Prosecution Insights
Last updated: April 19, 2026
Application No. 18/289,921

METHODS AND COMPOSITIONS FOR TREATING EPILEPSY

Final Rejection §103§112
Filed
Nov 08, 2023
Examiner
ZAHORIK, AMANDA MARY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITE D'AIX-MARSEILLE
OA Round
2 (Final)
61%
Grant Probability
Moderate
3-4
OA Rounds
2y 5m
To Grant
99%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allow Rate
36 granted / 59 resolved
+1.0% vs TC avg
Strong +53% interview lift
Without
With
+53.1%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
48 currently pending
Career history
107
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
31.2%
-8.8% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
32.4%
-7.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant' s correspondence received 01/23/2026. Claims 245-250, 255-258, 263-265, and 270-284 are currently pending. Claims 271-280 are withdrawn from prosecution as being drawn to non-elected subject matter. Claims 283 and 284 are newly added. Accordingly, claims 245-250, 255-258, 263-265, and 281-284 are examined herein. The restriction requirement mailed 07/25/2025 is still deemed proper. Applicant elected the invention of Group I, an isolated polynucleotide, and the species of SEQ ID NOs: 4, 19, 34 and 219 without traverse in the reply filed 09/25/2025. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Response to Amendment The declaration under 37 CFR 1.132 filed 01/23/2026 is insufficient to overcome the rejection of claims 245-250, 255-258, 263-265, and 281-282 based upon 35 U.S.C. § 103 as set forth in the last Office action because: As noted in the previous office action (p. 17), based on the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. § 102(a)(2). The rejection might be overcome by a showing under § 102(b)(2)(A), 102(b)(2)(B), or § 102(b)(2)(C). Please see MPEP 2154. In the instant case, it appears that in the remarks received 01/23/2026, Applicant has invoked a 102(b)(1)(A) exception, and notes that Crepel was filed within a one-year period prior to the filing of the instant application (p. 8-9). However, § 102(b)(1)(A) exceptions only apply to prior art which qualifies under § 102(a)(1). Please see MPEP 2153. Additionally, the Applicants have provided a declaration by one of the inventors of the instant application, stating that, “The subject matter in Crepel upon which the Office has relied in its rejection under 35 U.S.C. § 103 is solely the invention of the presently named inventors.” and that, “Valérie Crepel, Christopher Mulle, Celine Boileau, and Severine Deforges did not make an inventive contribution to the subject matter in Crepel upon which the Office has relied in its 35 U.S.C. §103 rejection.”. However, per MPEP 717.01(a)(1), “Where the authorship of the prior art disclosure includes the inventor or a joint inventor named in the application, an “unequivocal” statement from the inventor or a joint inventor that he/she (or some specific combination of named joint inventors) invented the subject matter of the disclosure, accompanied by a reasonable explanation of the presence of additional authors, may be acceptable in the absence of evidence to the contrary. A mere statement from the inventor or a joint inventor, without any accompanying reasonable explanation, may not be sufficient where there is evidence to the contrary, such as a contrary statement from another named author that was filed in another application on behalf of another party.” (emphasis added). In this case, because Crepel et al. are named inventors in the other application, there exists sufficient evidence to the contrary, and a mere statement is not sufficient. In addition to the statement that the disclosure was made by the inventor or a joint inventor or the subject matter was obtained directly or indirectly from the inventor or a joint inventor (MPEP 717.01(a)(1)), a reasonable explanation of the presence of the additional named inventors in Crepel et al. is also necessary. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 245-250, 255-258, 263-265, 270, and 281-284 are rejected under 35 U.S.C. 103 as being obvious over PGPUB US 2024/0018524 A1 to Crepel (hereinafter ‘Crepel’; priority filing date 07/10/2020) in view of Boffil-De Ros (Guidelines for the optimal design of miRNA-based shRNAs. Methods 103:157-66 (2016)). The applied reference has a common applicant/joint inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02. Regarding claim 245: Regarding SEQ ID NOs: 19 and 141, Crepel teaches an isolated polynucleotide that specifically binds (hybridizes with) Grik2 mRNA (claim 141). The polynucleotide (SEQ ID NO: 812) comprises guide strand sequences SEQ ID NO: 77 and 80: PNG media_image1.png 176 870 media_image1.png Greyscale Crepel notes that SEQ ID NO: 812 reduced GluK2 (a.k.a. Grik2) expression by 714% vs. control: PNG media_image2.png 109 425 media_image2.png Greyscale PNG media_image3.png 62 421 media_image3.png Greyscale As shown in the below alignment, SEQ ID NO: 19 has 86.4% identity SEQ ID NO: 77, while SEQ ID NO: 141 has 87.6% identity to SEQ ID NO: 80: RESULT 1 US-18-014-906-77 Query Match 86.4%; Score 19; DB 1; Length 21; Best Local Similarity 78.9%; Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 2 TCTCGATATGGAGAACCCA 20 :|:|||:|:|||||||||| Db 2 UCUCGAUAUGGAGAACCCA 20 RESULT 1 US-18-014-906-80 Query Match 87.6%; Score 18.4; DB 1; Length 21; Best Local Similarity 80.0%; Matches 16; Conservative 3; Mismatches 1; Indels 0; Gaps 0; Qy 2 AGAGCATTGCAGATGGACCG 21 ||||||::|||||:|||| | Db 2 AGAGCAUUGCAGAUGGACUG 21 It is also relevant to note that SEQ ID NO: 812 comprises SEQ ID NOs: 77 and 80 at positions 959-979 and 1266-1286, respectively (underlined and in bold; irrelevant portions of the alignment have been omitted for brevity; see search results in SCV for the full alignment): RESULT 2 US-18-014-906-812 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 812, US/18014906 Publication No. US20240018524A1 GENERAL INFORMATION APPLICANT: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE APPLICANT: MEDICALE) APPLICANT: UNIVERSITE D'AIX MARSEILLE APPLICANT: UNIVERSITE DE BORDEAUX APPLICANT: REGENXBIO INC. APPLICANT: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE APPLICANT: CORLIEVE THERAPEUTICS TITLE OF INVENTION: METHODS AND COMPOSITIONS FOR TREATING EPILEPSY FILE REFERENCE: 51460-003WO4 CURRENT APPLICATION NUMBER: US/18/014,906 CURRENT FILING DATE: 2023-01-06 PRIOR APPLICATION NUMBER: US 63/185,699 PRIOR FILING DATE: 2021-05-07 PRIOR APPLICATION NUMBER: US 63/137,669 PRIOR FILING DATE: 2021-01-14 PRIOR APPLICATION NUMBER: US 63/050,742 PRIOR FILING DATE: 2020-07-10 NUMBER OF SEQ ID NOS: 824 SEQ ID NO 812 LENGTH: 3432 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Construct Query Match 99.5%; Score 3416; Length 3432; Best Local Similarity 99.7%; Matches 3422; Conservative 0; Mismatches 10; Indels 0; Gaps 0; Qy 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60… |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60… Qy 901 CTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Db 901 CTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACGT 960 Qy 961 CTCGATATGGAGAACCCAGGCCGTGAAGCCACAGATGGGCCTGGGTTTTATATCGAGCAG 1020… |||||||||||||||||| || |||||||||||||||||| |||||||||||||||| | Db 961 CTCGATATGGAGAACCCATGCTGTGAAGCCACAGATGGGCATGGGTTTTATATCGAGACG 1020… Qy 1261 TTCTGTAGAGCATTGCAGATGGACCGGGTTGCGAGGTATGAGTAAACGGTCCATACGCAA 1320… ||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||| Db 1261 TTCTGCAGAGCATTGCAGATGGACTGGGTTGCGAGGTATGAGTAAACAGTCCATACGCAA 1320… Qy 3421 GCGAGCGCGCAG 3432 |||||||||||| Db 3421 GCGAGCGCGCAG 3432 Crepel does not teach the polynucleotide comprising the full length of SEQ ID NOs: 19 and/or 141 with 100% identity. There are two differences between the instant guide sequences, SEQ ID NOs: 19 and 141, and Crepel’s guide sequences, SEQ ID NO: 77 and 80, respectively. One, the 5’ nucleotide of SEQ ID NOs: 19 and 141 have been substituted with a ‘T’, or a ‘U’ after transcription into RNA, compared to SEQ ID NOs: 77 and 80. Two, the penultimate nucleotide (at position 21 in SEQ ID NO: 19 and 20 in SEQ ID NO: 141) has also been changed to a mismatch (shown 5’ to 3’): SEQ ID NO: 19: TTCTCGATATGGAGAACCCAGG -|||||||||||||||||||-| SEQ ID NO: 77: GUCUCGAUAUGGAGAACCCATG SEQ ID NO: 141: TAGAGCATTGCAGATGGACCG -||||||||||||||||||-| SEQ ID NO: 80: CAGAGCAUUGCAGAUGGACUG Boffil-De Ros teaches guidelines for the optimization of miRNA-based shRNAs (title). Among those optimizations are the placement of, “…U at the first position of the guide regardless of target sequence, which increases its association with Ago2, thereby enhancing repression efficiency.” (p. 8 2nd para). Boffil-De Ros further teaches that, “mismatches at position 18, 19, 20, 21 promote dislocation and thereby turnover rate of Ago2, enhancing RISC performance towards highly abundant targets.” (p. 8 1st para). It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified Crepel’s known effective multi-miRNA expression cassette comprising guide SEQ ID NOs: 77 and 80 by replacing the 5’ nucleotide with a ‘U’ and introducing a mismatch at any one of positions 18, 19, 20 or 21 of the guide sequence, according to the shRNA design guidelines taught by Boffil-De Ros. The ordinary artisan would have been motivated to do so by Boffil-De Ros’s teachings that both of these modifications would have enhanced the performance of the shRNA constructs. Thus in regard to the limitations of the claims, where the prior art teaches guide sequences for specifically binding Grik2 mRNA, and the prior art teaches design guidelines appropriate for optimization of guide sequences, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp for optimization of the guide sequences for enhanced performance. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization. Regarding claims 246-247, Crepel teaches SEQ ID NO: 812, which comprises passenger strands with at least 85% identity to SEQ ID NOs: 34 and 147 (see results in SCV). It is also relevant to note that the differences between the instant passenger strands and those taught by the prior art is a consequence of the changes to the guide sequences to maintain complementarity between the passenger and guide. Therefore, insofar as Crepel in view of Bofill-De Ros render obvious the guide sequences, they also render obvious the passenger sequences. Regarding claims 247-250, 255-258, 263-265 and 270, as discussed in the rejection of the claims under 35 U.S.C. 112(a) in the office action of 10/23/2025, instant SEQ ID NO: 256 is disclosed by the instant specification to be the full multi-miRNA expression cassette comprising the various elements and sequences recited in the instant claims. Crepel teaches SEQ ID NO: 812, which has 99.5% overall identity to SEQ ID NO: 256. A thorough search of the sequences was conducted, and revealed that all of the instantly recited sequences except for the guide and passenger sequences and the miRNA cassettes comprising them, SEQ ID NOs: 4 and 135, have 100% identity to their corresponding sequences in SEQ ID NO: 812 (see search results in SCV; detailed alignments omitted for brevity). Therefore, the two expression vectors comprise SEQ ID NO: 256 with 99.5% identity, comprise the same regulatory elements, and differ only by the guide and passenger sequences in their miRNA cassettes , which Crepel in view of Boliff-De Ros render obvious, as discussed above. Regarding claims 281 and 282, Crepel teaches a pharmaceutical composition and kit comprising the polynucleotide: PNG media_image4.png 115 421 media_image4.png Greyscale Regarding claim 283, Crepel’s SEQ ID NO: 812 comprises loop regions with 100% identity to SEQ ID NOs: 219 (positions 981-999, immediately adjacent to the guide sequence as discussed above) and 222 (positions 1287-1306, likewise adjacent to the guide sequence). Regarding claim 284, Crepel’s SEQ ID NO: 812 also teaches a sequence having (comprising) SEQ ID NOs: 208 (positions 1-130), 212 (positions 3304-3432), 198 (positions 310-477), 215 (positions 1460-1591), and 250 (positions 1600-1269). Conclusion No claims are allowed at this time. Applicant's amendment adding claims 283-284 necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.M.Z./ Examiner, Art Unit 1636 /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Nov 08, 2023
Application Filed
Jul 01, 2025
Response after Non-Final Action
Oct 20, 2025
Non-Final Rejection — §103, §112
Jan 23, 2026
Response Filed
Jan 23, 2026
Response after Non-Final Action
Feb 18, 2026
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12545941
MGAT1 DEFICIENT CELLS AND USES THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12533423
NEUROPROTECTIVE GENE THERAPY TARGETING THE AKT PATHWAY
2y 5m to grant Granted Jan 27, 2026
Patent 12522835
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12516332
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 06, 2026
Patent 12509677
PROBIOTIC STRAINS HAVING INCREASED STORAGE STABILITY
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
61%
Grant Probability
99%
With Interview (+53.1%)
2y 5m
Median Time to Grant
Moderate
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month