Prosecution Insights
Last updated: September 17, 2026
Application No. 18/293,326

COMPOSITIONS AND METHODS FOR MODULATING EXPRESSION OF METHYL-CPG BINDING PROTEIN 2 (MECP2)

Non-Final OA §101§102§103§112§DP
Filed
Jan 29, 2024
Priority
Jul 30, 2021 — provisional 63/228,014 +2 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
Tech Center
Assignee
Tune Therapeutics Inc.
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
1y 2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
118 granted / 201 resolved
-1.3% vs TC avg
Strong +65% interview lift
Without
With
+64.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
72 currently pending
Career history
259
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
32.6%
-7.4% vs TC avg
§102
13.8%
-26.2% vs TC avg
§112
30.4%
-9.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 201 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The amendment filed July 24, 2024 is acknowledged. Claims 3, 5-6, 9, 15, 17-20, 22, 39-40, 43-44, 56-57, 59, 66, 68, 96-98, 101-102 and 106-120 are pending and under examination. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code in paragraph [0445]. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Additionally, the use of the term SuperScriptTM, VILOTM, Lipofectamine®, and Sony®, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Drawings The drawings are objected to because the lines, shadings, numbers and letters of FIG. 2 are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in FIG. 2 is light grey, very small and/or of poor resolution. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 5 recites “The DNA-targeting system of claim 3, wherein the DNA targeting domain comprises a Cas-guide RNA combination comprising (a) a Cas protein… and (b) at least one gRNA; a zinc finger protein (ZFP), a TALE, a meganuclease… or an I-SceI enzyme.” Claim 5 is confusing because it recites a Cas-guide RNA combination but then does not actually appear to require a guide RNA. Element (b) can be a guide RNA or ZFP, TALE, meganuclease, etc., which are not guide RNAs. It is unclear whether a guide RNA is actually a requirement of the claims. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claims 106-108 are rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claims 106-108 are directed to cells comprising DNA targeting systems. The Specification does not limit cells to non-human cells, in vitro cells, or ex vivo cells. As such, the term “cell” could reasonably be interpreted as encompassing cells within a human organism, which is non-statutory subject matter. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 3, 5-6, 9, 17-20, 22, 56-57, 59, 66, 68, 96-98, 101-102, 106-107, 109-112, 117 and 119 are rejected under 35 U.S.C. 102 as being anticipated by Gilbert (Gilbert et al., Cell (2014), 159: 647-661, and supplemental materials). Claim 9 is evidenced by Tanenbaum (Tanenbaum et al., Cell (2014), 159: 635-646) and Chen (Chen et al., Cell (2013), 155: 1479-1491). Claims 18, 56 and 68 are evidenced by GenBank (NC_000023.11, Homo sapiens chromosome X, GRCh38.p14 Primary Assembly, selected region 154097000 to 154099000). Regarding claims 3, 5, 6, 17, 19-20 and 22, Gilbert teaches a genome-scale CRISPR activation (CRISPRa) platform comprising dCas9 (i.e., a DNA-targeting domain that binds to a target site in a regulatory DNA element that is a deactivated Cas protein), an sgRNA targeting upstream of a transcriptional start site (i.e., a regulatory DNA, and VP64 (an effector domain that increases transcription) (Fig 3A-C). Gilbert teaches the platform included 10 sgRNAs targeted to MeCP2 (Supp Table S2, lines 76375-76384). Gilbert teaches one of the sgRNAs, MeCP-4, targets the MeCP2 sequence GCTGCGAGCCCGCCCGTCAT, which is SEQ ID NOs 9 and 39 Regarding claim 9, Gilbert teaches the Cas9 for CRISPRa was originally developed in Tanenbaum (page 650, ¶3). Gilbert is silent as to the origin of the Cas9 protein. Tanenbaum teaches the dCas9-GFP plasmid was originally described in Chen (Extended experimental procedures). Chen teaches the dCas9 is an S. pyogenes dCas9 protein (page 1479, ¶1). Regarding claim 18, Gilbert is silent as to the genome coordinates that the MeCP2-targeting sgRNAs target. Genbank teaches the sequence of the X chromosome from coordinates 154097000 to 154099000. Genbank teaches that Gilbert’s MeCP2-4 sgRNA targets a sequence in the human X chromosome from coordinates 154,097,810 to 154,097,829. Therefore, Gilbert’s sgRNA inherently targeted a site located at the claimed coordinates of the human genome assembly. Regarding claims 56-57 and 59, as indicated above for claims 3, 6, 9 and 18, Gilbert teaches a guide RNA comprising SEQ ID NO 39, which targets a sequence of SEQ ID NO 9, which is on the X chromosome from coordinates 154,097,810 to 154,097,829. Regarding claims 66 and 68, Gilbert teaches additional MeCP2 promoter-targeting sgRNAs in the sgRNA library (i.e., a combination of guide RNAs) including MeCP2-2, with sequence GCAAACAGGCGTCCCAAGCCT (Table S2), which Genbank teaches targets a sequence located at 154,098,094 – 154,098,114 (page 5, underlined). Regarding claims 96-98 and 101-102, Gilbert teaches plasmids (i.e., polynucleotides, vectors) encoding the CRISPRa system and sgRNAs (page S1, ¶1-2). Regarding claims 106-107, Gilbert teaches expressing the CRISPRa system and sgRNAs in K562 cells (page S2, ¶6, 8). Regarding claims 109-110, the Specification defines “pharmaceutical formulation” as “a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered” ([0465]). Gilbert’s plasmid encoding the CRISPRa system and sgRNAs were delivered effectively to cells and did not appear cause any cellular toxicity. As such Gilbert’s CRISPRa system and MeCP2-targeting sgRNAs is “a pharmaceutical composition”. Regarding claims 111-112, 117, and 119, Gilbert teaches the CRISPRa system and MeCP2 -targeting sgRNAs for gene activation (i.e., modulating the expression of) the targeted gene promoter (i.e., the MeCP2 sgRNAs increase expression of MeCP2) (page 651, ¶8-9). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Gilbert (Gilbert et al., Cell (2014), 159: 647-661, and supplemental materials) as applied to claims 3, 5-6, 9, 17-20, 22, 56-57, 59, 66, 68, 96-98, 101-102, 106-107, 109-112, 117 and 119 above, and in view of Xie (US 20170233703 A1). The teachings of Gilbert are recited above as for claims 3, 5-6, 9, 17-20, 22, 56-57, 59, 66, 68, 96-98, 101-102, 106-107, 109-112, 117 and 119 and are incorporated here. Gilbert does not teach a split variant dCas9 comprising a N-terminal Cas9-Intein and a C-terminal Cas9-Intein. Xie teaches delivering Cas9 fusions in vivo has been limited due to size constrains of smaller delivery systems with payload capacity close to an entire Cas9 complex ([0003]). Xie teaches the split Cas9 systems bypasses the packaging limits of AAV vectors ([0004]-[0005]). Xie teaches Cas9 can be reconstituted once expressed in cells via intein-mediated fusion ([0007]). Xie teaches an N-terminal-dCas9-IntN fusion and an IntC-dCas9-C-terminal fused to a Suntag (i.e., for recruiting an anti-GCN4 fused effector) (Fig 12). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used Xie’s split dCas9 system in Gilbert’s CRISPRa screen which comprises the sgRNA targeting the MeCP2 promoter. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that Gilbert’s dCas9-suntag could be split and reconstituted using inteins because Xie demonstrates such a system. One would have been motivated to have done so for delivering the CRISPRa system via AAV vectors. Claims 39-40, 108, 113-116, 118 and 120 are rejected under 35 U.S.C. 103 as being unpatentable over Gilbert (Gilbert et al., Cell (2014), 159: 647-661, and supplemental materials) as applied to claims 3, 5-6, 9, 17-20, 22, 56-57, 59, 66, 68, 96-98, 101-102, 106-107, 109-112, 117 and 119 above, and further in view of Pflueger (Pflueger et al., Essays in Biochemistry (2019), 63: 813-825) and Morita (Morita et al., Nature Biotechnology (2016), 34: 1060-1065, and Supplemental Material). The teachings of Gilbert are recited above as for claims 3, 5-6, 9, 17-20, 22, 56-57, 59, 66, 68, 96-98, 101-102, 106-107, 109-112, 117 and 119 and are incorporated here. Briefly, Gilbert teaches a CRISPRa system comprised of dCas9, anti-GCN4-VP64, and sgRNAs targeted to the region -50 and -400 updates of the transcriptional start site (i.e., the promoter region) of the MeCP2 gene (Fig. 3A, Table S2). Gilbert does not teach using the CRISPRa system to treat diseases. Gilbert does not teach the TET1 domain as the effector domain. Pflueger teaches Rett syndrome is caused by mutations in the MeCP2 gene, which is a methyl-CpG binding protein encoded on the X chromosome (page 819, ¶1). Pflueger teaches proper MeCP2 function is important for normal cellular function, specifically in neurons (page 819, ¶1). Pflueger suggests activation of a normal allele of MeCP2 on an inactivated X-chromosome could compensate for a dysfunctional MeCP2 allele, thereby treating Rett syndrome (page 819, ¶1). Pflueger teaches dCas9 systems that can affect the methylation status of genomic DNA have recently been developed (Abstract). Pflueger teaches a targeted DNA demethylation system comprising dCas9, anti-GCN4 antibodies fused to a TET1 effector, and a sgRNA, to methylate targeted cytosines, which was developed by Morita et al. in 2016 (Figure 3). Morita teaches a targeted demethylation system comprising dCas9, the catalytic domain of antiGCN4-TET1 recruited to dCas9, and a sgRNA (Fig 1). Morita teaches this same system was previously used to recruit the transcriptional activator VP64 and then was optimized for demethylation (page 1061, ¶2-3). Morita used the dCas9/TET1/sgRNA system to demethylate at multiple sites (Fig 2) and verified function in mice brains (Fig 3). Morita teaches the dCas9/TET1/sgRNA system can demethylate sites within at least 200 bp from the sgRNA target (page 1062, ¶5). Regarding claims 39-40, 108, 113-116, 118 and 120, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used Gilbert’s sgRNA targeting the MeCP2 promoter with Morita’s dCas9/TET1/sgRNA system to demethylate the MeCP2 promoter of a normal MeCP2 allele on an inactivated X chromosome in a neuron for the purpose of treating Rett Syndrome, as suggested by Pflueger. It would have amounted to the simple combination of elements by known means, and for using the obvious combination in known methods to yield predictable results. The skilled artisan would have expected that Gilbert’s MeCP2-promoter targeting sgRNA could be used with Morita’s dCas9/TET1/sgRNA system because 1) Morita demonstrates using the targeted demethylation system with several different gene- and sequence-targeting sgRNAs, and 2) Morita’s demethylation system has the same overall architecture as Gilbert’s CRISRPa system, namely a dCas9 that recruits and anti-GCN4-effector fusion. The skilled artisan would have been motivated to use Morita’s system to activate a normal MeCP2 allele because Pflueger suggests it as a therapeutic approach to treating Rett Syndrome. In fact, Pflueger suggests that Rett syndrome would “strongly benefit” from targeted DNA methylation editing in neurons. The skilled artisan would have predicted that Morita’s demethylation system could be delivered to neurons for the purpose of treating Rett Syndrome because Morita demonstrates successful delivery to mouse brains where the system demethylated the targeted genomic sequence and increased the target gene’s expression. Claims 43-44 are rejected under 35 U.S.C. 103 as being unpatentable over Gilbert (Gilbert et al., Cell (2014), 159: 647-661, and supplemental materials), Pflueger (Pflueger et al., Essays in Biochemistry (2019), 63: 813-825) and Morita (Morita et al., Nature Biotechnology (2016), 34: 1060-1065, and Supplemental Material), as applied to claims 3, 5-6, 9, 17-20, 22, 39-40, 56-57, 59, 66, 68, 96-98, 101-102 and 106-120 above, and further in view of Liu (Liu and Jaenisch, Trends in Neuroscience (2019), 42: 861-870). The teachings of Gilbert, Pflueger and Morita are recited above and applied as for claims 3, 5-6, 9, 17-20, 22, 39-40, 56-57, 59, 66, 68, 96-98, 101-102 and 106-120. Gilbert, Pflueger and Morita do not teach a second DNA targeting domain. Liu provides perspectives on editing the epigenome (i.e., DNA methylation) to tackle brain disorders (Abstract). Liu teaches dCas9 and TET1 are used to demethylate targeted loci (Table 1). Liu teaches reactivating a silenced MeCP2 allele on the X chromosome to great RTT syndrome (¶ spanning pages 865-866). Liu teaches that an MeCP2 allele on the inactive chromosome may need to overcome several layers of suppressive epigenetic mechanisms including histone modifications in addition to DNA methylation (page 866, ¶1). Liu states “Thus, it may be necessary to combine multiple epigenetic editing tools targeted at DNA methylation as well as histone modification and others to establish a stable active state of the MECP2 gene in the heterochromatic environment of the inactive X chromosome. Our preliminary results (unpublished) suggest that such a combinational approach may be promising” (page 866, ¶1). Liu teaches dCas9 can be used to recruit other effectors to the targeted locus including histone modifying enzymes (Figure 1). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included a second DNA-targeting domain like dCas9 fused to a different effector and targeted to the MeCP2 locus. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that a second dCas9-effector could be included, and been motivated to have done so, because Liu teaches that multi-dCas9-effector system approach is promising. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 3, 5-6, 9, 15, 17-20, 22, 39-40, 43-44, 56-57, 59, 66, 68, 96-98, 101-102 and 106-120 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 6, 14, 24, 27, 36, 39, 42, 46, 125-126, 131, 133, 147, 151, 162, 169, 172, 175, 183, 187, 192 and 196 of copending Application No. 19152903. Claims 18, 56 and 68 are evidenced by GenBank (NC_000023.11, Homo sapiens chromosome X, GRCh38.p14 Primary Assembly, selected region 154097000 to 154099000). Claim 15 is rejected in view of Xie (US 20170233703 A1). Claim 108 is rejected in view of Pflueger (Pflueger et al., Essays in Biochemistry (2019), 63: 813-825) and Morita (Morita et al., Nature Biotechnology (2016), 34: 1060-1065, and Supplemental Material). Copending claim 131 recites An epigenetic-modifying DNA-targeting system comprising: (a) a first DNA-targeting module comprising: i) a DNA-targeting domain comprising a first deactivated Cas (dCas) protein and at least one gRNA that binds to a target site in a regulatory DNA element of a methyl-CpG- binding protein 2 (MeCP2) locus; and ii) at least one epigenetic effector domain that increases transcription of MeCP2; and b) a second DNA-targeting module comprising the epigenetic-modifying DNA-targeting system of claim 57 (i.e., a combination of DNA binding domains). Copending claim 133 recites wherein the dCas protein of the first or second DNA-targeting module is a Streptococcus pyogenes dCas9 (dSpCas9) protein and the other dCas protein of the first or second DNA-targeting module is a Staphylococcus aureus dCas9 (dSaCas9) protein. Copending claim 147 recites wherein the target site of the first DNA-targeting module comprises the sequence set forth in any one of SEQ ID NOs:1-29, which are 100% identical to SEQ ID NOs 1-29 of the examined application and comprise SEQ ID NOs 31-59. Copending claim 151 recites wherein the at least one epigenetic effector domain of the first DNA-targeting module comprises a catalytic domain of a ten-eleven translocation (TET) family methylcytosine dioxygenase. Copending claim 162 recites a plurality of gRNAs comprising at least a first gRNA and a second gRNA, wherein the first gRNA binds a target site in a regulatory DNA element of a methyl-CpG-binding protein 2 (MeCP2) locus and the second gRNA. Copending claim 169 recites A polynucleotide encoding the epigenetic-modifying DNA-targeting system of claim 131. Copending claim 175 recites a vector comprising the polynucleotide of claim 169. Copending claim 183 recites a cell comprising the epigenetic-modifying DNA-targeting system of claim 131. Copending claim 187 recites A pharmaceutical composition comprising the vector of claim 175. Copending claims 192 recites A method for modulating the expression of methyl-CpG-binding protein 2 (MeCP2) and X-inactive specific transcript (XIST) in a cell, the method comprising introducing the vector of claim 175 into the cell. Copending claim 196 recites A method of treating a subject, the method comprising: administering to the subject the pharmaceutical composition of claim 187, wherein the subject has or is suspected of having Rett syndrome. The copending claims do not recite the genome coordinates of the MeCP2-targeting sgRNA target sites. However, GenBank provides the sequence of the MeCP2 locus and evidences that the copending sgRNAs target the instantly claimed genome coordinates. Therefore, the copending claims anticipate examined claims 3, 5-6, 9, 17-20, 22, 39-40, 43-44, 56-57, 59, 96-98, 101-102, 106-107, 109-120. The copending claims do not recite a split Cas9 architecture (claim 15). The copending claims do not recite a second sgRNA targeting the MeCP2 promoter (claims 66 and 68) or a type of cell (claim 108). Regarding claims 66 and 68, it would have been obvious to have used a second guide RNA with a targeting sequence chosen from the copending SEQ ID NOs 1-29 for targeting MeCP2. It would have amounted to duplication of parts by known means to yield predictable results. The skilled artisan would have predicted a second MeCP2 targeting sgRNA could be included since the copending claims already recite a combination of a sgRNAs. Duplication of parts is prima facie obvious. MPEP 2144.04. Regarding claim 15, the teachings of Xie are recited above in paragraph 30 and are incorporated here. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used Xie’s split dCas9 system for delivery of the copending MeCP2-targeting dCas9/TET1 systems the sgRNA targeting the MeCP2 promoter. It would have amounted to the simple combination of elements by known means. The skilled artisan would have predicted that the copending system could be split and reconstituted using inteins because Xie demonstrates splitting dCas9-fusion proteins. One would have been motivated to have done so for delivery of the copending system via AAV vectors that have smaller payloads. Regarding claim 108, the teachings of Morita and Pfleuger are recited above in paragraphs 35 and 36 and are incorporated here. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically delivered the copending pharmaceutical formulation to neurons for the purpose of treating Rett Syndrome because 1) Morita demonstrates successful delivery to mouse brains where the system demethylated the targeted genomic sequence and increased the target gene’s expression, and 2) Pflueger teaches normal MeCP2 function is especially needed for normal neuronal function. This is a provisional nonstatutory double patenting rejection. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jan 29, 2024
Application Filed
Sep 02, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723277
LINKED TARGET CAPTURE
4y 9m to grant Granted Sep 01, 2026
Patent 12698477
METHODS OF PRECONDITIONING VASCULAR CELLS FOR TRANSDUCTION, METHODS OF TRANSDUCTION AND METHODS OF PRESERVING TRANSDUCED CELLS
4y 8m to grant Granted Aug 04, 2026
Patent 12698504
Methods for Making and Using Genomically Recoded Cells
3y 2m to grant Granted Aug 04, 2026
Patent 12686865
COMPOSITIONS AND METHODS OF NUCLEIC ACID-TARGETING NUCLEIC ACIDS
4y 11m to grant Granted Jul 21, 2026
Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+64.6%)
3y 10m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 201 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month