DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. This application has been transferred to Examiner Haney in Art Unit 1682.
3. Applicant’s election without traverse of Group I in the reply filed on June 1, 2026 is acknowledged.
Claims 1-20 are currently pending.
Claims 8-14, 17, and 20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on June 1, 2026.
Claim Rejections - 35 USC § 112
4. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 3, 4, and 18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 3 and 18 are rejected over the recitation of the phrase “and is preferably a hydrocarbon chain molecule that has a backbone with a length of not less than 5 carbon-carbon bonds” in claim 3. Claims are indefinite when they recite preferences without clearly indicating whether they are limitations.
Claim 4 is rejected over the recitation of the phrase “preferably biotin, phenylboronic acid, mannose, an antigen or an antibody.” Claims are indefinite when they recite preferences without clearly indicating whether they are limitations.
Claim Rejections - 35 USC § 102
5. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 4, and 7 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation).
Regarding claim 1 Suzhou (pages 1-5 of Eng Translation) discloses a primer set for SNP detection. The primer set comprises a forward specific coding primer and a reverse fluorophore labeled primer. The specific coding primer comprises a coding region, a spacer region, a blocking region and a specific primer region. Suzhou teaches that the coding sequence of the coding region binds to a nucleic acid capture probe on a microarray. Suzhou teaches that the blocking region is modified with a spacer to block DNA polymerase synthesis. Suzhou teaches that the specific primer region is a specific primer sequence that can be used to at least identify the site to be detected; the site to be detected can be a SNP and by utilizing the fidelity of DNA polymerase, the primer with completely matched 3 'end can be extended by the DNA polymerase, while the primer with mismatched 3' end cannot be extended by the DNA polymerase or has lower extension efficiency. Suzhou discloses the following primer set for detection of the A/G allele of rs671:
SEQ ID NO: 1 GCTGTACCCGATCGCAAGGTGGTC-TTTTT-(Spacer9)-TACGGGC TGCAG GCATA CACTA.
SEQ ID NO: 2 CAAGCGTGCTAACAAGCGTGATCA-TTTTT- (Spacer9) -TA CGGGC TGCAG GCATA CACTG.
SEQ ID NO: 3 FAM-CGGCAGG TCCTG AACCT CTGGC.
Suzhou further discloses nucleic acid capture probes that are immobilized on a microarray. The probes are complementary to the coding sequence of the primers to allow for capture.
SEQ ID NO: 6 5-GACCACCT TGCGATCGGGTACAGCTTTTTTTTTT-NH2。
SEQ ID NO: 7 5-TGATCACG CTTGTTAGCACGCTTGTTTTTTTTTT-NH2。
Thus Suzhou teaches a primer set for detecting a single base mutation in a nucleic acid sequence, wherein the primer set comprises the following primers: one or more identifying primers (SEQ ID NOs: 1 and 2), wherein the identifying primer comprises in order in the 5' to 3' direction: a) a nucleotide sequence that can specifically bind to a detection tool (the underlined portion of SEQ ID NOs: 1 and 2 are complementary to SEQ ID NOs: 6 and 7 on the microarray); b) a spacer arm molecule that can prevent further PCR amplification (The TTTTT-Spacer9); c) a nucleotide sequence that is complementary to a stretch of contiguous nucleotides in the nucleic acid sequence to be detected (the italic portion of SEQ ID NOs: 1 and 2), wherein the 5' end of the contiguous nucleotides starts from the first nucleotide downstream of a mutation detection site, and d) a single nucleotide selected from any one of A, T, C, and G (the bold portion of SEQ ID NOs: 1 and 2), and an amplification primer (SEQ ID NO: 3), wherein the amplification primer is modified at the 5' end with a group that can bind to a signal-responsive molecule (FAM), and the amplification primer can be used to amplify the amplification product obtained by amplifying the nucleic acid sequence to be detected using the identifying primer.
Regarding Claim 2 Suzhou teaches a method wherein the detection tool is a chip (microarray) that is modified with a gene probe (SEQ ID NOs: 6 and 7).
Regarding Claim 4 Suzhou teaches that the amplification primer (SEQ ID NO: 3) is modified at the 5’ end such that it can bind with FAM.
Regarding Claim 7 Suzhou teaches an amplification primer (SEQ ID NO: 3) that is 22bp long.
Claim Rejections - 35 USC § 103
6. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
7. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation) in view of Takahashi (US 2015/0203905 Pub 7/23/2015).
The teachings of Suzhou are presented above.
Suzhou does not teach a method wherein the spacer arm molecule is a hydrocarbon chain molecule that has a backbone with a length of not less than 5 carbon-carbon bonds.
However Takahashi teaches primers for nucleic acid amplification. The primers contain a primer body region 1, and a tag region 2 which is located on the 5' side of the primer body and which is not made double-stranded by a nucleic acid amplification reaction. Takahashi teaches that optionally a spacer region, which corresponds to a polymerase reaction inhibitory region 3, may be present between the primer body region and the tag region (para 0060). Takahashi teaches that the spacer can be a non-nucleic acid derivative (para 0065). Takahashi teaches that an example of a non-nucleic acid derivative is an aliphatic carbon chain (para 0082). The term "aliphatic chain" refers to a continuous carbon chain represented by Cn, or a derivative thereof. The range of n is not particularly limited, and is preferably 1 to 45, and more preferably 2 to 18 (para 0083).
Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the primer of Suzhou by using a spacer having a hydrocarbon chain molecule that has a backbone with a length of not less than 5 carbon-carbon bonds as suggested by Takahashi. One of skill in the art would have been motivated to use the spacer of Takahashi since the reference teaches that this type of spacer effectively inhibits polymerase activity.
8. Claims 5, 6, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation) in view of Shanghai Biochip Co Ltd (CN107841548 Pub 3/27/2018 Eng Translation).
The teachings of Suzhou are presented above.
Suzhou does not teach a primer set wherein portions c) and d) of the identifying primer are in total 1 to 19 nucleotides shorter than the amplification primer in length (clm 5). Suzhou does not teach a primer set wherein portions c) and d) of the identifying primer are between 11 and 16 nucleotides in total length (clm 6). Suzhou does not teach a primer set wherein the amplification primer is between 15 and 30 nucleotides in length (clm 19).
However Shanghai (page 6 of Eng Translation) teaches a set of primers for detecting a mutation in the MTHFR gene, wherein the set of primers includes a forward primer having a C nucleotide at the mutated position in the MTHFR gene (i.e., an "identifying primer") and a reverse primer (i.e., an amplifying primer):
rs1801131-C-F: GCTGACCAGTGAAGC (SEQ ID NO:5)
rs1801131-R: CCACTCCAGCATCACTCACT (SEQ ID NO:6) IS
As shown above, the forward primer (identifying primer) comprises portions c and d that are 15bp long and the reverse primer (amplification primer) is 20bp long. Thus Shanghai teaches a primer set wherein portions c) and d) of the identifying primer are 5 nucleotides shorter than the amplification primer in length, wherein portions c) and d) of the identifying primer are between 11 and 16 nucleotides in total length, and wherein the amplification primer is between 15 and 30 nucleotides in length.
Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the primer set of Suzhou such that portions c) and d) of the identifying primer are 5 nucleotides shorter than the amplification primer in length, portions c) and d) of the identifying primer are between 11 and 16 nucleotides in total length, and wherein the amplification primer is between 15 and 30 nucleotides in length as suggested by Shanghai. In the instant case to have determined the optimum lengths of the c) and d) portions of the identification primer and the total length of the amplification primer would have been obvious to one of ordinary skill in the art and well within the skill of the art. As discussed in MPEP 2144.05(b), “(w)here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F.2d 454, 105 USPQ 233, 235 (CCPA 1955).
MPEP 2144.05(b):
“Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955)”
“A particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation. In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977).”
9. Claims 15 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation) in view of Lagace (US 2015/0167068 June 18/2015).
The teachings of Suzhou are presented above.
Suzhou does not teach the primer set of claim 1 in a kit (clm 15). Suzhou does not teach a kit further comprising a high-fidelity polymerase (clm 16).
However Lagace teaches kit comprising reagents for PCR, including a DNA polymerase (para 0080). Additionally Lagace teaches high fidelity polymerase (para 0164).
Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have included the primer set of Suzhou in a kit along with a DNA polymerase as suggested by Lagace. One of skill in the art would have been motivated to have included primers and a polymerase in a kit for the expected benefits of convenience and cost-effectiveness. Further one of skill in the art would have been motivated to use a high fidelity polymerase for the benefit of higher accuracy during primer extension.
10. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation) in view of Takahashi (US 2015/0203905 Pub 7/23/2015) as applied to claim 3 above and in further view of
Shanghai Biochip Co Ltd (CN107841548 Pub 3/27/2018 Eng Translation).
The teachings of Suzhou and Takahashi are presented above.
The combined reference do not teach a primer set wherein portions c) and d) of the identifying primer are in total 1 to 19 nucleotides shorter than the amplification primer in length.
However Shanghai (page 6 of Eng Translation) teaches a set of primers for detecting a mutation in the MTHFR gene, wherein the set of primers includes a forward primer having a C nucleotide at the mutated position in the MTHFR gene (i.e., an "identifying primer") and a reverse primer (i.e., an amplifying primer):
rs1801131-C-F: GCTGACCAGTGAAGC (SEQ ID NO:5)
rs1801131-R: CCACTCCAGCATCACTCACT (SEQ ID NO:6) IS
As shown above, the forward primer (identifying primer) comprises portions c and d that are 15bp long and the reverse primer (amplification primer) is 20bp long. Thus Shanghai teaches a primer set wherein portions c) and d) of the identifying primer are 5 nucleotides shorter than the amplification primer in length.
Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the primer set of Suzhou and Takahashi such that portions c) and d) of the identifying primer are 5 nucleotides shorter than the amplification primer in length as suggested by Shanghai. In the instant case to have determined the optimum lengths of the c) and d) portions of the identification primer would have been obvious to one of ordinary skill in the art and well within the skill of the art. As discussed in MPEP 2144.05(b), “(w)here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F.2d 454, 105 USPQ 233, 235 (CCPA 1955).
MPEP 2144.05(b):
“Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955)”
“A particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation. In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977).”
Double Patenting
11. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
12a. Claims 1-2, 4-7, 15-16, and 19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 14-17, 20, 24-26 of copending Application 18/287245 in view of Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation). This is a provisional nonstatutory double patenting rejection.
Regarding Claim 1 both sets of claims are drawn to a primer set for detecting a single base mutation in a nucleic acid sequence, wherein the primer set comprises the following primers: one or more identifying primers, wherein the identifying primer comprises in order in the 5' to 3' direction: c) a nucleotide sequence that is complementary to a stretch of contiguous nucleotides in the nucleic acid sequence to be detected, wherein the 5' end of the contiguous nucleotides starts from the first nucleotide downstream of a mutation detection site, and d) a single nucleotide selected from any one of A, T, C, and G, and an amplification primer, wherein the amplification primer is modified at the 5' end with a group that can bind to a signal-responsive molecule, and the amplification primer can be used to amplify the amplification product obtained by amplifying the nucleic acid sequence to be detected using the identifying primer (see clm 14 of the copending application). The instant claims are different from the copending claims because they recite that the identification primer further comprises a) a nucleotide sequence that can specifically bind to a detection tool; b) a spacer arm molecule that can prevent further PCR amplification (clm 1). Additionally they are different from the copending claims because they state that the detection tool is a chip (clm 2). Further they are different from the copending claim because they state that the group that can bind to a signal-responsive molecule is a chemical molecule (clm 3). However as discussed above, the prior art of Suzhou teaches each of these limitations and it would have been obvious to modify the primer set in view of these teachings. For example it would have been obvious to modify the primer set of the copending application by adding a) a nucleotide sequence that can specifically bind to a detection tool for the benefit of being able to immobilize the identification primer on the chip. Further it would have been obvious to modify the primer set of the copending application by adding b) a spacer arm molecule that can prevent further PCR amplification for the benefit of being able to stop primer extension so that portion (a) remains single stranded for capture. Regarding Claim 5 both sets of claims state that the identifying primer is in total 1 to 19 nucleotides shorter than the amplification primer in length (see clm 14 of the copending application). Regarding Claim 6 both sets of claims state that the identifying primer is between 11 and 16 nucleotides in total length (see clm 15 of the copending application). Regarding Claim 7 both sets of claims state that the amplification primer is between 15 and 25 nucleotides in length (see clm 16 of the copending application). Regarding Claim 15 both sets of claims recite a kit for detecting a single base mutation in a nucleic acid sequence, the kit comprising the primer set (see clm 20 of the copending application). Regarding Claim 16 both sets of claims state that the kit further comprises a DNA polymerase (see clm 24 of the copending application). Regarding Claim 19 both sets of claims state that the amplification primer is between 15 and 25 nucleotides in length (see clm 16 of the copending application).
12b. Claims 3 and 18 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 14-17, 20, 24-26 of copending Application 18/287245 in view of Suzhou Institute of Nano Tech and Nano Bionics of CAS (CN112899152 Pub 6/4/2021 Eng Translation) as applied to claim 1 above and in further view of Takahashi (US 2015/0203905 Pub 7/23/2015). This is a provisional nonstatutory double patenting rejection.
The claims in view of Suzhou are discussed above. The instant claims are different from the copending claims because they recite that the spacer arm molecule is a hydrocarbon chain molecule that has a backbone with a length of not less than 5 carbon-carbon bonds. However Takahashi teaches primers for nucleic acid amplification with spacer regions. Takahashi teaches that the spacer can be a non-nucleic acid derivative (para 0065). Takahashi teaches that an example of a non-nucleic acid derivative is an aliphatic carbon chain (para 0082). The term "aliphatic chain" refers to a continuous carbon chain represented by Cn, or a derivative thereof. The range of n is not particularly limited, and is preferably 1 to 45, and more preferably 2 to 18 (para 0083). Accordingly, it would have been obvious to have modified the primer of the copending application and Suzhou by using a spacer having a hydrocarbon chain molecule that has a backbone with a length of not less than 5 carbon-carbon bonds as suggested by Takahashi. One of skill in the art would have been motivated to use the spacer of Takahashi since the reference teaches that this type of spacer effectively inhibits polymerase activity.
13. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached Monday-Friday, 8:15am-4:45pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA HANEY/Primary Examiner, Art Unit 1682
