Prosecution Insights
Last updated: July 17, 2026
Application No. 18/287,758

COMPOSITIONS AND METHODS FOR TREATING RETINAL DEGENERATIVE DISORDERS

Non-Final OA §103
Filed
Oct 20, 2023
Priority
Apr 20, 2021 — EU 21169473.2 +1 more
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Sorbonne Université
OA Round
1 (Non-Final)
69%
Grant Probability
Favorable
1-2
OA Rounds
2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 69% — above average
69%
Career Allowance Rate
44 granted / 64 resolved
+8.8% vs TC avg
Strong +43% interview lift
Without
With
+43.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
52 currently pending
Career history
115
Total Applications
across all art units

Statute-Specific Performance

§101
4.1%
-35.9% vs TC avg
§103
55.2%
+15.2% vs TC avg
§102
2.5%
-37.5% vs TC avg
§112
14.6%
-25.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 64 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made of Applicant’s National Stage entry of PCT Application PCT/EP2022/060462 filed on 4/20/2022 and Foreign Application EP 21169473.2 filed on 4/20/2021. A certified priority document EP 21169473.2 has been properly added to the priority chain. The copy has been made available from the WIPO Digital Access Service. The certified copy provides support for the priority date to be the filing date of the foreign application; i.e., April 20th, 2021. Election/Restrictions Applicant’s election of Group I comprising claims 1-10 and 16-18 in the reply filed on 5/18/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 11-15 and 19-23 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Status of the Claims Claims 1-10 and 16-18 are under prosecution. Drawings The drawings filed on 10/20/2023 are objected to as failing to comply with 37 CFR 1.84(u)(1) because: the labels for Figures 1 - 6 are preceded by the word "Figure" instead of the abbreviation "FIG.". MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1 and 8-10 are rejected under 35 U.S.C. 103 as being unpatentable over Leveillard (US 20200318138 A1) in view of Golz (WO 2005054848 A2). Regarding claim 1, Leveillard teaches a pharmaceutical composition for treating and/or preventing neurodegenerative disorders [0001]. The composition comprises an adeno-associated vector (AAV) comprising: [0024]: a first expression cassette comprising a first nucleic acid encoding RdCVF and [0025]: a second expression cassette comprising a second nucleic acid encoding RdCVFL. Leveillard teaches how to make AAV vectors comprising expression cassettes (Production of Viral Vectors [0133]). Thus, Leveillard’s teachings, read on instant recitation of one or several viral vectors comprising nucleic acids encoding RdCVF and RdCVFL. Regarding claim 8, Leveillard taught SEQ ID: 3 corresponding to the sequence of the human short isoform of RdCVF (hRdCVF, [0045]). See alignment below of instant SEQ ID NO: 1 comprising 109 amino acids with Leveillard’s nucleic acid sequence: RESULT 1 US-16-956-894-3 Alignment Scores: Length: 330 Score: 556.00 Matches: 109 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 50.5% Indels: 0 DB: 1 Gaps: 0 US-18-287-758-2 (1-212) x US-16-956-894-3 (1-330) Qy 1 MetAlaSerLeuPheSerGlyArgIleLeuIleArgAsnAsnSerAspGlnAspGluLeu 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGGACGAGCTG 60 Qy 21 AspThrGluAlaGluValSerArgArgLeuGluAsnArgLeuValLeuLeuPhePheGly 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGTTCTTTGGT 120 Qy 41 AlaGlyAlaCysProGlnCysGlnAlaPheValProIleLeuLysAspPhePheValArg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCTTCGTGCGG 180 Qy 61 LeuThrAspGluPheTyrValLeuArgAlaAlaGlnLeuAlaLeuValTyrValSerGln 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACGTGTCCCAG 240 Qy 81 AspSerThrGluGluGlnGlnAspLeuPheLeuLysAspMetProLysLysTrpLeuPhe 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAATGGCTTTTC 300 Qy 101 LeuProPheGluAspAspLeuArgArg 109 ||||||||||||||||||||||||||| Db 301 CTGCCCTTTGAGGATGATCTGAGGAGG 327 Regarding claim 9, Leveillard taught SEQ ID: 5 corresponding to the human long isoform of RdCVF (hRdCVF, [0049]). See alignment below of instant SEQ ID NO: 2 comprising 212 amino acids with Leveillard’s nucleic acid sequence: RESULT 1 US-16-956-894-5 Alignment Scores: Length: 639 Score: 1100.00 Matches: 212 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 DB: 1 Gaps: 0 US-18-287-758-2 (1-212) x US-16-956-894-5 (1-639) Qy 1 MetAlaSerLeuPheSerGlyArgIleLeuIleArgAsnAsnSerAspGlnAspGluLeu 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGGACGAGCTG 60 Qy 21 AspThrGluAlaGluValSerArgArgLeuGluAsnArgLeuValLeuLeuPhePheGly 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGTTCTTTGGT 120 Qy 41 AlaGlyAlaCysProGlnCysGlnAlaPheValProIleLeuLysAspPhePheValArg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCTTCGTGCGG 180 Qy 61 LeuThrAspGluPheTyrValLeuArgAlaAlaGlnLeuAlaLeuValTyrValSerGln 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACGTGTCCCAG 240 Qy 81 AspSerThrGluGluGlnGlnAspLeuPheLeuLysAspMetProLysLysTrpLeuPhe 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAATGGCTTTTC 300 Qy 101 LeuProPheGluAspAspLeuArgArgAspLeuGlyArgGlnPheSerValGluArgLeu 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTGCCCTTTGAGGATGATCTGAGGAGGGACCTCGGGCGCCAGTTCTCAGTGGAGCGCCTG 360 Qy 121 ProAlaValValValLeuLysProAspGlyAspValLeuThrArgAspGlyAlaAspGlu 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCGGCGGTCGTGGTGCTCAAGCCGGACGGGGACGTGCTCACTCGCGACGGCGCCGACGAG 420 Qy 141 IleGlnArgLeuGlyThrAlaCysPheAlaAsnTrpGlnGluAlaAlaGluValLeuAsp 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ATCCAGCGCCTGGGCACCGCCTGCTTCGCCAACTGGCAGGAGGCGGCCGAGGTGCTGGAC 480 Qy 161 ArgAsnPheGlnLeuProGluAspLeuGluAspGlnGluProArgSerLeuThrGluCys 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CGCAACTTCCAGCTGCCAGAGGACCTGGAGGACCAGGAGCCACGGAGCCTCACCGAGTGC 540 Qy 181 LeuArgArgHisLysTyrArgValGluLysAlaAlaArgGlyGlyArgAspProGlyGly 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CTGCGCCGCCACAAGTACCGCGTGGAAAAGGCGGCGCGAGGCGGGCGCGACCCCGGGGGA 600 Qy 201 GlyGlyGlyGluGluGlyGlyAlaGlyGlyLeuPhe 212 |||||||||||||||||||||||||||||||||||| Db 601 GGGGGTGGGGAGGAGGGCGGGGCCGGGGGGCTGTTC 636 Leveillard does not teach a nucleic acid encoding a G protein-activated Inward Rectifier potassium channel 2 (GIRK2). However, before the effective filing date of instant invention, Golz had taught a composition comprising GIRK2 for the treatment of neurological diseases (pg. 1, first para; variety of expression vector/host systems can be utilized to contain and express sequences encoding GIRK2 , pg. 18, first para; >gb|U24660.1|HSU24660 Human G protein coupled inward rectifier potassium channel 2(hiGIRK2) mRNA, complete cds, pg. 66, first para; claim 28). Golz taught GIRK2 polynucleotides can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Golz taught that the method of making such constructs are known to one skilled in the art (pg. 17, last para). Regarding claim 10, Golz taught SEQ ID: 1 corresponding to the sequence of human GIRK2 (SEQ ID: 1 = nucleic acid, SEQ ID: 2 = amino acid; pg. 1, first para). See alignment below of instant SEQ ID NO: 9 comprising 423 amino acids with Golz nucleic acid sequence: RESULT 1 WO2005054848A2_SEQ1 Alignment Scores: Length: 2598 Score: 2197.00 Matches: 423 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 DB: 1 Gaps: 0 US-18-287-758-9 (1-423) x WO2005054848A2_SEQ1 (1-2598) Qy 1 MetAlaLysLeuThrGluSerMetThrAsnValLeuGluGlyAspSerMetAspGlnAsp 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 652 ATGGCCAAGCTGACAGAATCCATGACTAACGTCCTGGAGGGCGACTCCATGGATCAGGAC 711 Qy 21 ValGluSerProValAlaIleHisGlnProLysLeuProLysGlnAlaArgAspAspLeu 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 712 GTCGAAAGCCCAGTGGCCATTCACCAGCCAAAGTTGCCTAAGCAGGCCAGGGATGACCTG 771 Qy 41 ProArgHisIleSerArgAspArgThrLysArgLysIleGlnArgTyrValArgLysAsp 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 772 CCAAGACACATCAGCCGAGATCGGACCAAAAGGAAAATCCAGAGGTACGTGAGGAAAGAC 831 Qy 61 GlyLysCysAsnValHisHisGlyAsnValArgGluThrTyrArgTyrLeuThrAspIle 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 832 GGAAAGTGCAATGTTCATCACGGCAACGTGAGGGAGACCTATCGCTACCTGACCGATATC 891 Qy 81 PheThrThrLeuValAspLeuLysTrpArgPheAsnLeuLeuIlePheValMetValTyr 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 892 TTCACCACATTAGTGGACCTGAAGTGGAGATTCAACCTATTGATTTTTGTCATGGTTTAC 951 Qy 101 ThrValThrTrpLeuPhePheGlyMetIleTrpTrpLeuIleAlaTyrIleArgGlyAsp 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 952 ACAGTGACCTGGCTCTTTTTTGGAATGATCTGGTGGTTGATCGCATACATACGGGGAGAC 1011 Qy 121 MetAspHisIleGluAspProSerTrpThrProCysValThrAsnLeuAsnGlyPheVal 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1012 ATGGACCACATAGAGGACCCCTCCTGGACTCCTTGTGTTACCAACCTCAACGGGTTCGTC 1071 Qy 141 SerAlaPheLeuPheSerIleGluThrGluThrThrIleGlyTyrGlyTyrArgValIle 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1072 TCTGCTTTTTTATTCTCAATAGAGACAGAAACCACCATTGGTTATGGCTACCGGGTCATC 1131 Qy 161 ThrAspLysCysProGluGlyIleIleLeuLeuLeuIleGlnSerValLeuGlySerIle 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1132 ACAGATAAATGCCCGGAGGGAATTATTCTTCTCTTAATCCAATCTGTGTTGGGGTCCATT 1191 Qy 181 ValAsnAlaPheMetValGlyCysMetPheValLysIleSerGlnProLysLysArgAla 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1192 GTCAATGCATTCATGGTGGGATGCATGTTTGTAAAAATCTCTCAACCCAAGAAGAGGGCA 1251 Qy 201 GluThrLeuValPheSerThrHisAlaValIleSerMetArgAspGlyLysLeuCysLeu 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1252 GAGACCCTGGTCTTTTCCACCCATGCAGTGATCTCCATGCGGGATGGGAAACTGTGCCTG 1311 Qy 221 MetPheArgValGlyAspLeuArgAsnSerHisIleValGluAlaSerIleArgAlaLys 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1312 ATGTTCCGGGTAGGGGACCTTAGGAATTCCCACATTGTGGAGGCTTCCATCAGAGCCAAG 1371 Qy 241 LeuIleLysSerLysGlnThrSerGluGlyGluPheIleProLeuAsnGlnThrAspIle 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1372 TTGATCAAATCCAAACAGACCTCGGAGGGGGAGTTCATCCCGTTGAACCAGACGGATATC 1431 Qy 261 AsnValGlyTyrTyrThrGlyAspAspArgLeuPheLeuValSerProLeuIleIleSer 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1432 AACGTAGGGTATTACACGGGGGATGACCGTCTGTTTCTGGTGTCACCGCTGATCATTAGC 1491 Qy 281 HisGluIleAsnGlnGlnSerProPheTrpGluIleSerLysAlaGlnLeuProLysGlu 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1492 CATGAAATTAACCAACAGAGTCCTTTCTGGGAGATCTCCAAAGCCCAGCTGCCCAAAGAG 1551 Qy 301 GluLeuGluIleValValIleLeuGluGlyMetValGluAlaThrGlyMetThrCysGln 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1552 GAACTGGAAATTGTGGTCATCCTAGAAGGAATGGTGGAAGCCACAGGGATGACATGCCAA 1611 Qy 321 AlaArgSerSerTyrIleThrSerGluIleLeuTrpGlyTyrArgPheThrProValLeu 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1612 GCTCGAAGCTCCTACATCACCAGTGAGATCCTGTGGGGTTACCGGTTCACACCTGTCCTG 1671 Qy 341 ThrLeuGluAspGlyPheTyrGluValAspTyrAsnSerPheHisGluThrTyrGluThr 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1672 ACCCTGGAGGATGGGTTCTACGAAGTTGACTACAACAGCTTCCATGAGACCTATGAGACC 1731 Qy 361 SerThrProSerLeuSerAlaLysGluLeuAlaGluLeuAlaSerArgAlaGluLeuPro 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1732 AGCACCCCATCCCTTAGTGCCAAAGAGCTGGCCGAGTTAGCCAGCAGGGCAGAGCTGCCC 1791 Qy 381 LeuSerTrpSerValSerSerLysLeuAsnGlnHisAlaGluLeuGluThrGluGluGlu 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1792 CTGAGTTGGTCTGTATCCAGCAAACTCAACCAACATGCAGAACTGGAGACTGAAGAGGAA 1851 Qy 401 GluLysAsnLeuGluGluGlnThrGluArgAsnGlyAspValAlaAsnLeuGluAsnGlu 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1852 GAAAAGAACCTCGAAGAGCAAACAGAAAGAAATGGTGATGTGGCAAACCTGGAGAATGAA 1911 Qy 421 SerLysVal 423 ||||||||| Db 1912 TCCAAAGTT 1920 It would have been obvious to one of ordinary skill in the art before the instant invention to modify the composition of Leveillard comprising an AAV vector encoding RdCVF and RdCVFL with the addition of GIRK2 because it is prima facie obvious to combine two known agents for the treatment of neurological disease into a single composition for the treatment of the same disease. The MPEP states: "It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980). There would have been a reasonable expectation of success in making this addition because both the RdCVF and RdCVFL of Leveillard with the addition of GIRK2 of Golz are known agents for the treatment of neurological diseases. Thus, Leveillard in view of Golz make obvious instant claims 1 and 8-10. Claim(s) 2-4 and 6-7 are rejected under 35 U.S.C. 103 as being unpatentable over Leveillard (US 20200318138 A1) in view of Golz (WO 2005054848 A2) as discussed for claims 1 and 8-10 above and evidenced by Vickers (Vickers et al. Microbial Cell Factories 2013, 12:96). Regarding claim 2-4, the claims require the three distinct encoded proteins of claim 1 to be either comprised in vectors wherein one vector comprises both the rod-derived factors and another vector comprises the GRIK2 (claim 2) or encoding each protein separately (claim 3), or all together in one vector (claim 4). Each such combination is a matter of design choice, and one of skill in the art knows, and as evidenced by Vickers, each expression cassette discussed above can be carried in a separate viral vector or together in one vector or any combination of vectors. Vickers evidences each expression cassette may be contained in a separate or single vector (Several dual gene expression cassette vectors have been developed as have single gene expression vectors that can be used combinatorially for metabolic engineering applications, pg. 2, R col., 2nd para). Thus, it would be prima facie obvious to make a design choice of separating the expression constructs into distinct viral vectors or encode all the therapeutic agents into one viral vector. See MPEP 2144.05 II and In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions."). One would have had reasonable expectation of success in making the different configurations of expression constructs in vectors because each expression construct would be doing the same thing; i.e., expressing the encoded proteins when present in one vector as it would when present in distinct vectors. Regarding claims 6-7, the preamble of these claims recites a “kit.” The specification, however, does not define this term, and so it is being interpreted to encompass any collection of reagents that includes all of the elements of the claims. Any further interpretation of the word is considered an “intended use” and does not impart any further structural limitation of on the claimed subject matter.. The limitations of these claims were discussed for claim 1-4 above and are similarly applied. Thus, Leveillard in view of Golz make obvious instant claims 2-4 and 6-7. Claim(s) 5 and 16-18 are rejected under 35 U.S.C. 103 as being unpatentable over Leveillard (US 20200318138 A1) in view of Golz (WO 2005054848 A2). Regarding claims 5 and 16-18, the composition of Leveillard comprising an AAV vector encoding RdCVF and RdCVFL with the addition of GIRK2 was made obvious in the rejection of claim 1 above. Since instant claim requires a viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL and GIRK2, the teachings of Leveillard and Golz, discussed above as applied to claims 1 and 7-9 are similarly applied to claims 5 and 16-18. Thus, Leveillard in view of Golz make obvious instant claims 5 and 16-18. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Conclusion No claims are allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Oct 20, 2023
Application Filed
Jun 25, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680103
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jul 14, 2026
Patent 12644124
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jun 02, 2026
Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
1y 10m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 4m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
69%
Grant Probability
99%
With Interview (+43.0%)
2y 11m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 64 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month