DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The preliminary amendment filed January 22, 2024 is acknowledged. Claims 1, 3-14, 16-19, 21 and 23 are pending and under examination.
Drawings
The drawings are objected to because:
The figures are referred to as “Figure” in the drawings. MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG.".
Additionally, the lines, shadings, numbers and letters of FIGs. 1A and 1B are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in FIGs 1A and 1B is light grey or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics; and the letters over shading especially in FIG 1B are not sufficiently dark for reproduction.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The use of the terms JetOPTIMUS, and OMNI, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 13 is objected to because of the following informalities:
Claim 13 recites “The method of any one of claims 1, wherein…”. “[A]ny one of” should be deleted and “claims” should be singularized. Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 3-14, 16-19, 21 and 23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 4-5, 14 and 16-17 each recite “a guide sequence portion having 17-50 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-18936”. However, each of the SEQ ID NOs only have 20, 21 or 22 nucleotides. It is confusing how a guide sequence portion can have 23-50 nucleotides from a sequence that is only 20, 21 or 22 nucleotides in length.
Claims 3, 6-13, 18-19, 21 and 23 are rejected for depending from claims 1 or 14 and not remedying the indefiniteness.
Claim 5 recites “the method of claim 3, wherein the guide sequence portion of the second RNA molecule…” Neither claim 1 or claim 3 recites “a second RNA molecule”. Thus, “the second RNA molecule” in claim 5 lacks clear antecedent basis, rendering the claim indefinite.
Claim 7 recites “the method of claim 5, wherein the sequence of nucleotides excised from the HBV sequence comprises…” Neither claim 1, 3 or 5 recites “a sequence excised from the HBV genome”. Thus, “the sequence of nucleotides” in claim 7 lacks clear antecedent basis. Although claim 5 requires a second guide RNA molecule, there is no requirement for sequence excision.
Claim 11 recites “the method of claim 9, wherein the human subject suffers from chronic…” Neither claim 1 or claim 9 recites “a human subject”. Thus, “the human subject” in claim 11 lacks clear antecedent basis, rendering the claim indefinite.
Claims 16, 18, 19 and 21 recite “the composition of claim 13”. However, claim 13 is directed to a method. It is not clear if claims 16, 18 and 19 only require the products that are recited in the methods of claim 13 or also require any active steps encompassed by claim 13.
Claim 17 recites “the composition of claim 14…, wherein the nucleotide sequence of the guide sequence portion of the second RNA molecule…” Claim 14 does not recite “a second RNA molecule”. Thus, “the second RNA molecule” in claim 17 lacks clear antecedent basis, rendering the claim indefinite.
Claim 23 recites “A medicament comprising the composition of claim 14… wherein the medicament is administered by delivering…” Claim 23 is a directed to a medicament comprising a composition and is therefore a product claim. However, “is administered” is an active step for use of the medicament. A single claim which claims both a product and the method steps of using the product is indefinite. See MPEP 2173.05(p).II. In this case, “is administered by delivering to a cell…” is not merely a capability of the medicament, but instead is directed to actions of an individual using the medicament.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 3-10, 12-14, 16-19, 21 and 23 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhen (Zhen et al., Gene Therapy (2015), 22: 404-412).
Claims 5, 7, 11, 16-19, 21 and 23 are indefinite for the reasons described above. For the purpose of compact prosecution and applying prior art claim 5 is interpreted as depending from claim 4; claim 7 is interpreted as depending from claim 6; claim 11 is interpreted as depending from claim 10; claims 16, 18, 19 and 21 are interpreted as depending from claim 14; claim 17 is interpreted as depending from claim 16; and claim 23 is interpreted as a pharmaceutical composition (i.e., a medicament) comprising the composition of claim 14.
Regarding claims 1, 4-5, 14 and 16-17, Zhen teaches delivering to HepG2.2.15 cells a plasmid expressing CRISPR/Cas9 (i.e., at least one CRISPR nuclease) and a plasmid expressing two gRNAs called S1 and X3 (i.e., a first RNA molecule comprising a guide sequence and a second RNA molecule comprising a guide sequence) (page 410, ¶4-6; Figure 5). Zhen teaches Cas9/gRNA complexes create double strand breaks (DSBs) (page 405, ¶3; page 406, ¶3). Zhen teaches the targeting sequence of gRNAs S1 and X3 (Table 1). Zhen’s S1 gRNA targeting sequence is 100% identical to SEQ ID NO 1676 as shown below. Zhen’s X3 gRNA targeting sequence is 100% identical to SEQ ID NO 4295 as shown below. Therefore, Zhen’s method comprises introducing a first and second RNA molecules comprising different guide sequence portions having 20 nucleotides in SEQ ID NOs 1676 and 4295.
SEQ ID 1676: caacttgtcctggttatcgc SEQ ID 4295: ggtctccatgcgacgtgcag
Zhen S1: CAACTTGTCCTGGTTATCGC Zhen X3: GGTCTCCATGCGACGTGCAG
Regarding claim 3, Zhen teaches S1 and X3 target the S-ORF and X-ORF, respectively (i.e., the DSB is affected in a sequence of an HBV gene) (page 404, ¶2; Fig 2).
Regarding claims 6-7, Zhen teaches a sequence of the X-ORF and S-ORF is deleted (i.e., excised) from the HBV genome (Fig 8).
Regarding claim 8, as indicated above for claims 1, 4 and 6-7, Zhen teaches the guide sequence of the S1 and X3 gRNAs that are within the S-ORF and X-ORF (i.e., zero base pairs from an HBV gene, up to 500 base pairs from an HBV gene) (Table 1) that result in deletions in both the S-ORF and the X-ORF (i.e., an HBV gene sequence that is to be excised by the first and second RNA molecules) (Fig 8).
Regarding claim 9, as indicated above for claim 1, Zhen teaches delivering to HepG2.2.15 cells (i.e., a hepatocyte) (page 410, ¶4-6).
Regarding claim 10, Zhen teaches the HepG2 and GepG2.2.15 cells are derived from humans (page 410, ¶5). Therefore, Zhen delivers the Cas9 and gRNA expression plasmids to a cell from a human subject.
Regarding claim 12, Zhen teaches the S1 and X2 gRNAs target the S-ORF and X-ORF on cccDNA (page 405, ¶6).
Regarding claim 13, Zhen teaches the HBV genome also integrates into the host cell genome, indicating that the S1 and X3 guide RNAs also target an HBV sequence in a genomic DNA molecule (Fig 3b).
Regarding claims 18, 19, 21 and 23, Zhen teaches delivering the CRISRP/Cas9 expression plasmids with the S1 and X3 guide RNAs to HBV-Tg mice (i.e., delivering a medicament to a subject having a hepatitis B) (page 411, ¶2-6). Zhen teaches the Cas9/S1/X3 composition reduced HBV antigen titer (i.e., treating hepatitis B) (Fig 5).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Zhen (Zhen et al., Gene Therapy (2015), 22: 404-412).
The teachings of Zhen are recited above as for claims 1, 3-10, 12-14, 16-19, 21 and 23 and are incorporated here. Briefly, Zhen teaches delivering Cas9 and two guide RNAs targeted to the HBV genome in HepG2.2.15 cells and mice for disabling HBV genes and treatment of hepatitis B.
Although the HepG2.2.15 cells are derived from a human and infected with HBV, the cells are not specifically from a human that suffers from chronic or acute hepatitis B.
However, Zhen also teaches HBV is a major pathogen of liver disease in humans and leads to hepatocellular carcinoma (HCC) (page 404, ¶1).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the Cas9 and S1/X3 guide RNA editing system to edit the HBV genome in cells from an individual with hepatitis B. It would have amounted to a simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that Zhen’s Cas9 S1/X3 guide RNAs could yield DSBs in the HBV genome of a cell isolated from a hepatitis B patient because the system is effective at 1) generating DSB in a human model system of hepatitis, the HepG2.2.15 cells, and 2) treating mice infected with HBV. The skilled artisan would have been motivated to have done so for the purpose of treating hepatitis B in a human subject since Zhen teaches HBV infection can cause hepatitis B.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights