Prosecution Insights
Last updated: September 26, 2026
Application No. 18/288,778

CIRCULATING NONCODING RNAS AS A SIGNATURE OF AUTISM SPECTRUM DISORDER SYMPTOMATOLOGY

Non-Final OA §101§103§112
Filed
Oct 27, 2023
Priority
Apr 28, 2021 — provisional 63/180,952 +1 more
Examiner
JONES, CHRISTINE MICHELLE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Qatar Foundation for Education, Science and Community Development
OA Round
1 (Non-Final)
0%
Grant Probability
At Risk
1-2
OA Rounds
0m
Est. Remaining
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 1 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
41 currently pending
Career history
35
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
31.8%
-8.2% vs TC avg
§102
13.9%
-26.1% vs TC avg
§112
23.4%
-16.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election with without traverse of the combination of miRNA, piRNA, and Y RNA in the reply filed on June 24, 2026 is acknowledged. Applicant’s amendments of claim 6, 10, 14, 18, 21, and 27 in the reply filed June 24, 2026 are acknowledged. Claim(s) 1-4, 6-12, 14-16, 18-21, 26, and 27 is/are currently pending and have been examined herein to the extent that they read the elected types of cir-ncRNA. The additionally recited species have been withdrawn from consideration as being directed to non-elected subject matter. Priority It is acknowledged that the instant application is a 371 of international PCT Application No. PCT/QA2022/050007, filed April 28, 2022, and that it claims benefit of provisional 63/180,952, filed April 28, 2021. The effective filing date is considered to be April 28, 2021. Claim Interpretation The miRNA, piRNA, and Y RNA recited in claims 10-12, 14-16, and 18-20 are interpreted as the sequences enumerated in the specification (Tables 1-3: SEQ ID NOs: 86-111) and any related sequences. Please see the document ‘NCBI Entries’ (pg. 8-16) for alignments showing correspondence between SEQ ID NOs: 86-111 and the GenBank sequences relied upon in the rejections under 35 U.S.C. 103. Please see the rejection of claims 10-12 and 14-16 under 35 U.S.C. 112(b) for a discussion of indefiniteness of claim terminology regarding these cir-ncRNA. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-4, 6-12, 14-16, 18-21, 26, and 27 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1-4, 6-12, 14-16, 18-21, 26, and 27 are rejected for the recitation of “quantitating the level of multiple cir-ncRNA from a predetermined panel” in claims 1 and 2, and “wherein the panel comprises” in claims 10, 14, and 18. These limitations are considered indefinite because it is unclear if the claim requires that all members of the predetermined panel of cir-ncRNA are quantitated in the sample, or if the claim merely requires that the quantitation includes a plurality of the predetermined cir-ncRNA. As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. For the purposes of compact prosecution, the combined limitations of claim 1 and claims 10-12, 14-16, and 18-20 are considered to mean that any two or more of the specified cir-ncRNA must be quantitated. However, if what was meant is quantitating the level of all, or a specific set, of a predetermined panel of cir-ncRNA…, the claims must be amended to reflect that meaning using transitional phrase “consisting of”, see MPEP 2111.03. Claims 1-4, 6-12, 14-16, 18-21, 26, and 27 are rejected for the recitation of “a child potentially having autism spectrum disorder” in claim 1 and “a potentially affected child” in claim 2, as indefinite. All children have the potential to have or be affected by autism spectrum disorders, and thus it is unclear how the language is meant to limit the invention. As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Claims 2-4 are rejected because it is not clear how the recited preamble is intended to breathe life and meaning into the claim. The preamble recites a method of “diagnosing or stratifying” ASD, yet the method only requires the active process steps of quantitating circ-ncRNA and matching the levels to an ASD-associated profile. It is not clear if the applicant intends to cover only a method of quantitating and matching cir-ncRNA levels, or if the method is intended to somehow require more to accomplish the goal set forth in the preamble. If it is the latter, then it appears the claims are incomplete, as they fail to provide any active steps that clearly accomplish the goal set forth by the preamble of the claims. As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Claims 3 and 4 are rejected for the recitation of “matching” in claim 3, as indefinite. The term “matching” is not given a clear, limiting definition in either the claims or the specification and it is unclear what is intended by the language of the claim. Would the limitation be met by a method in which levels of cir-ncRNA known to be associated with ASD are simply measured in a child, or is the claim meant to require that the levels of the panel cir-ncRNA are compared to reference levels an ASD-associated control subject and assessed as being equivalent or not? Is the profile required to include all members of the measured predetermined panel, or can the measured panel and the ASD-associated profile merely have at least one shared cir-ncRNA? As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Claims 3 and 4 are rejected for the recitation of “ASD-associated cir-ncRNA profile” in claims 3 and 4, as indefinite. Neither the specification nor the claims set forth a limiting definition of the term “ASD-associated.” Would a cir-ncRNA profile obtained from a child known to have ASD be required, or could the profile be generated by a researcher based on cir-ncRNA implicated in pathways likely to be associated with ASD? As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Claims 4, 12, 16, and 20 are rejected for the recitation of “severe ASD” in claims 4, 12, 16, and 20, and the recitation of “mild ASD” in claim 4, as being indefinite. The terms ‘severe’ and ‘mild’ are relative terms which have not been given clear, limiting definitions in either the specification or the claims. The specification provides that severe symptoms may include significant alterations in social and language development, but provides no examples of mild symptomology (par. 43). Furthermore, the instant specification explicitly states that classification of severity can be ‘perplexing’ due to the complexity and heterogeneity of ASD. It is therefore unclear how ‘severe’ and ‘mild’ forms of ASD are determined, whether there are other forms of ASD beyond ‘severe’ or ‘mild,’ and what limitations are intended by the claims. As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Claims 10-12 and 14-16 are rejected for the recitation of miRNA and piRNA because it is unclear what is meant to be quantitated. Are the claims requiring quantitation of RNAs which share the terminology of the claims (i.e. “piR-hsa-27134”) or is quantitation corresponding to the sequences in the specification required (i.e. SEQ ID NO: 106 for piR-hsa-27134, as shown in Table 2 of the specification)? Furthermore, the claimed piRNA are not clearly defined relative to the state of the art. For example, piR-hsa-27134 has a sequence according to the instant specification (SEQ ID NO. 106) which is not the same as the sequence for piR-hsa-27134 as defined by piRNAdb (https://www.pirnadb.org): piR-hsa-27134 SEQ ID NO. 106: GCCTGGATAGCTCAGTTGGTAGAGCATCAGA piRNAdb: GCACCCCTAGACACTGCCATGGCATCGAAGC Indeed, in NCBI, the sequence termed ‘piR-27134’ is a piRNA sequence from Mus musculus which has no significant sequence similarity to SEQ ID NO. 106 (GenBank DQ560022.1). SEQ ID NO. 106 instead matches with 100% identity to a sequence in the NCBI database which is named ‘piR-35463.’ Similar issues arise for the rest of the piRNA. As a result, one of skill in the art would not be able to determine the metes and bounds of the claimed subject matter so as to avoid infringement. Clarification is requested. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 9 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 9 specifies that the panel of claim 1 comprises miRNA, piRNA, and Y RNA. Since claim 1 already recites that the panel comprises these elements, Claim 9 does not further limit the independent claim. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-4, 6-12, 14-16, 18-21, 26, and 27 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exception without significantly more. The claims have been evaluated using the 2019 Revised Patent Subject Matter Eligibility Guidance (see Federal Register Vol. 84, No. 4, Monday, January 7, 2019). Step 1: The claims are directed to the statutory category of a process. Step 2A, prong one: Evaluate Whether the Claim Recites a Judicial Exception The instant claims recite abstract ideas. Claims 1, 6-12, 14-16, 18-21, 26, and 27 recite “determining” a circulating noncoding RNA (cir-ncRNA) profile. Claims 11, 12, 15, 16, 19, and 20 recite “determining” whether cir-ncRNA is present at specified levels. Neither the specification nor the claims set forth a limiting definition for “determining” and the claims do not set forth how these steps are accomplished. The “determining” steps broadly encompass mental processes. For example, one may “determine” a cir-ncRNA profile or “determine” cir-ncRNA levels by looking at data and thinking about the level of cir-ncRNA in a sample. Mental processes, which are concepts performed in the human mind (including observation, evaluation, judgement, and opinions) are considered to be abstract ideas. Claims 2-4 recite “diagnosing or stratifying” ASD in a potentially affected child. Neither the specification nor the claims set forth a limiting definition for “diagnosing or stratifying” and the claims do not set forth how this step is accomplished. The “diagnosing”/”stratifying” step broadly encompasses mental processes. For example, one may “diagnose”/”stratify” a child by looking at data and thinking about the levels of cir-ncRNA in a sample. Mental processes, which are concepts performed in the human mind (including observation, evaluation, judgement, and opinions) are considered to be abstract ideas. Claims 3 and 4 recite a step of “matching” levels from a sample to an ASD-associated cir-ncRNA profile. Neither the specification nor the claims set forth a limiting definition for “matching” the claims do not set forth how this step is accomplished. The “matching” step broadly encompasses mental processes. For example, one may “match” profiles by thinking about the correlation between measured cir-ncRNA levels and ASD-associated levels. Mental processes, which are concepts performed in the human mind (including observation, evaluation, judgement, and opinions) are considered to be abstract ideas. The instant claims are directed to natural phenomenon. The instant claims are directed to the naturally occurring levels of cir-ncRNA present in plasma samples from a child. Claims 12, 16, and 20 are directed to a correlation between the expression level of cir-ncRNA and treatment for severe autism spectrum disorder (ASD). Claims 2-4 are directed to a correlation between the expression level of cir-ncRNA and the presence or stratification (severity) of ASD. This type of correlation is a consequence of natural processes, similar to the naturally occurring correlation found to be a law of nature by the Supreme Court in Mayo. Step 2A, prong two: Evaluate Whether the Judicial Exception Is Integrated Into a Practical Application The claims do NOT recite additional steps or elements that integrate the recited judicial exception(s) into a practical application of the exception(s). For example, the claims do not practically apply the judicial exception by including one or more additional elements that the courts have stated integrate the exception into a practical application: An additional element reflects an improvement in the functioning of a computer, or an improvement to other technology or a technological field; An additional element that applies or used a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition; An additional element implements a judicial exception with, or uses a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim; An additional element effects a transformation or reduction of a particular article to a different state or thing; An additional element applies or uses the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such that the claim as a whole is more than a drafting effort designed to monopolize the exception. In addition to the judicial exceptions, the claims recite a step of “quantitating” the level of multiple cir-ncRNA. Claims 6 and 7 specify that this step is accomplished through deep sequencing. This step is not considered to integrate the judicial exceptions into a practical application because it merely adds insignificant extra-solution activity (data-gathering) to the judicial exceptions. In addition to the judicial exceptions, claims 12, 16, and 20 recite steps of “treating” a child for severe ASD if the levels of various cir-ncRNA are above or below specified limits. Here, the treatment steps are conditional and only occur when the subject is found to have a level of a cir-ncRNA above or below a specified limit. The claims broadly encompass situations where the subject is found to NOT have cir-ncRNA above and/or below the specified limits. In those situations, the treatment would not be administered. Additionally, the treatment steps are not particular, i.e., specifically identified so that they do not encompass all application of the judicial exceptions. The steps are merely instruction to apply the exception in generic ways. As the treatment step need not occur, and the treatments steps are not particular, claims 12, 16, and 20 do not recite any steps or elements that integrate the judicial exception so as to practically apply the judicial exception. The claims recite limitations of the cir-ncRNA (e.g. claims 1, 2, 4), limitations of the quantitation/analysis (e.g. claim 7, 8), limitations of the sample/subject (e.g. claims 21, 26, 27), as well as specific miRNA/piRNA/YRNA panels (e.g. claims 10, 14, 18). These elements fail to meaningfully limit the claims and are the equivalent of adding the words “apply it” to the judicial exceptions. Step 2B: Evaluate Whether the Claim Provides and Inventive Concept In addition to the judicial exceptions, the claims recite steps of “quantitating” and “treating,” and recite wherein clauses which introduce limitations to the analysis, sample, and subject. These steps do not amount to significantly more because they simply append well-understood, routine, and conventional activities previously known in the art, specified at a high level of generality, to the judicial exceptions. These steps are recited a high level of generality. “Quantitating,” “treating,” and applying limitations to the cir-ncRNA/analysis/subject merely instruct a scientist to use any known technique for quantitating levels, treating a subject, selecting subjects, processing samples, and performing analysis. The claims do not require the use of any particular non-conventional reagents or equipment or methodology. When recited at this high level of generality, there is no meaningful limitation that distinguishes this step from well-understood, routine, and conventional activities engaged in by scientists prior to applicant’s invention and at the time the application was filed. Additionally, the teachings in the specification demonstrate the well-understood, routine, and conventional nature of additional elements because it teaches that the additional elements are well-known or commercially available. For example, the specification teaches the following: PNG media_image1.png 372 667 media_image1.png Greyscale PNG media_image2.png 155 689 media_image2.png Greyscale Further, it is noted that the courts have recognized the following laboratory techniques as well-understood, routine, and conventional activity in the life science arts when they are claimed in a merely generic manner (e.g. at a high level of generality) or as insignificant extra-solution activity. Determining the level of a biomarker in blood by any means, Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017); Using polymerase chain reaction to amplify and detect DNA, Genetic Techs. v. Merial LLC, 818 F.3d 1369, 1376, 118 USPQ2d 1541, 1546 (Fed. Cir. 2016); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1377, 115 USPQ2d 1152, 1157 (Fed. Cir. 2015); Detecting DNA or enzymes in a sample, Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017); Immunizing a patient against a disease, Classen Immunotherapies, Inc. v. Biogen IDEC, 659 F.3d 1057, 1063, 100 USPQ2d 1492, 1497 (Fed. Cir. 2011); Analyzing DNA to provide sequence information or detect allelic variants, Genetic Techs., 818 F.3d at 1377; 118 USPQ2d at 1546; Freezing and thawing cells, Rapid Litig. Mgmt. 827 F.3d at 1051, 119 USPQ2d at 1375; Amplifying and sequencing nucleic acid sequences, University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014) For the reasons set forth above the claims are not directed to patent eligible subject matter. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a). Claims 1-4, 6, 7, 9, 21, 26, and 27 are rejected under 35 U.S.C. 103 as unpatentable over Hicks et al (published Nov 9, 2018; Hicks et al. Front Genet. 2018 Nov 9;9:534) in view of Pegtel et al. (published Feb. 23, 2017; Patent Application Publication US 2017/0051359). Regarding claims 1, 2, and 9, Hicks teaches a method of determining a circulating noncoding RNA (cir-ncRNA) profile comprising quantitating the level of multiple cir-ncRNA from a predetermined panel (pg. 3, col. 2, par. 1-3) of cir-ncRNA. Here, the predetermined panel may be considered all of the annotated RNA sequences from RefSeq, miRbase, and piRNAbase, and the quantified levels are the quantified RNA levels of the test set. Hicks teaches that the cir-ncRNA comprise miRNA, piRNA, and noncoding RNA (pg. 3, col. 2, 3rd par.). Hicks teaches that the quantification is done in a sample from a child potentially having autism spectrum disorder (pg. 2, col. 2, last par.). Regarding claim 2, Hicks teaches diagnosing ASD in a potentially affected child (pg. 3, col. 2, par. 2). Regarding claim 1, Hicks does not teach that the sample utilized in the method is a plasma sample. However, Hicks does teach that noncoding transcripts in the blood of children with ASD have demonstrated predictive potential for identifying ASD (pg. 2, col. 2, par. 2). Pegtel teaches quantification of cir-ncRNA in plasma samples (par. 94). It would have been obvious to a person with ordinary skill in the art before the effective filing date of the instant invention to substitute the saliva sample of Hicks with the plasma sample of Pegtel because the samples are used for the same purpose (detecting cir-ncRNA) and therefore may be considered functional equivalents. One would have had reasonable expectation of success because both Pegtel (par. 178) and Hicks (pg. 2, col. 2, par. 2) describe the detection of non-coding RNA in saliva and plasma for the purposes of disease detection. Regarding claims 1 and 9, Hicks does not explicitly teach simultaneously quantitating miRNA, piRNA, and Y-RNA. Hicks teaches the quantification comprises miRNA, piRNA, and non-coding RNA more generally (pg. 3, col. 2, par. 3). Pegtel teaches that non-coding RNA include Y RNA (par. 4, 51) and that the presence of miRNA, piRNA, and Y RNA may be simultaneously quantitated (Fig. 1C). It would have been obvious to a person with ordinary skill in the art before the effective filing date of the instant invention to combine the teachings of Hicks and Pegtel. One would have been motivated to do so because Pegtel explains that Y RNA is non-coding RNA and allows for its use as a biomarker equivalent to other forms of noncoding RNA (par. 51), and noncoding RNA is quantified by Hicks in combination with miRNA and piRNA (pg. 3, col. 2, par. 3). One would have had reasonable expectation of success because Pegtel demonstrates that miRNA, piRNA, and Y RNA may be simultaneously quantitated (Fig. 1C). Regarding claim 3, Hicks teaches comparing quantified levels of panel cir-ncRNA to an ASD-associated cir-ncRNA profile (pg. 3, col. 2, par. 2). Here, the ASD-associated cir-ncRNA profile may be considered as the output of diagnostic modeling of the training data. Regarding claim 4, Hicks teaches the inclusion of participants having a clinical diagnosis based on DSM-5 criteria so as to accommodate phenotypic heterogeneity (pg. 2, col. 2, last par.), indicating that Hicks has included subjects having a range of severity of ASD. Therefore, Hicks is considered to meet the limitation that the profile be associated with severe ASD or mild ASD. Regarding claim 6, Hicks teaches quantitating by deep sequencing (pg. 3, col. 2, 1st par.). Regarding claim 7, Hicks does not explicitly teach expressing the level of cir-ncRNA in reads per million (RPM). Pegtel teaches expressing levels of cir-ncRNA in terms of RPM (par. 167). It would have been obvious to a person with ordinary skill in the art before the effective filing date of the instant invention to combine the teachings of Hicks and Pegtel in order to normalize read data (par. 167). One would have had reasonable expectation of success because Hicks uses read data (pg. 3, col. 2, par. 1) and Pegtel explains that RPM is the most common type of normalization for read data (par. 167). Regarding claims 21, 26, and 27, Hicks teaches quantitation in children from 19-83 months of age (pg. 2, col. 2: “Study Population”). This range (~1.6 – 6.9 years of age) overlaps the claimed ranges with sufficient specificity that the limitations are considered to have been met. Claim 8 is rejected under 35 U.S.C. 103 as unpatentable over Hicks et al (published Nov 9, 2018; Hicks et al. Front Genet. 2018 Nov 9;9:534) in view of Pegtel et al. (published Feb. 23, 2017; Patent Application Publication US 2017/0051359), as applied to claim 1 above, and further in view of Hafner et al. (published Jan. 2008; Hafner et al. Methods. 2008 Jan;44(1):3-12). Hicks and Pegtel teach the limitations of claim 1, as discussed above. Regarding claim 8, Hicks does not explicitly teach fractionating circ-ncRNA by size and selecting for analysis a size fraction corresponding to the biotype(s) of the circ-ncRNA in the panel. Hicks does teach sequencing of RNA using an Illumina TruSeq Small RNA Prep protocol (pg. 3, col. 2, par. 1) Hafner teaches fractionating circ-ncRNA by size and selecting for analysis a size fraction corresponding to specific biotypes (pg. 5, col. 1, 1st par.). It would have been obvious to a person with ordinary skill in the art before the effective filing date of the instant invention to combine the teachings of Hicks and Pegtel with the teachings of Hafner in order to enrich for RNA varieties of a desired size range (pg. 5, col. 1, 1st par.). One would have had reasonable expectation of success because Hicks uses a sequencing method which implicitly suggests fractionating by size (“Small RNA Prep”), and because Hafner describes how it may be accomplished (pg. 6, col. 1, section 2.2.2). Claims 10, 14, and 18 are rejected under 35 U.S.C. 103 as unpatentable over Hicks et al (published Nov 9, 2018; Hicks et al. Front Genet. 2018 Nov 9;9:534) in view of Pegtel et al. (published Feb. 23, 2017; Patent Application Publication US 2017/0051359), as applied to claims 1 and 9 above, and further in view of the publicly available sequences included in the document ‘NCBI Entries’ (published between April 2007 – September 2020; available as GenBank sequences from NCBI). Hicks and Pegtel teach the limitations of claims 1 and 9, as discussed above. Regarding claim 10, Hicks does not explicitly teach that the panel of miRNA comprises hsa-miR-302a-5p, hsa-miR-302c-3p, hsa-miR-302a-3p, hsa-miR-302d-3p, hsa-miR-302b-3p, hsa-miR-302c-5p, hsa-miR-135b-5p, hsa-miR-373-3p, hsa-miR-372-3p, hsa-miR-187-3p, hsa-miR-4745-5p, hsa-miR-184, hsa-miR-219a-5p, hsa-miR-6516-5p, hsa-miR-5189-5p, hsa-miR-378g, hsa-let-7f-2-3p, and hsa-miR-6509-5p. Regarding claim 14, Hicks does not explicitly teach that the panel of piRNA comprises piR-hsa-22380, piR-hsa-28131, piR-hsa-27134, piR-hsa-28877, piR-hsa-32221, piR-hsa-32184, and piR-hsa-27493. Regarding claim 18, Hicks does not explicitly teach that the panel of Y-RNA comprises RNY4P29. However, the combination of Hicks and Pegtel does teach small RNA sequencing with quantification of RNA reads based on RefSeq and other publicly available databases’ annotations, including those for miRNA, piRNA, and non-coding RNA such as Y RNA (as discussed in the rejections of claims 1 and 9 above). Each of the claimed miRNA and piRNA were publicly available through RefSeq before the effective filing date of the instant invention. The document ‘NCBI Entries’ contains representative alignments of the specified cir-ncRNA to sequences in public databases (pg. 1-7) with the associated database ID’s and publicly available dates shown on pages 8-16. A table summarizing this information is provided below. Claimed cir-ncRNA SEQ ID No. Match ID (GenBank) Publicly Available Date hsa-miR-302a-5p 86 LM379203.1 3-Mar-15 hsa-miR-302c-3p 87 LM379227.1 3-Mar-15 hsa-miR-302a-3p 88 LM379204.1 3-Mar-15 hsa-miR-302d-3p 89 LM379228.1 3-Mar-15 hsa-miR-302b-3p 90 LM379226.1 3-Mar-15 hsa-miR-302c-5p 91 LM608694.1 3-Mar-15 hsa-miR-135b-5p 92 LM379263.1 3-Mar-15 hsa-miR-373-3p 93 LM379232.1 3-Mar-15 hsa-miR-372-3p 94 CS548430.1 18-May-07 hsa-miR-187-3p 95 LM378902.1 3-Mar-15 hsa-miR-4745-5p 96 FR773039.1 13-Jan-11 hsa-miR-184 97 LM379072.1 3-Mar-15 hsa-miR-219a-5p 98 LM378916.1 3-Mar-15 hsa-miR-6516-5p 99 NR_106997.1 3-Sep-20 hsa-miR-5189-5p 100 LM382909.1 3-Mar-15 hsa-miR-378g 101 LM382381.1 3-Mar-15 hsa-let-7f-2-3p 102 LM380167.1 3-Mar-15 hsa-miR-6509-5p 103 JC506822.1 10-Sep-14 piR-hsa-22380 104 DQ592146.1 2-Dec-08 piR-hsa-28131 105 DQ597916.1 2-Dec-08 piR-hsa-27134 106 DQ597397.1 2-Dec-08 piR-hsa-28877 107 DQ598677.1 2-Dec-08 piR-hsa-32221 108 DQ590835.1 2-Dec-08 piR-hsa-32184 109 DQ590835.1 2-Dec-08 piR-hsa-27493 110 DQ597218.1 2-Dec-08 RNY4P29 111 NG_032603.2 9-Nov-18 It would have been obvious to a person with ordinary skill in the art before the effective filing date to include or substitute the miRNA, piRNA, and Y RNA from NCBI into the method of Hicks because the miRNA, piRNA, and Y RNA are functional equivalents (i.e. they are all publicly available miRNA, piRNA, and Y RNA which can be quantified for the purposes of diagnostic marker selection). One would have had reasonable expectation of success because Hicks, using routine methodology, leverages publicly available sequence and annotation data from NCBI (‘RefSeq’; pg. 3, col. 2, 1st par.). Claims 11, 12, 15, 16, 19, and 20 are rejected under 35 U.S.C. 103 as unpatentable over Hicks et al (published Nov 9, 2018; Hicks et al. 2018 Nov 9;9:534) in view of Pegtel et al. (published Feb. 23, 2017; Patent Application Publication US 2017/0051359), as applied to claims 1 and 9 above, in view of ‘NCBI Entries’ (published between April 2007 – September 2020; available as GenBank sequences from NCBI), as applied to claims 10, 14, and 18 above, and further in view of Gerard et al. (published Jan 16, 2020; International Publication No. WO 2020/011998). Hicks and Pegtel teach the limitations of claims 1 and 9, as discussed above. Hicks, Pegtel, and the NCBI Entries teach the limitations of claims 10, 14, and 18, as discussed above. Regarding claims 11, 15, and 19, Pegtel teaches the expression of read data in reads per million (as discussed in the rejection of claim 7). Regarding claim 11, Hicks, Pegtel, and NCBI do not explicitly teach determining whether: a) hsa-miR-302a-5p, hsa-miR-302c-3p, hsa-miR-302a-3p, hsa-miR-302d-3p, hsa-miR-302b-3p, hsa-miR-302c-5p, hsa-miR-135b-5p, hsa-miR-373-3p, hsa-miR-372-3p, and hsa-miR-187-3p are present at >300 RPM; and b) hsa-miR-4745-5p, hsa-miR-184, hsa-miR-219a-5p, hsa-miR-6516-5p, hsa-miR-5189-5p, hsa-miR-378g, hsa-let-7f-2-3p, and hsa-miR-6509-5p are present at <10 RPM. Regarding claim 15, Hicks, Pegtel, and NCBI do not explicitly teach determining whether piR-hsa-22380, piR-hsa-28131, piR-hsa-27134, piR-hsa-28877, piR-hsa-32221, piR-hsa-32184, and piR-hsa-27493 are present at >200 RPM. Regarding claim 19, Hicks, Pegtel, and NCBI do not explicitly teach determining whether RNY4P29 is present at >100 RPM. However, the method of the combined references involves sequencing, read mapping, and quantitation of cir-ncRNA including the miRNA and piRNA of the instant invention. The language of the instant claims (i.e. “determining whether [cir-ncRNA] are present” at various levels (>300 RPM, <10 RPM, >200 RPM, >100 RPM) broadly encompasses simply quantifying reads against the cir-ncRNA sequences, as set forth in Hicks. Therefore, the combination of Hicks, Pegtel, and NCBI is considered to have met the limitations regarding RPM cutoffs. Regarding claims 12, 16, and 20, Hicks teaches treatment of ASD (“intervention services”) following diagnosis (pg. 2, col. 1, par. 1). Barring evidence to the contrary, and because it is unclear from both the claims and the specification how treatment for severe ASD is meant to be distinguished from treatment for general ASD, the teaching of treatment in Hicks is considered to include both forms of treatment for both severe and mild ASD. Regarding claim 12, Hicks, Pegtel, and NCBI do not explicitly teach treating the child for severe ASD if: a) hsa-miR-302a-5p, hsa-miR-302c-3p, hsa-miR-302a-3p, hsa-miR-302d-3p, hsa-miR-302b-3p, hsa-miR-302c-5p, hsa-miR-135b-5p, hsa-miR-373-3p, hsa-miR-372-3p, and hsa-miR-187-3p are present at >300 RPM; and b) hsa-miR-4745-5p, hsa-miR-184, hsa-miR-219a-5p, hsa-miR-6516-5p, hsa-miR-5189-5p, hsa-miR-378g, hsa-let-7f-2-3p, and hsa-miR-6509-5p are present at <10 RPM. Regarding claim 16, Hicks, Pegtel, and NCBI do not explicitly teach treating the child for severe ASD if piR-hsa-22380, piR-hsa-28131, piR-hsa-27134, piR-hsa-28877, piR-hsa-32221, piR-hsa-32184, and piR-hsa-27493 are present at >200 RPM. Regarding claim 20, Hicks, Pegtel, and NCBI do not explicitly teach treating the child for severe ASD if RNY4P29 is present at >100 RPM. Gerard teaches varying a threshold of uniquely mapped sequencing reads per sequence group, in order to identify subpopulations of cells (pg. 8, ln. 30 – pg. 9, ln. 2). It would have been obvious to a person with ordinary skill in the art before the effective filing date of the instant invention to optimize the read thresholds of the miRNA, piRNA, and Y RNA. One would have been motivated to do so because Gerard demonstrates that read threshold is a results effective variable for diagnosis. One would have had reasonable expectation of success because the use in Gerard of varying read thresholds to identify cell subpopulations is a principle which applies to diagnostics more generally. Gerard also discusses the use of the reference’s sequencing method for diagnosis and prognosis of disease states in a subject (pg. 25, ln. 1-5), including ASD (pg. 31, ln. 9). Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Christine M Jones whose telephone number is (571)272-2585. The examiner can normally be reached Monday - Friday, 8AM - 4PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.M.J./Examiner, Art Unit 1682 /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Oct 27, 2023
Application Filed
Jul 28, 2026
Non-Final Rejection mailed — §101, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
2y 11m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month