DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant filed a claim set on November 5, 2025; however, the 11/05/2025 claim set did not have the new claims or amended claims that are in a claim set filed in a preliminary amendment on February 1, 2024. The claim set under examination is from the preliminary amendment filed 2/1/2024 and has 16 claims directed to an siRNA and uses for it.
Claims 1-16 are under examination.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence disclosures are located in Table 1, namely the sequence of unmodified SEQ NC AS1 and SEQ AS1. Nucleotide sequences in the sequence MUST be entered/written 5’ to 3’. However, the sequence listing lists SEQ ID NO 3 as ttcggacatcgggtacaacat, aka 5’-ttcggacatcgggtacaacat, which is NOT the same as 3’-ttcggacatcgggtacaacat. SEQ AS1 should be written in the sequence listing as 5’-tacaacatgggctacaggctt.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Specification Objections
The use of the term Tween, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 1 is objected to because of the following informalities:
Claim 1 recites two different nucleotide sequences. The nucleotide sequences must be identified with a SEQ ID NO. It is noted that the sequence that starts 3’-TTTCGGGAC… is not present in the sequence listing. See previous section.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “a sense strand having a sequence 5’-GCC…” and an antisense sense strand having a sequence 5’-UACAA…” “A sequence” is interpreted as any two adjacent nucleotides in the recited sequence. Claim 1 is indefinite because it is not clear what two or more adjacent nucleotides are required of the siRNA sequence.
Claims 2-16 are rejected for depending from claim 1 and not remedying the indefiniteness.
To overcome this rejection, it is suggested that claim 1 recite “A siRNA… comprising a sense strand having the sequence 5’-GCCUGU… (SEQ ID NO 1), and an antisense strand having the sequence 5’-UACAACA… (SEQ ID NO ?)”.
Claims 5, 8 and 11-16 recites “Use of the siRNA of claim…” While the claims provide for the "use” of the siRNA, the claims do not set forth any steps involved in the method/process, and thus it is unclear what method/process they are intending to encompass. As such, it is not clear if the claims are directed to methods or merely reciting intended use of the siRNAs. A claim is indefinite where it merely recites a use without any active, positive steps delimiting how this use is actually practiced. Note MPEP 2173.05(q), which states “' Use' claims that do not purport to claim a process, machine, manufacture, or composition of matter fail to comply with 35 U.S.C. 101”, which is explained below.
Claims 6-7 and 9-10 are rejected for depending from claims 5 and 8 and not remedying the indefiniteness.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 5-16 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claims 5-16 recite “Use of the siRNA”. As indicated above in paragraph 12, the “use” claims are indefinite because it is not clear if the claims are directed to methods or merely reciting intended use of the siRNAs. For the purpose of examination, claims 5-16 are interpreted as reciting intended uses for the siRNAs. See MPEP 2111.02. Claims 5-16 do not further limit the structure of the siRNAs. As such claims 5-16 do not further limit the subject matter of the claims from which they depend.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 5-16 are rejected under 35 U.S.C. 101 because the claimed recitation of a use/usage, without setting forth any steps involved in the process, results in an improper definition of a process, i.e. results in a claim which is not a proper process claim under 35 USC 101. See for example Ex parte Dunki, 153 USPQ 678 (Bd. App. 1967) and Clinical Products, Ltd. V. Brenner, 255 F. Supp. 131, 149 USPQ 475 (D.D.C. 1966).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2, 5-11 and 14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lu (CN 101199858, published June 18, 2008, citation provided from the translated version). Claims 2, 11 and 14 are evidenced by Genbank (MH180383.1, Homo sapiens isolate RKL121_WG_new TNF-alpha (TNF-alpha) gene, promoter region and complete cds, available May 7, 2019).
As explained above in paragraph 19, claims 5-16 are interpreted as reciting intended uses for the siRNAs. See MPEP 2111.02. For the purpose of applying prior art, claims 5-16 will be examined as per the structure of the recited siRNA.
Regarding claims 1 and 5-10, Lu teaches an siRNA that targets human TNF-alpha mRNA comprising a sense strand and an antisense strand (page 10, Table 4, 3s and 3a). An alignment of Lu’s siRNA sense and antisense strands with the sequences in claim 1 are provided below. Lu’s siRNA sequences are 100% identical to the claimed siRNA sequences. Lu teaches the siRNAs are used to knockdown expression of the targeted gene (page 6, ¶3). Thus, Lu teaches the claimed siRNA and it’s claimed function.
Lu 3s: 5’-GCCUGUAGCCCAUGUUGUATT Lu 3a: 5’-UACAACAUGGGCUACAGGCTT
claimed sense: 5’-GCCUGUAGCCCAUGUUGUATT antisense: 5’-UACAACAUGGGCUACAGGCTT
Regarding claims 2, 11 and 14, Lu is silent regarding the sequence of the target human TNF-alpha. However, Genbank teaches the sequences the TNF-alpha coding sequence, which is 100% identical to SEQ ID NO 1. Therefore, Lu’s siRNA comprising the 3s and 3a strands above inherently targeted and could knockdown the expression of a gene comprising SEQ ID NO: 1.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 3, 12 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Lu (CN 101199858, published June 18, 2008, citation provided from the translated version), as applied to claim 1-2, 5-11 and 14 above, and further in view of Hu (Hu et al., Signal Transduction and Targeted Therapy (2020), 5:101, pages 1-25).
The teachings of Lu are recited above as for claims 1-2, 5-11 and 14 and are incorporated here. Briefly, Lu teaches a TNF-alpha-targeting siRNA comprising sense and antisense strands with 100% identity to the claimed sequences of the siRNA sense and antisense strands.
Lu does not teach using phosphorothioate linkages (i.e. thiol substitutions of an oxygen agon of an alpha-phosphate group) in the siRNA.
Hu teaches phosphorothioate (PS) linkages comprise substituting a sulfur atom for one of the nonbridging oxygen atoms in the phosphate group in the phosphodiester backbone (page 4, ¶2). Hu teaches PS modifications provide resistance to nucleases and increases the circulation time of the siRNAs in vivo (page 4, ¶2). Hu provides examples of siRNAs having PS linkages in the sense strand (Fig 3).
Regarding claims 3, 12 and 15, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have incorporated PS linkages in at least one linkage in the sense strand of Lu’s siRNA. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that PS linkages can be incorporated into Lu’s siRNA sense strand because Hu teaches that it is standard practice in the art for therapeutic siRNAs. One would have been motivated to have done so because Hu teaches that PS linkages increase the stability of siRNAs in vivo.
Claims 4, 13 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Lu (CN 101199858, published June 18, 2008, citation provided from the translated version) and Hu (Hu et al., Signal Transduction and Targeted Therapy (2020), 5:101, pages 1-25), as applied to claim 1-3, 5-12 and 14-15 above, and further in view of Biscans (Biscans et al., Nucleic Acids Research (2020), 48: 7665-7680) and Berk (Berk et al., Nucleic Acid Therapeutics (2021), 31: 237-244).
Regarding the positions recited in claim 4, a phosphate group of nucleotides 2-4, 6-7, 9-13, 15-16 and 18-19 are equivalent to linkages 1-3, 5-6, 8-12, 14-15 and 17-18 of the sense strand since the phosphate group is on the 5’ end each nucleotide. It is noted that the claimed modification pattern, while fully supported in the Specification (page 4, lines 5-6), is not the modification pattern provided in Table 1. SEQ S4 comprises PS linkages on nucleotides in positions 3-5, 7-8, 10-14, 16-18 and 20 (Table 1). Nevertheless, the siRNA does not exclude additional PS linkages at other positions or PS linkages on the antisense strand.
The teachings of Lu and Hu are recited above and applied as for claims 1-3, 5-12 and 14-15. Hu also teaches that the position and number of PS linkages should be optimized for individual applications (page 4, ¶2). Hu teaches that more PS linkages can increase protein binding, and thus lifetime in circulation, but at least when present in the antisense strand, can reduce binding to the target sequence (page 4, ¶2). Hu teaches the most common site for PS-linkages is the 5’- terminal two linkages on both the sense and antisense strands (Fig 3), which is equivalent to PS substitutions on the 1st and 2nd nucleotides of the claimed siRNA.
Lu and Hu do not teach modifying at least the 1-3, 5-6, 8-12, 14-15 and 17-18 linkages.
Biscans teaches “High PS/PO” ratio modified siRNAs with 3’ overhangs (Fig 2). Biscans teaches the high PS/PO siRNAs have two PS linkages at the 5’ end of the sense strand and 7 PS linkages at the 3’ end of the sense strand (Fig 2A). Biscans teaches optimization of siRNA structure is needed for targeting to specific tissues, including position and percentage of PS linkages (page 7665, ¶2-3). Biscans teaches increasing the percentage of PS linkages in the sense strand increases tissue accumulation (Fig 5).
Berk teaches an siRNA called siRNA II with 3’ overhangs on the sense and antisense strand and having a fully PS-modified sense strand (Fig 1). Berk teaches siRNA II resulted in over 50% knockdown of the intended target (FIG. 1B) and had the intended pharmacological effect in vivo (FIG. 1C-D).
Regarding claims 4, 13 and 16, it would have been obvious to one skilled in the art before the skilled artisan would have tried the claimed PS-linkage pattern in the sense strand in Lu’s siRNA. It would have amounted to the optimization of known PS linkages in a known TNF-alpha-targeted siRNA. Altering each PS linkage in the Lu’s sense strand would require screening ~ 1 million variations, a large but finite number. However, a standard design for siRNAs is to have at least the first two linkages of the sense strand to be PS linkages, thereby reducing the number of additional combinations to be screened to ~ 200,000 combinations. Both Biscans and Berk demonstrate that designing and synthesizing PS-modified the siRNAs is routine in the art. As such, the skilled artisan could have pursued the claimed PS-modified siRNA design and predicted that such a design could target TNF-alpha since the claimed high PS/PO modifications are in the sense strand. One skilled in the art would have been motivated to optimize Lu’s siRNA because both Hu and Biscans teach that siRNA modifications should be optimized for each specific application.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 of copending Application No. 19374145. Claims 3-4, 12-13 and 15-16 are rejected in view of Hu (Hu et al., Signal Transduction and Targeted Therapy (2020), 5:101, pages 1-25), Biscans (Biscans et al., Nucleic Acids Research (2020), 48: 7665-7680) and Berk (Berk et al., Nucleic Acid Therapeutics (2021), 31: 237-244).
Copending claim 2 recites A double-stranded siRNA, comprising a sense strand and an antisense strand, wherein a sequence of the sense strand is shown in SEQ ID NO. 1, from the 5' end to the 3' end is 5'- GCCUGUAGCCCAUGUUGUATT - 3', and a sequence of the antisense strand is shown in SEQ ID NO. 2, from the 5' end to the 3' end is 5'- UACAACAUGGGCUACAGGCTT - 3’. Therefore, the copending claims anticipate examined claims 1-2, 5-11 and 14.
The copending claim does not recite phosphorothioate linkages.
The teachings of Hu are recited above in paragraph 33 and 37 and are incorporated here. The teachings of Biscans and Berk are recited above in paragraphs 39 and 40, respectively, and are incorporated here.
Regarding claims 4, 13 and 16, it would have been obvious to one skilled in the art before the skilled artisan would have tried the claimed PS-linkage pattern in the sense strand of the siRNA in the copending Application. It would have amounted to the optimization of known PS linkages in the copending TNF-alpha-targeted siRNA. Altering each PS linkage in the copending siRNA sense strand would require screening ~ 1 million variations, a large but finite number. However, a standard design for siRNAs is to have at least the first two linkages of the sense strand to be PS linkages, thereby reducing the number of additional combinations to be screened to ~ 200,000 combinations. Both Biscans and Berk demonstrate that designing and synthesizing PS-modified the siRNAs is routine in the art. As such, the skilled artisan could have pursued the instantly claimed PS-modified siRNA design and predicted that such a design could target TNF-alpha since the claimed high PS/PO modifications are in the sense strand. One skilled in the art would have been motivated to optimize the copending siRNA because both Hu and Biscans teach that siRNA modifications should be optimized for each specific application.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights