DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application claims priority to EP21306077 (filed 8/2/2021). This application is a 371 PCT/EP2022/071712 (filed 8/2/2022). Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Application Status
Amended claims were filed on 2/1/2024, such that claims 12-22 are under examination in this Office action. Claims 1-11 and have been cancelled.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings (Fig 4) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Browser executable code is found on Pg 1 ([0005]), Pg 59 ([0336]), Pg65, ([0372] and [0445]), Pg 81 ([0445]), Pg 82 [0452]).
The disclosure is objected to because of the following informalities: Trademarks, see below. Appropriate correction is required.
The use of the terms lipofectamin(e) (Pg 59), Graph Pad (Pg 65, [0368] and [0369]), IRDye (Pg 62, 74, 79), Tween (Pg 74), LI-COR (Pg 75) which are trade names or marks used in commerce, have been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 16 is objected to because of the following informalities:
Claim 16 further describes the AAV9 as AAV serotype 9. If the acronym is going to be further described, this should occur in the first claim that uses the acronym; in this case that would be claim 15.
Appropriate correction is required.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, the claims will be given their broadest reasonable interpretation, in view of the specification, and as set forth at MPEP§ 2111.
For clarity of the record, it is noted that the specification discloses that the terms “patient” or ”individual” (and more) used to refer preferably to a mammal in need of a therapeutic or prophylactic treatment..including primates…rodents (e.g. mice and rats)… the recipient may be a human [0077].
The specification refers to a “therapeutically effective amount” or dose, as a minimal amout of active ingredient necessary for benefit, where the dose may depend on varied factors [0084].
Claim Rejections - 35 USC § 103
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 12-18, 20-22 are rejected under 35 U.S.C. 103 as being unpatentable over Gautier (Gautier et al.,2021, Nature Comms, 12: 2356) in view of Cai (Cai, W., et al., June 2017, Molec Cancer Therapeutics, 16:1187-1198).
Re: claim 12, Gautier had and used an adeno-associated virus (AAV) vector comprising an inhibitory RNAi molecule, comprising an oligonucleotide sequence targeting Pmp22 mRNA, with which they assessed safety and efficacy of said AAV use (Abstract, Pg 1 final para, Pg2, right col para 1).
Akin to the subject matter of the instant application, Gautier’s work related to Charcot-Marie-Tooth disease (CMT1A) and disclosed PMP22 gene duplication causes PMP22 overexpression and a myelination deficit in peripheral nerve cells (Abstract).
Gautier worked on a diseased animal model systems where the vector was delivered directly into nerve cell in animals and diffused to cover the length of the sciatic nerve into which it was injected (Pg 3 right col, para 2).
Gautier disclosed shRNA oligonucleotide sequence, but did not disclose SEQ ID NO:61.
Cai disclosed an shRNA with a target 100% identical to instant SEQ ID NO: 17 (Pg 1188, left col, 3rd full para) More specifically, Cai disclosed a lentivirus vector to express an RNAi molecule comprising shRNA (shRNA2) directed against PMP22, where the target sequence of hPMP22 was cggtgtcatctatgtgatctt (or instant SEQ ID NO: 17; Pg 1188, left col final para). This renders obvious to one of ordinary skill, the necessary reverse complement, or SEQ ID NO:61 as the antisense portion of the shRNA that Cai developed. Cai articulated that PMP22 mutations cause Charcot-Marie-Tooth disease, the same peripheral nerve disorder studied by Gautier (Pg 1187, right col, para 2), and that myelin proteins in the peripheral nervous system comprise PMP22 protein (Pg 1195, right col, para 1). PMP22 expression also occurs in stomach cells, with putative tumor suppressor function, Cai’s interest (Abstract, Pg 1187 rich col, penult para, Pg 1195, right col, para 1). Of relevance in both disorders is PMP22 expression. Cai used a viral vector expressing shRNA, instant SEQ ID NO; 17, against hPMP22 target (Abstract, Pg 1187 right col, penult para, Pg 1188 left col para 4) to knock down PMP22 mRNA expression in cells (Fig 3A, Pg 1193-1194).
Prior to effective filing date it would have been prima facie obvious to one of ordinary skill in the art to have simply substituted the shRNA sense and antisense strand of Cai in the vector of Gautier, given that it proved successful in knocking down PMP22 mRNA expression. The composition would be obvious to make and use to modify expression of PMP22 mRNA expression, a goal of Gautier, who would be motivated to try because with the shRNA in use, some of Gautier’s work was completed successfully, but in some aspects the shRNA did not prove useful, and Cai’s molecule performed the desired function of Gautier.
Re: claims 13-16 the teachings of Gautier and Cai have been discussed as related to the composition of claim 12.
Gautier disclosed the RNAi molecule in the AAAV vector was an shRNA (Pg 4 left col, penult para, right col first para), and disclosed that this AAV-shRNA inhibited PMP22 expression (Pg 4, right col, para 2, final four lines), and that the vector was AAV2/9 (Pg 4, right col, para 2, final four lines) which is serotype 9.
Re: claim 17, Gautier used a single stranded AAV to test transduction of mSC (stem cells) after sciatic nerve delivery, identifying GFP expressing cells along the nerve of test animals and specificity of AAV2/9 after intra-nerve injection, followed by sciatic nerve injection of AAV2/9 vectors expressing the shRNAs into test animals (Pg 2, right col, para 2, Pg 3 left col, final para, to right col, paras 1-2, Pg 4 para 2).
Re: claim 18, an isolated host cell (HEK293) containing AAV of claim 12 (Pg 11, right col, final para).
Re: claims 20-22, Gauthier further used a method of treating a patient (rodent) comprising administering a therapeutically effective amount of an AAV vector according to claim 12 and doing so to treat Charot-Marie Tooth type 1A (Pg 4, right col). Gautier’s method involved intraneural route delivery (directly into nerve cells, Pg 3 right col, para 2, Pg 4 right col, para 2).
Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Gautier (Gautier et al.,2021, Nature Comms, 12: 2356) in view of Cai (Cai, W., et al., June 2017, Molec Cancer Therapeutics, 16:1187-1198), as applied to claim 12 above, and further in view of Massade, L (US11939577 B2; filed 4/24/2019).
Re: claim 19, a pharmaceutical composition of claim 12, and an excipient
The contributions of Gautier in view of Cai have been discussed as it relates to the composition of claim 12.
Neither Gautier nor Cai explicitly disclose a pharmaceutical composition with an excipient.
Massade discussed an antisense RNA (siRNA) targeting PMP22 to decrease expression of PMP22 in cells, in a pharmaceutical composition (Abstract), as relates to a method of treatment for Charcot-Marie tooth syndrome (Pg 29, Col 12). The antisense RNA, specifically the shRNA, may be cloned into a vector and transmitted to cells, and the shRNA or vector comprising said nucleic acid, may be provided in a pharmaceutical composition (Pg 28, col 9-10). The pharmaceutical composition may comprise a pharmaceutical excipient, that can be routinely selected in accordance with needs such as mode of administration, solubility and stability of RNA antisense (Pg 28, Col 10).
Prior to effective filing date it would have been prima facie obvious to one of ordinary skill in the art to have used the pharmaceutical composition with excipient of Massaude with the composition comprising a vector comprising an shRNA as disclosed by Gautier and Cai, given that the intent of these inventors/scientists was ultimately therapeutic treatment for Charcot-Marie tooth syndrome. This would have merely amounted to a combination of prior art elements according to known method to yield predictable results. Gauiter’s motivation would arise from the point that their composition in view of Cai, comprised within the pharmaceutical composition with excipient of Massaude would provide a way to reliably and repeatedly dose a therapeutic, stably maintain vector and shRNA during delivery and prevent degradation of these components of the therapeutic.
Conclusion
All claims rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lisa Horth whose telephone number is (703)756-4557. The examiner can normally be reached Monday-Friday 8:30-4:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LISA HORTH/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights