary skill in the art would be motivated to use cancer epitopes to develop compositions that interact with T-cells that respond to that cancer type and would have a reasonable expectation of success because Hawkins discloses that the disclosed cancer peptides bound to the MHC molecule: “Three fractions preceding and following the fraction of interest were examined to confirm the unique nature of these peptides. Synthetic peptides were produced and subjected to MS/MS under identical collision conditions, and spectra were compared with native peptide to confirm peptide sequences (Figures 2 and 4, Supplementary Figures 3, 5, and 7 in Supporting Information). The 5 peptides identified were determined to have high affinity for the HLA A*0201 using a competitive binding, fluorescence polarization based assay (Table 1). (Hawkins et al., page 1448, col. 2, para. 4). Consequently, claim 10 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Hawkins et al. and rejected. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Petersen et al. WO 93/17095, published 9/2/1993. Regarding claim 11, claim 1 is anticipated as described above. Clemente-Casares does not specifically disclose any of the sequences of claim 11. However, Peterson et al. discloses SEQ ID NO: 25: “In addition, it has now been determined that the Class I molecules expressed on the cell surface are further stabilized by the addition of peptides of appropriate size. (See Figures 5A-C.) A series of peptides of differing lengths were synthesized, as shown in Table 3 (see Example 5.2.). These include a peptide that is 8 amino acids in length; RGYVYQGL (SEQ ID NO 24) has been characterized as the epitope in the vesicular stomatitis virus (VSV) G protein. Similarly, OVA 8mer peptide SIINFEKL (SEQ ID NO 23, residues 5-12) has been identified as the peptide in ovalbumin that is presented by Kb/B2, and the 9-amino-acid-long peptide ASNENMETM (SEQ ID NO 25) has been characterized as the epitope of the influenza virus nuclear protein presented by Db/B2.” (Petersen et al., page 82, line 6). This sequence is aligned against Applicant SEQ ID NO: 2 below: % Result Query Filing No. Score Match Length ID Date Dups Description ------------------------------------------------------------------------------------------------------------- 1 45 100.0 9 AAB45907 -- 114 Influenza virus AM peptide fragment. ALIGNMENT: Query Match 100.0%; Score 45; Length 9; Best Local Similarity 100.0%; Matches 9; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ASNENMETM 9 ||||||||| Db 1 ASNENMETM 9 Petersen also discloses that this peptide binds to MHC molecules (Petersen et al., page 83, Table 1). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the peptide discloses by Petersen as the binding peptide in a composition as disclosed by Clemente-Casares because Peterson shows that the peptide binds to MHC molecules. A person of ordinary skill in the art would use the influenza nuclear protein to identify T-cells that respond to this epitope and would have a reasonable expectation of success because Petersen shows that this peptide binds to MHC molecules. Consequently, claim 11 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Petersen et al. and rejected. Claims 12, 13, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) as applied to claim 1 above, further in view of Lee et al. (Lee, et al. Journal of Controlled Release 313: 80-95. (2019)), Gattinoni et al. (Gattinoni, et al. Nature Reviews Cancer 12.10: 671-684 (2012)) and Wang et al. (Wang, et al. Pharmaceutical research 36.10:145. (2019)). Regarding claim 12, claim 1 is anticipated as described above. Clemente-Casares discloses the usage of nanoparticles in general as described above. Clemente-Casares does not specifically disclose a lipid nanoparticle. However, Wang discloses the usage of lipid nanoparticles for delivery of therapeutic miRNA and chemotherapeutics: “In this study, we aimed to prepare SRF and anti-miRNA27a-loaded anti-GPC3 antibody targeted lipid nanoparticles to enhance the therapeutic efficacy against liver cancers. In this study, we have employed a unique cationic switchable lipid (CSL) as a mean to encapsulate miRNA as well as to confer pH-responsiveness to the nanocarrier system.’ (Wang et al., page 1, col. 1, para. 2). Wang also discloses the attachment of the antibody to the outside of the nanoparticle: PNG media_image3.png 427 712 media_image3.png Greyscale (Wang et al., page 4, Fig. 1). Furthermore, Gattinoni discloses that miRNA molecules can be used to “reprogram” T-cells: “Recently, small non-protein-coding RNAs with regulatory properties termed microRNAs (miRNAs) have been found to tune key aspects of both stem cell and mature T cell functions. Although a comprehensive profiling of miRNA expression across all naive, memory and effector T cell subsets has yet to be carried out, existing data demonstrate that subsets of miRNAs are reciprocally expressed in TN cells, TEM and TEFF cells (Fig. 1).” (Gattinoni et al, page 672, col. 2, para. 3). Lee discloses that miRNAs can influence cell behavior and can also be encapsulated in lipid nanoparticles: “As important regulators of cell behavior in normal and pathological conditions, miRNAs hold immense potential for clinical applications, ranging from cancer therapy to TE approaches for the treatment of bone and cardiac defects, to neurological disorders, as described in the above paragraphs [3]. Moreover, because miRNAs inhibit/promote the expression of a multitude of genes compared with mRNA and siRNA, miRNA therapy potentially carries distinct advantages for disease treatment and regenerative medicine. Efficient and safe delivery of miRNAs is of paramount importance for their exploitation in the clinics, as naked miRNAs are susceptible to rapid degradation and traditional transfection reagents are not suitable for in-human applications. Encapsulation of miRNAs into NPs can overcome these delivery challenges, resulting in enhanced targeting efficacy and reduced off-target effects of the encapsulated payload.” (Lee et al., page 90, col. 1, para. 6). “Lipids are the main components of the cell membrane, thus making lipid-based NPs (LNPs) capable of interacting with the membrane, promoting cellular uptake of their contents. LNPs are composed of a lipid bilayer that contains the miRNA in the aqueous core or, in the case of multi-lamellar liposomes, between lipid bilayers [154]. Typically, miRNA-loaded LNPs are made with a mixture of cationic lipids, neutral lipids and PEG.” (Lee et al., page 85, col. 2, para. 6). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use a lipid nanoparticle as disclosed by Wang as the nanoparticle disclosed in the composition of Clemente-Casares to arrive at the claimed invention because Wang shows the conjugation of an antibody (heavy chain) to a lipid nanoparticle. A person of ordinary skill in the art would be motivated to use a lipid nanoparticle in the composition of Clemente-Casares because Wang shows that a lipid nanoparticle can function as a scaffold for heavy chains such as MHC class I. Furthermore, Gattinoni discloses that miRNAs can further reprogram T-Cells as targeted by Clemente-Casares and Lee shows that such miRNAs can be loaded into lipid nanoparticles. A person of ordinary skill in the art would have a reasonable expectation of success because Wang shows that antibody-like structures can be conjugated to lipid nanoparticles and Lee discloses that miRNAs can be delivered via lipid nanoparticle. Consequently, claim 12 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Wang et al., Lee et al., and Gattinoni et al. and rejected. Regarding claim 13, claim 12 is obvious as described above. The lipid nanoparticle of Wang contains DSPC and cholesterol: “As a first step, cationic switchable lipid (CSL3) was synthesized as reported previously (25). 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine)-N-[(polyethylene glycol)-2000 (DSPE-PEG2000), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine)-N-[(polyethylene glycol)-2000-maleimide (DSPE-PEG2000-MAL), and cholesterol was purchased from Avanti Polar Lipids, China.” (Wang et al., page 145, col. 2, para. 3). Consequently, claim 13 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Wang et al., Lee et al., and Gattinoni et al. and rejected. Regarding claim 19, claim 1 is anticipated as described above. Clemente-Casares does not specifically disclose a nucleic acid. However, Gattinoni discloses that miRNA molecules can be used to “reprogram” T-cells: “Recently, small non-protein-coding RNAs with regulatory properties termed microRNAs (miRNAs) have been found to tune key aspects of both stem cell and mature T cell functions. Although a comprehensive profiling of miRNA expression across all naive, memory and effector T cell subsets has yet to be carried out, existing data demonstrate that subsets of miRNAs are reciprocally expressed in TN cells, TEM and TEFF cells (Fig. 1).” (Gattinoni et al, page 672, col. 2, para. 3). Lee discloses that miRNAs can influence cell behavior and can also be encapsulated in lipid nanoparticles: “As important regulators of cell behavior in normal and pathological conditions, miRNAs hold immense potential for clinical applications, ranging from cancer therapy to TE approaches for the treatment of bone and cardiac defects, to neurological disorders, as described in the above paragraphs [3]. Moreover, because miRNAs inhibit/promote the expression of a multitude of genes compared with mRNA and siRNA, miRNA therapy potentially carries distinct advantages for disease treatment and regenerative medicine. Efficient and safe delivery of miRNAs is of paramount importance for their exploitation in the clinics, as naked miRNAs are susceptible to rapid degradation and traditional transfection reagents are not suitable for in-human applications. Encapsulation of miRNAs into NPs can overcome these delivery challenges, resulting in enhanced targeting efficacy and reduced off-target effects of the encapsulated payload.” (Lee et al., page 90, col. 1, para. 6). “Lipids are the main components of the cell membrane, thus making lipid-based NPs (LNPs) capable of interacting with the membrane, promoting cellular uptake of their contents. LNPs are composed of a lipid bilayer that contains the miRNA in the aqueous core or, in the case of multi-lamellar liposomes, between lipid bilayers [154]. Typically, miRNA-loaded LNPs are made with a mixture of cationic lipids, neutral lipids and PEG.” (Lee et al., page 85, col. 2, para. 6). Wang also discloses that such a nucleic acid can be on the surface of the nanoparticle: Wang also discloses the attachment of the antibody to the outside of the nanoparticle: PNG media_image3.png 427 712 media_image3.png Greyscale (Wang et al., page 4, Fig. 1). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use a nucleic acid as disclosed by Gattinoni to assist in the reprogramming of T-Cells as disclosed by Clemente-Casares because Gattinoni discloses how this can further modify and therefore the enhance the desired properties of the T-Cell of Clemente-Casares. A person of ordinary skill in the art would be motivated to use nucleic acids such as miRNAs as disclosed by Gattinoni because they can further reprogram T-Cells as targeted by Clemente-Casares. A person of ordinary skill in the art would have a reasonable expectation of success because Gattinoni discloses that nucleic acids such as miRNA can further reprogram T-Cells as targeted by Clemente-Casares. Furthermore, Wang shows that nucleic acids can be delivered on the surface of nanoparticles and Lee discloses that miRNAs can be delivered via lipid nanoparticle. Consequently, claim 19 is obvious over Clemente-Casares et al. as applied to claim 1, further in view of Wang et al., Lee et al., and Gattinoni et al. and rejected. Claim 18 is rejected under 35 U.S.C. 103 as being unpatentable over Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011), further in view of Agarwal et al. (Agarwal, et al. Bioconjugate chemistry 26.2: 176-192 (2015) as evidenced by Bjorkman et al. (Bjorkman, et al. Annual review of biochemistry 59.1: 253-288 (1990)), as applied to claim 16 above, further in view of Ravasco et al. (Ravasco, et al. Chemistry–A European Journal 25.1: 43-59. (2019)). Regarding claim 18, claim 16 is obvious as described above. Clemente-Casares, Agarwal, and Bjorkman do not disclose a specific linker type. However, Ravasco discloses the usage of maleimide linkages: “Maleimide chemistry stands out in the bioconjugation toolbox by virtue of its synthetic accessibility, excellent reactivity, and practicability. The second-generation of clinically approved antibody–drug conjugates (ADC) and much of the current ADC pipeline in clinical trials contain the maleimide linkage. However, thiosuccinimide linkages are now known to be less robust than once thought, and ergo, are correlated with suboptimal pharmacodynamics, pharmacokinetics, and safety profiles in some ADC constructs. Rational design of novel generations of maleimides and maleimide-type reagents have been reported to address the shortcomings of classical maleimides, allowing for the formation of robust bioconjugate linkages. This review highlights the main strategies for rational reagent design that have allowed irreversible bioconjugations in cysteines, reversible labelling strategies and disulfide re-bridging.” (Ravasco et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use a maleimide linker as disclosed by Ravasco to arrive at the claimed invention because Ravasco discloses that maleimide linkers have good reactivity and are currently used by many drugs. A person of ordinary skill in the art would use this linker because it has good reactivity and would have a reasonable expectation of success because Ravasco discloses a diagram with the exact scenario set up by the C-terminal cysteine scheme disclosed by Agarwal: PNG media_image4.png 410 412 media_image4.png Greyscale (Ravasco et al., page 46, Scheme 2). Consequently, claim 18 is obvious over Clemente-Casares et al. in view of Agarwal et al. as evidenced by Bjorkman et al. as applied to claim 16, further in view of Ravasco et al. and rejected. Clemente-Casares et al. (Clemente-Casares, et al. Journal of molecular medicine 89.8: 733-742 (2011) in view of Lee et al. (Lee, et al. Journal of Controlled Release 313: 80-95. (2019)), Gattinoni et al. (Gattinoni, et al. Nature Reviews Cancer 12.10: 671-684 (2012)) and Wang et al. (Wang, et al. Pharmaceutical research 36.10:145. (2019)) as applied to claim 19 above, further in view of Hsu et al. (Hsu, et al. The Journal of Immunology 175.11: 7226-7234. (2005), Reichmuth et al., (Reichmuth, et al. Therapeutic delivery 7.5: 319-334. (2016)) and GenBank Accession No. U14332, entered 9/14/1995. Regarding claim 22, Clemente-Casares et al., Lee et al., Gattinoni et al., and Wang et al. do not specifically disclose these nucleic acid sequences. However, Genbank discloses U14332, mouse IL-15, aligned against Applicant SEQ ID NO: 32 below: Query Match 100.0%; Score 489; Length 489; Best Local Similarity 69.9%; Matches 342; Conservative 147; Mismatches 0; Indels 0; Gaps 0; Qy 1 AUGAAAAUUUUGAAACCAUAUAUGAGGAAUACAUCCAUCUCGUGCUACUUGUGUUUCCUU 60 |:|||||::::|||||||:|:|:||||||:|||:|||:|:||:||:||::|:|:::||:: Db 1 ATGAAAATTTTGAAACCATATATGAGGAATACATCCATCTCGTGCTACTTGTGTTTCCTT 60 Qy 61 CUAAACAGUCACUUUUUAACUGAGGCUGGCAUUCAUGUCUUCAUUUUGGGCUGUGUCAGU 120 |:||||||:|||:::::|||:|||||:||||::||:|:|::||::::||||:|:|:|||: Db 61 CTAAACAGTCACTTTTTAACTGAGGCTGGCATTCATGTCTTCATTTTGGGCTGTGTCAGT 120 Qy 121 GUAGGUCUCCCUAAAACAGAGGCCAACUGGAUAGAUGUAAGAUAUGACCUGGAGAAAAUU 180 |:|||:|:|||:|||||||||||||||:|||:|||:|:||||:|:||||:||||||||:: Db 121 GTAGGTCTCCCTAAAACAGAGGCCAACTGGATAGATGTAAGATATGACCTGGAGAAAATT 180 Qy 181 GAAAGCCUUAUUCAAUCUAUUCAUAUUGACACCACUUUAUACACUGACAGUGACUUUCAU 240 |||||||::|::|||:|:|::||:|::||||||||:::|:||||:|||||:|||:::||: Db 181 GAAAGCCTTATTCAATCTATTCATATTGACACCACTTTATACACTGACAGTGACTTTCAT 240 Qy 241 CCCAGUUGCAAAGUUACUGCAAUGAACUGCUUUCUCCUGGAAUUGCAGGUUAUUUUACAU 300 |||||::||||||::||:||||:||||:||:::|:||:||||::|||||::|::::|||: Db 241 CCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTGGAATTGCAGGTTATTTTACAT 300 Qy 301 GAGUACAGUAACAUGACUCUUAAUGAAACAGUAAGAAACGUGCUCUACCUUGCAAACAGC 360 |||:||||:||||:|||:|::||:|||||||:||||||||:||:|:|||::||||||||| Db 301 GAGTACAGTAACATGACTCTTAATGAAACAGTAAGAAACGTGCTCTACCTTGCAAACAGC 360 Qy 361 ACUCUGUCUUCUAACAAGAAUGUAGCAGAAUCUGGCUGCAAGGAAUGUGAGGAGCUGGAG 420 ||:|:|:|::|:||||||||:|:|||||||:|:|||:||||||||:|:|||||||:|||| Db 361 ACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAG 420 Qy 421 GAGAAAACCUUCACAGAGUUUUUGCAAAGCUUUAUACGCAUUGUCCAAAUGUUCAUCAAC 480 |||||||||::|||||||:::::|||||||:::|:|||||::|:|||||:|::||:|||| Db 421 GAGAAAACCTTCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAAC 480 Qy 481 ACGUCCUGA 489 |||:||:|| Db 481 ACGTCCTGA 489 Clemente-Casares contemplate additional molecules to enhance the effect of T-Cells:” Also, molecules could be added to induce, maintain, or even enhance the suppressive function of the expanded pools of autoregulatory T cells.” (Clemente-Casares et al. page 740, col. 2, para. 3). Hsu discloses that introduction of IL-15 mRNA can boost immunotherapy outcomes when transfected into T-Cells: “IL-15 is a common γ-chain cytokine that has been shown to be more active than IL-2 in several murine cancer immunotherapy models. Although T lymphocytes do not produce IL-15, murine lymphocytes carrying an IL-15 transgene demonstrated superior antitumor activity in the immunotherapy of B16 melanoma. Thus, we sought to investigate the biological impact of constitutive IL-15 expression by human lymphocytes. In this report we describe the generation of a retroviral vector encoding a codon-optimized IL-15 gene.” (Hsu et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to include an IL-15 gene as disclosed by GenBank and Hsu to the composition of Clemente-Casares, Lee, Gattinoni, and Wang to arrive at the claimed invention because Clemente-Casares contemplates additional molecules to enhance activity and Hsu discloses that transfection of IL-15 mRNA can improve immunotherapy outcomes. A person of ordinary skill in the art would be motivated to make this combination to improve immunotherapy outcomes as disclosed by Hsu and would have a reasonable expectation of success because Reichmuth discloses that nanoparticles, such as lipid nanoparticles can transfect mRNA cargo: “LNPs offer a number of advantages over other vec-tors, including protection of nonstabilized mRNA, the large payload that can be delivered, adjuvants that can be codelivered, the possibility to decorate them with targeting ligands and the ease of simple synthesis.” (Reichmuth et al., page 328, col. 2, para. 2). Consequently, claim 22 is obvious over Clemente-Casares et al. in view of Wang et al., Lee et al., and Gattinoni et al. as applied to claim 19, further in view of Hsu et al., GenBank, and Reichmuth et al. and rejected. Free of the Prior Art Regarding claim 15, the prior art does not provide a teaching, suggestion, or motivation to utilize this particular density of MHC molecule on the surface of any nanoparticle contemplated in the prior art. Therefore, this claim 15 is free of the prior art but not allowable because of the rejection under U.S.C. 112(b) described above. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 2, 6, 8, 12-14, and 19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 8-14, 17-18, 20, 24-25, 27-28, 33-34, and 47 of copending Application No. 19/527,805 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 1, claim 1 of the ‘805 application recites: “An antigen-presenting nanoparticle (APN), comprising: a major histocompatibility complex (MHC) presented on a surface of the APN and comprising a peptide epitope; and an encapsulated nucleic acid encoding a chimeric antigen receptor (CAR), antibody, or antibody fragment.” Consequently, claim 1 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 2, claim 2 of the ‘805 application recites: “The APN of claim 1, wherein the MHC is MHC class I or MHC class II.” Consequently, claim 2 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 6, claim 1 of the ‘805 application recites: “An antigen-presenting nanoparticle (APN), comprising: a major histocompatibility complex (MHC) presented on a surface of the APN and comprising a peptide epitope; and an encapsulated nucleic acid encoding a chimeric antigen receptor (CAR), antibody, or antibody fragment.” Consequently, claim 6 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 8, claim 3 of the ‘805 application recites: “The APN of claim 1, wherein the peptide epitope is an epitope of a virus, bacteria, fungus, or parasite.” Consequently, claim 8 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 12, claim 11 of the ‘805 application recites: “The APN of claim 1, wherein the APN is a lipid nanoparticle, a liposome, or a polymeric nanoparticle.” Consequently, claim 12 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 13, claim 13 of the ‘805 application recites: “The APN of claim 12, wherein the at least one ionizable lipid comprises cKK-E12, SM102, MC3, Lipid-5, Alc-0315, LPO1, Lipid A9, or any combination thereof; and/or wherein the at least one PEGylated lipid comprises ALC-0159, DMG-PEG, DSPE-PEG, PEG14-2000, or any combination thereof.” Consequently, claim 13 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 14, claim 1 of the ‘805 application recites: “An antigen-presenting nanoparticle (APN), comprising: a major histocompatibility complex (MHC) presented on a surface of the APN and comprising a peptide epitope; and an encapsulated nucleic acid encoding a chimeric antigen receptor (CAR), antibody, or antibody fragment.” Consequently, claim 14 is anticipated by the ‘805 application and provisionally rejected. Regarding claim 19, claim 1 of the ‘805 application recites: “An antigen-presenting nanoparticle (APN), comprising: a major histocompatibility complex (MHC) presented on a surface of the APN and comprising a peptide epitope; and an encapsulated nucleic acid encoding a chimeric antigen receptor (CAR), antibody, or antibody fragment.” Consequently, claim 19 is anticipated by the ‘805 application and provisionally rejected. Claim 3 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 8-14, 17-18, 20, 24-25, 27-28, 33-34, and 47 of copending Application No. 19/527,805 (reference application) as applied to claim 1, further in view of Xu et al. (Xu, et al. Diabetologia 60.12: 2418-2431 (2017)). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 3, claim 1 is anticipated as described above. The ‘805 application does not specifically disclose the case wherein the MHC molecule comprises HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*07:02, HLA-A*11:01, or HLA-A*24:02. However, Xu discloses the usage of HLA-A*02:01 MHC molecules in the context of nanoparticles to treat diabetes: “Induction of antigen-specific immunological tolerance may provide an attractive immunotherapy in the NOD mouse model but the conditions that lead to the successful translation to human type 1 diabetes are limited. In this study, we covalently linked 500 nm carboxylated polystyrene beads (PSB) with a mixture of immunodominant HLA-A*02:01-restricted epitopes (peptides-PSB) that may have high clinical relevance in humans as they promote immune tolerance; we then investigated the effect of the nanoparticle–peptide complexes on T cell tolerance.” (Xu et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the MHC molecule disclosed by Xu in the general pMHC-nanoparticle scheme of the ‘805 application to arrive at the claimed invention because Xu is also attaching a pMHC to a nanoparticle for the specific purpose of treating diabetes. A person of ordinary skill in the art would be motivated to make this combination to treat diabetes as disclosed by Xu and have a reasonable expectation of success because Xu shows that HLA-A*02:01 MHC molecules attached to nanoparticles have effects in vivo (Xu et al., pages 2420 and 2422, Figs 2 and 3). Consequently, claim 3 is obvious over the ‘805 application as applied to claim 1, further in view of Xu et al. and provisionally rejected. Claims 4, 16, and 17 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 8-14, 17-18, 20, 24-25, 27-28, 33-34, and 47 of copending Application No. 19/527,805 (reference application) as applied to claim 2 above, further in view of Agarwal et al. (Agarwal, et al. Bioconjugate chemistry 26.2: 176-192 (2015) as evidenced by Bjorkman et al. (Bjorkman, et al. Annual review of biochemistry 59.1: 253-288 (1990)). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 4, claim 1 is anticipated as described above. The ‘805 application does not explicitly disclose a heavy chain that comprises a C-terminal cysteine. However, Bjorkman discloses that MHC molecules possess heavy chains: “HLA-A, B, and C heavy chains are homologous structures, showing only minor differences in the size of the transmembrane and cytoplasmic domains. Within the 274 residues of the a~, az, and a3 domains, a total of 165 positions or 61% of the total are invariant between the 25 HLA-A, 35 HLA-B, and 18 HLA-C sequences that have been determined (Figure 4). These positions include the invariant glycosylation site at position 86 in al, the cysteines at positions 101, 164, 203, and 259 that form the disulfide bonds of a2 and a3, and many of the residues involved in contacting /32m (Figure 4).” (Bjorkman et al., page 274, para. 2) Furthermore, Agarawal discloses the usage of C-terminal cysteines to provide conjugation points: “Alternatively, C-terminal cysteine residues could be treated with a maleimide reagent containing an aminothiol masked as its formaldehyde-derived thiazolidine. Following deblocking, conjugation of the aminothiol-containing proteins to an aldehyde-functionalized cematodin derivative provided site-specifically modified diabodies, although the reaction required up to 4 days at pH 4.5 to proceed. The thiazolidine linkages exhibited half-lives of roughly 2 days in PBS at 37 ?C. While the field has generally moved away from linkers that provide slow nonspecific cleavage of the ADC (such as the hydrazone linker used to prepare Mylotarg) due to concerns about toxicity arising from premature drug release, the rationale for engineering a half-life into the linker here was to use it with antibodies targeting poorly internalized antigens. With the advent of a system to ribosomally incorporate an unnatural amino acid containing a masked 1,2-aminothiol that can be deprotected without disrupting native disulfide bonds, (47) the thiazolidine ligation could also be useful for modification at interior sites on an antibody; alternatively, the 1,2-aminothiol moiety could be treated with a cyanobenzothiazole reagent to form a more stable linkage.” (Agarwal et al, page 181, col. 2, para. 2). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to insert a C-terminal cysteine as disclosed by Agarwal into the heavy chain of an MHC molecule as disclosed by the ‘805 application to arrive at the claimed invention because Agarwal shows the usage of such cysteines in heavy chains (Agarwal et al., page 179, Fig. 2). A person of ordinary skill in the art would be motivated to substitute or insert a cysteine as disclosed by Agarwal to create a stable linkage to another molecule using a scheme that does not disrupt native disulfide bonds as described above. A person of ordinary skill in the art would have a reasonable expectation of success because Agarwal discloses that such cysteine conjugation schemes are well-known: “Cysteine conjugation is the testing ground on which much of our current knowledge about site-specific ADCs was built. In coming years, cysteine will continue to be a popular target for conjugation based on the new generation of cysteine-specific chemistries that promise to fix the problem of maleimide exchange. Cysteine alkylation reactions are typically quite fast, making these conjugation schemes an appealing choice.” (Agarwal et al., page 181, col. 2, para. 3). Consequently, claim 4 is obvious over the ‘805 application as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Regarding claim 16, claim 1 is anticipated as described above. The ‘805 application does not specifically disclose conjugation of the MHC to linker at the C-terminus. However, Agarwal discloses the usage of C-terminal cysteines to provide conjugation points: “Alternatively, C-terminal cysteine residues could be treated with a maleimide reagent containing an aminothiol masked as its formaldehyde-derived thiazolidine. Following deblocking, conjugation of the aminothiol-containing proteins to an aldehyde-functionalized cematodin derivative provided site-specifically modified diabodies, although the reaction required up to 4 days at pH 4.5 to proceed. The thiazolidine linkages exhibited half-lives of roughly 2 days in PBS at 37 ?C. While the field has generally moved away from linkers that provide slow nonspecific cleavage of the ADC (such as the hydrazone linker used to prepare Mylotarg) due to concerns about toxicity arising from premature drug release, the rationale for engineering a half-life into the linker here was to use it with antibodies targeting poorly internalized antigens. With the advent of a system to ribosomally incorporate an unnatural amino acid containing a masked 1,2-aminothiol that can be deprotected without disrupting native disulfide bonds, (47) the thiazolidine ligation could also be useful for modification at interior sites on an antibody; alternatively, the 1,2-aminothiol moiety could be treated with a cyanobenzothiazole reagent to form a more stable linkage.” (Agarwal et al, page 181, col. 2, para. 2). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to insert a C-terminal cysteine as disclosed by Agarwal into the heavy chain of an MHC molecule as disclosed by the ‘805 application and use that cysteine to conjugate a linker as disclosed by Agarwal to arrive at the claimed invention because Agarwal describes that such a linker scheme is stable and does not disrupt the natural disulfide bonds. A person of ordinary skill in the art would be motivated to create a stable linkage to another molecule using a scheme as described by Agarwal that does not disrupt native disulfide bonds as described above. A person of ordinary skill in the art would have a reasonable expectation of success because Agarwal discloses that such cysteine conjugation schemes are well-known: “Cysteine conjugation is the testing ground on which much of our current knowledge about site-specific ADCs was built. In coming years, cysteine will continue to be a popular target for conjugation based on the new generation of cysteine-specific chemistries that promise to fix the problem of maleimide exchange. Cysteine alkylation reactions are typically quite fast, making these conjugation schemes an appealing choice.” (Agarwal et al., page 181, col. 2, para. 3). Consequently, claim 16 is obvious over the ‘805 application as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Regarding claim 17, claim 16 is obvious as described above. The ‘805 application discloses a nanoparticle covered in pMHC molecules. It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the conjugation scheme of Agarwal to attach pMHC molecules to the nanoparticle as disclosed by the ‘805 application because Agarwal discloses that this attachment scheme creates a stable linkage and does not interfere with the native disulfide bonding. A person of ordinary skill in the art would be motivated to make this linkage in order to create the composition of the ‘805 application and have a reasonable expectation of success because Agarwal discloses that this scheme creates a stable linkage and does not interfere with the native disulfide bonding. Consequently, claim 17 is obvious over the ‘805 application as applied to claim 1, further in view of Agarwal et al. as evidenced by Bjorkman et al. and rejected. Claim 9 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 8-14, 17-18, 20, 24-25, 27-28, 33-34, and 47 of copending Application No. 19/527,805 (reference application) as applied to claim 1, further in view of Bakker et al. (Bakker, et al. Proceedings of the National Academy of Sciences 105.10: 3825-3830 (2008)). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 9, claim 8 is anticipated as described above. The ‘805 application does not specifically disclose any of the recited viruses. However, Bakker discloses the case wherein MHC class I molecules are bound to various peptides: “Based on these considerations, it seemed valuable to devise technologies that allow the high-throughput parallel generation of peptide-MHC class I complexes. As a step toward this goal, we recently designed an HLA-A2-specific peptide that contains a photocleavable moiety (8). When refolding reactions of HLA-A2 heavy chain and _2m are performed with this ligand, stable HLA-A2 complexes are formed. However, upon irradiation with long-wavelength UV, the ligand is cleaved and dissociates from the HLA-A2 complex. The resulting empty HLA-A2 complexes disintegrate rapidly, unless UV exposure is performed in the presence of a ‘‘rescue peptide.’’ In this case, the peptide-binding groove that has been vacated by UV exposure will be occupied by the rescue peptide, resulting in the formation of stable pMHC complexes with a distinct T cell specificity. The utility of this approach has been demonstrated by the identification of an HLA-A2-restricted CTL epitope from an H5N1 influenza strain isolated from a lethal case of avian influenza infection in humans (8).” (Bakker et al., page 3825, col. 2, para. 2). Bakker also discloses an influenza epitope: PNG media_image2.png 34 356 media_image2.png Greyscale (Bakker et al., page 3829, Table 1). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the viral peptide disclosed by Bakker with the composition disclosed by the ‘805 application to arrive at the claimed invention because Bakker discloses MHC binding peptides against targets of interest and MHC-peptide complexes are part of the composition of the ‘805 application. A person of ordinary skill in the art would be motivated to bind a viral protein such as influenza in order to observe T-cell reactions to the overall composition: “As a first step in the mapping of disease-associated T cell epitopes, peptide fragments of disease-associated proteomes may be analyzed for binding to MHC molecules of interest, and subsequent assays can then be used to determine whether T cell reactivity against such pMHC complexes does occur. As demonstrated in a landmark study by Altman and colleagues (1), such antigen-specific T cell reactivity can efficiently be detected by the staining of T cell populations with recombinant fluorescent multimeric MHC molecules.” (Bakker et al., page 3825, col. 1, para. 1). A person of ordinary skill in the art would have a reasonable expectation of success because both Bakker and the ‘805 application reference MHC molecules and therefore the peptides should bind in either situation because the MHC molecules can be the same. Consequently, claim 9 is obvious over the ‘805 application. as applied to claim 8, further in view of Bakker et al. and rejected. Claim 18 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 8-14, 17-18, 20, 24-25, 27-28, 33-34, and 47 of copending Application No. 19/527,805 (reference application) in view of Agarwal et al. (Agarwal, et al. Bioconjugate chemistry 26.2: 176-192 (2015) as evidenced by Bjorkman et al. (Bjorkman, et al. Annual review of biochemistry 59.1: 253-288 (1990)) as applied to claim 16 above, further in view of Ravasco et al. (Ravasco, et al. Chemistry–A European Journal 25.1: 43-59. (2019)).. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 18, claim 16 is obvious as described above. The ‘805 application, Agarwal, and Bjorkman do not disclose a specific linker type. However, Ravasco discloses the usage of maleimide linkages: “Maleimide chemistry stands out in the bioconjugation toolbox by virtue of its synthetic accessibility, excellent reactivity, and practicability. The second-generation of clinically approved antibody–drug conjugates (ADC) and much of the current ADC pipeline in clinical trials contain the maleimide linkage. However, thiosuccinimide linkages are now known to be less robust than once thought, and ergo, are correlated with suboptimal pharmacodynamics, pharmacokinetics, and safety profiles in some ADC constructs. Rational design of novel generations of maleimides and maleimide-type reagents have been reported to address the shortcomings of classical maleimides, allowing for the formation of robust bioconjugate linkages. This review highlights the main strategies for rational reagent design that have allowed irreversible bioconjugations in cysteines, reversible labelling strategies and disulfide re-bridging.” (Ravasco et al., Abstract). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use a maleimide linker as disclosed by Ravasco to arrive at the claimed invention because Ravasco discloses that maleimide linkers have good reactivity and are currently used by many drugs. A person of ordinary skill in the art would use this linker because it has good reactivity and would have a reasonable expectation of success because Ravasco discloses a diagram with the exact scenario set up by the C-terminal cysteine scheme disclosed by Agarwal: PNG media_image4.png 410 412 media_image4.png Greyscale (Ravasco et al., page 46, Scheme 2). Consequently, claim 18 is obvious over the ‘805 application in view of Agarwal et al. as evidenced by Bjorkman et al. as applied to claim 16, further in view of Ravasco et al. and rejected. Conclusion No claim is allowed. Claims 1-6, 8-19, and 22 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to David Paul Bowles whose telephone number is (571)272-0919. The examiner can normally be reached Monday-Friday 8:30-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Lianko Garyu can be reached on (571) 270-7367. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DAVID PAUL BOWLES/ Examiner, Art Unit 1654 /LIANKO G GARYU/ Supervisory Patent Examiner, Art Unit 1654
Read full office action

Prosecution Timeline

Oct 19, 2023
Application Filed
Sep 15, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703726
COMPOSITIONS AND METHODS FOR THE TREATMENT OF CYSTIC FIBROSIS
3y 9m to grant Granted Aug 11, 2026
Patent 12698307
NOVEL CELLULAR DELIVERY METHODS
4y 1m to grant Granted Aug 04, 2026
Patent 12648942
METHOD FOR TREATING ACUTE ISCHEMIC STROKE
2y 8m to grant Granted Jun 09, 2026
Patent 12629405
EZRIN PEPTIDE 1 FOR USE IN A METHOD OF TREATING COVID-19
3y 7m to grant Granted May 19, 2026
Patent 12594326
COMPOSITIONS OF GLP-1 PEPTIDES AND PREPARATION THEREOF
1y 1m to grant Granted Apr 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
73%
Grant Probability
95%
With Interview (+22.4%)
3y 6m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month