HYBRID PROMOTERS FOR GENE EXPRESSION IN MUSCLES AND IN THE CNS

§103 §112 §DOUBLEPATENT

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made of Applicant’s National Stage entry of PCT Application PCT/US2022/072028 filed on 8/04/2022 and Foreign Application EP 21306089.0 filed on 8/04/2021. An English language copy of certified priority document EP 21306089.0 has been properly added to the priority chain. The copy has been made available from the WIPO Digital Access Service. The certified copy provides support for the priority date to be the filing date of the foreign application; i.e., August 4th, 2021. Election/Restrictions Applicant's election with traverse of group I and species: Group A: a plurality of liver-selective enhancers having the same sequence, SEQ ID NO: 1 (i.e. HS-CRM8), Group B: 3 liver-selective enhancers (HS-CRM8, SEQ ID NO: 1), Group C: SPC5-12 promoter (SEQ ID NO: 7), Group D: the second muscle-selective promoter (spC5-12) consists of SEQ ID NO: 6; and Group E: the nucleic acid consists of SEQ ID NO: 29, in the reply filed on 3/10/2026 was previously acknowledged. New claim 33 is added to Group 1. The election/restriction is made Final. Claims 31-32 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group or species, there being no allowable generic or linking claim. Election was made with traverse in the reply filed on 3/10/2026. However, no argument or reasoning was provided. Amendments This action is in response to papers filed 24th Aug 2026 in which drawings, specification and claims 16, 19, 20, 21, 24, 25, and 31 were amended, new claim 33 was added and no claims cancelled. All of the amendments have been thoroughly reviewed and entered. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant's remarks with respect to: §112a rejections have been fully considered and are persuasive for the reasons discussed in this Office Action. The §112a rejection is withdrawn. §103 rejections have been fully considered but they are not persuasive for the reasons discussed in this Office Action. The §103 rejection is maintained. NSDP rejections have been fully considered but they are not persuasive for the rejection made over: Application No. 17601934 but are persuasive for US 12171843 B2 for the reasons discussed in this Office Action. The NSDP rejection is maintained for Application No. 17601934 and withdrawn for US 12171843 B2. Status of the Claims Accordingly, claims 16-30 and 33 are being examined. Claim Interpretation functional variant: Pursuant Remarks filed 8/24/2026, "functional variant" refers to "functional derivatives", "fragments", "analogs", or "homologs" of a nucleic acid molecule of interest, which retain at least in part the biological activity of said nucleic acid molecule of interest. The functional variant may have an activity which is at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the activity of the nucleic acid molecule of interest. Also seen in specification filed 8/24/2026, pg. 12, last para. One of skill in the art knows how to test the function of a sequence that is a gene regulatory element. From the art, Chuah, as previously cited teach the significance of maintaining the CRM, which one of skill in the art knows to apply in the creation of variants; i.e., Chuah provides a blueprint for how and where to make modifications in a sequence being considered as a regulatory element. Withdrawn Claim Rejections - 35 USC § 112 (a) Response to Arguments: Applicants argue, arguments filed 8/24/2026, pg. 4, last para.: the claims have been amended to indicate that the functional variants have at least 90% sequence identity to the claimed sequences and the as-filed disclosure indicates that these functional derivatives have at least 40% of the activity of the corresponding nucleic acid (i.e., promoter). This is persuasive. Additionally, the recitation of the 90% sequence identity to the enumerated sequences would necessarily only include sequences that are recited, which is limited (“consisting of”) to the specified sequences. The rejection is withdrawn. Maintained Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 16-30 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Mingozzi (WO 2020208032 A1, IDS) in view of Skopenkova (VOL. 13 № 1 (48) 2021 | ACTA NATURAE) and Gray (US 2021/0162073 A1, priority date 02/05/2018). Regarding claims 16, 19, and 33, Mingozzi’s invention relates to hybrid promoters to drive gene expression in muscles. Mingozzi’s novel hybrid promoters are based on the combination of one or more liver-selective enhancer(s) operably linked to a muscle-selective promoter. Mingozzi teach that the expression of a transgene is increased in muscle cells when placed under the control of such a hybrid promoter including a liver-selective enhancer (bridging pgs 1-2). Mingozzi test two liver-selective enhancers: fibrinogen alpha chain, F, and three copies of the liver-specific enhancer; i.e., SEQ ID NO: 1, (HS-CRM8) operably linked to muscle-specific promoters, which are either spC5-12 promoter or CK6 and CK8 promoter, respectively, and show that the combinations perform better in transgene expression (mSEAP) in the muscle than the promoters used without the liver-specific enhancers (Table 1, Figure 7, last para on pg. 43; Figure 5-6, last para on pg. 43, 2nd para). Mingozzi teaches the muscle-specific promoter, CK6 promoter (Table. 1, SEQ ID NO: 6). Mingozzi’s CK6 promoter is 100% identical to instant SEQ ID NO: 7. RESULT 1 US-17-601-934-6 Query Match 100.0%; Score 575; DB 1; Length 575; Best Local Similarity 100.0%; Matches 575; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGT 60 Qy 61 TATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAG 120 Qy 121 CGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGC 180 Qy 181 TCTAAAAATAACCCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTAAAAATAACCCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGC 240 Qy 241 TGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTC 300 Qy 301 CATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGA 360 Qy 361 ACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTG 420 Qy 421 CACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCT 480 Qy 481 CAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTAT 540 Qy 541 ATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 575 ||||||||||||||||||||||||||||||||||| Db 541 ATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 575 Regarding claim 20, Mingozzi teaches the spC5-12 promoter is represented by SEQ ID NO: 2-4 (pg. 3, 2nd para; Table. 1, SEQ ID NO: 2). Mingozzi’s spC5-12 promoter represented by SEQ ID NO: 2 is at least 90% identical to instant SEQ ID NO: 6. RESULT 1 US-17-601-934-2 Query Match 81.2%; Score 291.4; DB 1; Length 315; Best Local Similarity 97.5%; Matches 307; Conservative 0; Mismatches 6; Indels 2; Gaps 1; Qy 2 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 62 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 122 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 182 AAATATGGCGAC--GGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGG 239 |||||||||||| | | | ||| |||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACCGGTTCCTCAACCGGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGG 240 Qy 240 CCGCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGG 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CCGCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGG 300 Qy 300 CGGCGGCCCACGAGC 314 ||||||||||||||| Db 301 CGGCGGCCCACGAGC 315 Mingozzi’s spC5-12 promoter represented by SEQ ID NO: 4 is 100% identical to instant SEQ ID NO: 6. RESULT 1 US-17-601-934-4 Query Match 99.7%; Score 358; DB 1; Length 358; Best Local Similarity 100.0%; Matches 358; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 62 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 122 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 182 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 240 Qy 242 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 300 Qy 302 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 358 Regarding claim 21, Mingozzi teaches SEQ ID NO: 1, which is one copy of a liver-specific enhancer (Table. 1, SEQ ID NO: 1), is 100% identical to instant SEQ ID NO: 1. RESULT 1 US-17-601-934-1 Query Match 100.0%; Score 72; DB 1; Length 72; Best Local Similarity 100.0%; Matches 72; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 Qy 61 GGCTAAGTCCAC 72 |||||||||||| Db 61 GGCTAAGTCCAC 72 Regarding claims 22-24, Mingozzi teaches three copies of SEQ ID NO: 1, the liver-specific enhancer (Table. 1, H3 is three copies of SEQ ID NO: 1). Regarding claims 26 – 29, Mingozzi teaches design, construction, and testing of muscle-specific promoters operably linked to enhancers cassettes, packaged in AAV vectors, wherein such a cassette increases transcription of a heterologous gene expression, as discussed above, and detailed in the materials and methods section (materials and methods, pgs. 40-46; Fig. 1-7; abstract). Regarding claim 30, Mingozzi teaches a cell comprising the expression cassette of claim 26 (In a particular embodiment, the invention involves introducing the nucleic acid molecule or the expression cassette of the invention into cells of the subject to be treated, and administering back to the subject said cells into which the nucleic acid or expression cassette has been introduced, pg. 34). Mingozzi does not teach juxtaposition of two muscle-specific promoters or the specific order of combination of the two muscle-specific promoters, as recited in the claim (claim 17). However, before the effective filing date of the claimed invention, Skopenkova discussed the critical role of muscle-specific promoters in gene therapy for inherited muscle disorders. Skopenkova discussed synthetic muscle-specific promoters were engineered to be shorter and more efficient and they were combined with other vector elements to enhance tissue-specific expression. Specifically, in Fig. 5 Skopenkova discussed the SPc5-12 synthetic promoter. SPc5-12 synthetic promoter consists of a combination of four muscle-specific TFBSs (TEF1, SRE, MEF1, and MEF2) and the core promoter (a fragment of the promoter of the chicken skeletal muscle α-actin gene). Skopenkova discussed how the promoter was created, from pg. 54: PNG media_image1.png 200 400 media_image1.png Greyscale Skopenkova discussed, the MCK promoter (creatine kinase, M-type) has been characterized well both in vitro and in vivo. From pg. 50: PNG media_image2.png 200 400 media_image2.png Greyscale The construct CK6, consisting of an enhancer (206 bp) and a proximal promoter (358 bp) (Fig. 3) of MCK, ensured high muscle specificity. PNG media_image3.png 200 400 media_image3.png Greyscale Skopenkova also discuss CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof (at least Figs 2-5). Before the effective filing date of the claimed invention, Gray taught ApoE enhancer in combination with other regulatory elements. In paragraphs 0035, Gray taught that the ApoE enhancer is a liver-specific enhancer (hepatic control region). In paragraphs 95 and 135, for example Gray taught that such combinations provide for directed expression of a transgene in specific tissues such as muscle and CNS and also provide for a reduced immune response (para 0095). Specifically, Gray taught promoters of the instant invention include the synapsin promoter, desmin promoter, and alph-1 anti-trypsin promoter, in combination with the liver-specific enhancer. Further, Gray have taught that functional portion thereof the muscle-specific promoters may be used (para 0066).Thus, it is clear from the teachings of Gray that a functional fragment of any known muscle specific promoter can be used when promoters are being combined. This teaching of Gray reiterates Skopenkova’s teachings of combining regulatory elements. Gray taught up to three regulatory elements may be combined: PNG media_image4.png 200 400 media_image4.png Greyscale PNG media_image5.png 200 400 media_image5.png Greyscale Gray had taught vectors, including AAV, lentiviral, retroviral, adenoviral, and lentivral vectors (see paragraphs 29, 83, and claim 84) that comprised tissue specific enhancers and promoters for tissue specific expression of a transgene of interest. Regarding claims 17-18, Gray taught that the regulatory elements may be combined in the order 5’ to 3’ (discussed above, [0004] and [0017]. It would have been prima facie obvious to an artisan of ordinary skill to link a liver-specific enhancer as taught by Mingozzi with muscle-specific promoters as taught by Skopenkova and Gray into a single nucleic acid molecule because Gray provides ample motivation and direction to make combinations of a liver-specific enhancer with two different promoters and Skopenkova provides ample motivation and direction to make rearrange regulatory elements from varied sources such as enhancers with promoters or functional fragments of various promoters as has been done to create the known spC5-12 promoter. All of the enhancers and promoters recited in the instant invention were known at the time applicant effectively filed the application. One would be motivated to make the combination because a teaching to make such a combination (library of constructs) was also known in the art to exist, and combining the elements as claimed by known methods with no change in their respective functions would have yielded predictable results for the combination; i.e., nucleic acid molecule comprising (i) a liver-specific enhancer and (ii) a muscle-specific promoter comprising a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof. See MPEP 2143 (A) and (G). One of ordinary skill in the art would have reasonable expectation of success because all references are in the field of producing nucleic acid molecules for gene therapy especially requiring expression in muscle tissue. Thus, Mingozzi in view of Skopenkova and Gray, make obvious instant claims 16-24, 26-30 and 33. Regarding claim 25, Mingozzi (WO2020208032-A1) taught HS-CRM8x3 enhancer-CK6 promoter DNA, SEQ ID NO: 36. Shown below: Query Match 68.6%; Score 803; Length 803; Best Local Similarity 100.0%; Matches 803; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 Qy 61 GGCTAAGTCCACAAGCTTGGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGCTAAGTCCACAAGCTTGGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTT 120 Qy 121 ATCGGAGGAGCAAACAGGGGCTAAGTCCACGGGGGAGGCTGCTGGTGAATATTAACCAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATCGGAGGAGCAAACAGGGGCTAAGTCCACGGGGGAGGCTGCTGGTGAATATTAACCAAG 180 Qy 181 GTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACACTAGTCTACGGGTCTAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACACTAGTCTACGGGTCTAG 240 Qy 241 GCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCC 300 Qy 301 CAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCAC 360 Qy 361 CCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAAC 420 Qy 421 CCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTT 480 Qy 481 GGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGC 540 Qy 541 GAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAA 600 Qy 601 GTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTC 660 Qy 661 CGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTC 720 Qy 721 CCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGG 780 Qy 781 CACAGGGGCTGCCCCCGGGTCAC 803 ||||||||||||||||||||||| Db 781 CACAGGGGCTGCCCCCGGGTCAC 803 RESULT 1 US-17-601-934-4 When the above is combined with spC5-12 promoter DNA, SEQ ID NO: 4, as disclosed for claim 20, the combination would yield a sequence that is 100% identical to instant SEQ ID NO: 29. See remaining of SEQ ID NO: 29 not shown in alignment above, as aligned with Mingozzi’s SEQ ID NO: 4: Query Match 30.6%; Score 358; DB 1; Length 358; Best Local Similarity 100.0%; Matches 358; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 814 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 873 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 874 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 933 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 934 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 993 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 994 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 1053 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 240 Qy 1054 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 1113 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 300 Qy 1114 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 1171 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 358 Thus, Mingozzi in view of Skopenkova and Gray, make obvious instant claim 25. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Response to Arguments Applicants argue, arguments filed 8/24/2026, pg. 10, last para. To end: pg. 10, last para to pg. 14 last para: the applied art of Ronzitti (referred to as Mingozzi in OA) teach the association of a liver-specific enhancer and a muscle-specific promoter, unlike instant which is directed to the juxtaposition of 2 muscle-specific promoters or the specific order of those promoters with a liver-specific enhancer. This is not persuasive. Referring to MPEP 2144.04 VI, mere duplication or rearrangement of parts has no patentable significance unless a new and unexpected result is produced. Middle of pg. 15: reference of Gray: Applicants argue: Gray was cited for a teaching related to the combination of an ApoE enhancer (a liver-specific enhancer) (called a first segment in Gray [0004]) with other regulatory elements, especially synapsin promoter, desmin promoter and alpha-anti-trypsin promoter (called a second segment in Gray [0004]). In paragraph [0017], a third fragment can be combined with the first and second fragments. However, Gray does not suggest combining two muscle-specific promoters. Indeed, the third fragment is not a muscle-specific promoter. It is also noted that paragraphs [0018]-[0019] of Gray indicates that the third fragment stimulates expression in a cell of the CNS. Thus, the two promoters disclosed in Gray have different tissue-specificity. Accordingly, Gray does not teach nor suggest the combination of two promoters having the same specificity, especially two muscle-specific promoters. Thus, Applicants submit that the cited combination of references fail to raise a prima facie case of obviousness for the claimed invention. This is not persuasive. In response to applicant's argument that “b. Gray does not suggest combining two muscle-specific promoters, and c. the two promoters disclosed in Gray have different tissue-specificity. Accordingly, Gray does not teach nor suggest the combination of two promoters having the same specificity, especially two muscle-specific promoters.”, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In instant case, Gray was relied upon as practical evidence that more than one promoter may be juxtaposed near an enhancer to improve transgene expression. One of skill in the art can see that if expression in a CNS-specific cell is not needed, than a CNS-specific promoter may not be the third segment that is combined. Further to that, one of skill in the art can see that if expression in a muscle-specific cell is needed, then a muscle-specific promoter may be the third segment that is combined. Therefore, a prima facie case of obviousness was properly made. End of pg. 15, last para to pg. 16: new and unexpected result is produced. Applicants argue, the addition of a CK6 promoter, and its positioning between the liver-selective enhancer and the second muscle-selective promoter results in a synergistic effect results in a major improvement in transgene expression in vivo, Figures 7-12. This is not persuasive. "To be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014). A showing of unexpected results must be "commensurate in scope with the degree of protection sought by the claimed subject matter." In re Harris, 409 F.3d 1339, 1344 (Fed. Cir. 2005). "Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected." (emphasis added). See MPEP §716.02. "It is not enough to show that results are obtained which differ from those obtained in the prior art: that difference must be shown to be an unexpected difference". ( original emphasis). In re Klosak, 455 F.2d 1077, 1080 (CCPA 1972). In instant case, Fig. 7 shows: increased expression of GAA with H3-CK6-C512 (CK6 promoter positioned between the liver-selective enhancer and the second muscle-selective promoter), middle bar, over: H3- C512 (no CK6 promoter), or H3-CK6 (no second muscle-selective promoter), or CK6-C512 (no enhancer). Thus, it can be conclusively said that the presence of an enhancer with two promoters, CK6-C512, show enhanced expression compared to use of an enhancer with one promoter. This is expected. Nothing in this Fig. shows positioning of CK6 results in enhanced activity as positioning of CK6 after the second promoter or even before the enhancer is not shown. Similar analysis can be made for remaining figures argued by Applicant. In view of the foregoing, the rejection of claims 16-30 and 33 over Mingozzi in view of Skopenkova and Gray is maintained. Maintained Double Patenting 17601934 Claims 16-30 and 33 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 20 – 26, 28, 30, 32, and 34-39 of copending Application No. 17601934 (reference application) in view of Skopenkova (VOL. 13 № 1 (48) 2021 | ACTA NATURAE) and Gray (US 2021/0162073 A1, priority date 02/05/2018). The claims of both applications require a hybrid promoter comprising a liver-selective enhancer in combination with a muscle-selective promoter. Furthermore, the sequences recited for each of the liver-selective enhancers and muscle-selective promoters are the same. The reference application further comprises a broader genus of regulatory elements than instant. Instant claim 16 Reference claim 20 A nucleic acid molecule comprising, operatively linked to each other: (i) one or a plurality of liver-selective enhancer(s); (ii) a first muscle-selective promoter, which is a CK6 promoter: comprising SEQ ID NO: 7 or SEQ ID NO: 35 or a functional variant thereof; and (iii) a second muscle-selective promoter, selected from the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, and functional variants thereof….and further sequences of liver-selective enhancer(s). A nucleic acid molecule comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, wherein: the liver-selective enhancer comprises a sequence selected from the group consisting of SEQ ID NO: 1 or SEQ ID NO: 30; and the muscle-selective promoter comprises SEQ ID NOs: 2, 3, 4, 6, 7, 8. The reference application does not teach three groups of regulatory elements linked to each other wherein there are two muscle-specific promoters; i.e., ref app does not teach: (ii) a first muscle-selective promoter …; and (iii) a second muscle-selective promoter. However, before the effective filing date of the claimed invention, Skopenkova discussed the critical role of muscle-specific promoters in gene therapy for inherited muscle disorders. Skopenkova discussed synthetic muscle-specific promoters were engineered to be shorter and more efficient and they were combined with other vector elements to enhance tissue-specific expression. Specifically, in Fig. 5 Skopenkova discussed the SPc5-12 synthetic promoter. SPc5-12 synthetic promoter consists of a combination of four muscle-specific TFBSs (TEF1, SRE, MEF1, and MEF2) and the core promoter (a fragment of the promoter of the chicken skeletal muscle α-actin gene). Skopenkova discussed how the promoter was created. Before the effective filing date of the claimed invention, Gray taught ApoE enhancer in combination with other regulatory elements. In paragraphs 0035, Gray taught that the ApoE enhancer is a liver-specific enhancer (hepatic control region). In paragraphs 95 and 135, for example Gray taught that such combinations provide for directed expression of a transgene in specific tissues such as muscle and CNS and also provide for a reduced immune response (para 0095). Specifically, Gray taught promoters of the instant invention include the synapsin promoter, desmin promoter, and alph-1 anti-trypsin promoter, in combination with the liver-specific enhancer. Further, Gray have taught that functional portion thereof the muscle-specific promoters may be used (para 0066).Thus, it is clear from the teachings of Gray that a functional fragment of any known muscle specific promoter can be used when promoters are being combined. This teaching of Gray reiterates Skopenkova’s teachings of combining regulatory elements. Gray taught up to three regulatory elements may be combined: PNG media_image4.png 200 400 media_image4.png Greyscale PNG media_image5.png 200 400 media_image5.png Greyscale Gray had taught vectors, including AAV, lentiviral, retroviral, adenoviral, and lentivral vectors (see paragraphs 29, 83, and claim 84) that comprised tissue specific enhancers and promoters for tissue specific expression of a transgene of interest. It would have been prima facie obvious to an artisan of ordinary skill to link a liver-specific enhancer as taught by Ref App with muscle-specific promoters as taught by Skopenkova and Gray into a single nucleic acid molecule because Gray provides ample motivation and direction to make combinations of a liver-specific enhancer with two different promoters and Skopenkova provides ample motivation and direction to make rearrange regulatory elements from varied sources such as enhancers with promoters or functional fragments of various promoters as has been done to create the known spC5-12 promoter. All of the enhancers and promoters recited in the instant invention were known at the time applicant effectively filed the application. One would be motivated to make the combination because a teaching to make such a combination (library of constructs) was also known in the art to exist, and combining the elements as claimed by known methods with no change in their respective functions would have yielded predictable results for the combination; i.e., nucleic acid molecule comprising (i) a liver-specific enhancer and (ii) a muscle-specific promoter comprising a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, and functional variants thereof. One of ordinary skill in the art would have reasonable expectation of success because all references are in the field of producing nucleic acid molecules for gene therapy especially requiring expression in muscle tissue. Thus, the combination of reference application claims in view of Skopenkova and Gray would read on instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Any additional limitations of the ‘934 claims are encompassed by the open claim language “comprises” found in the instant claims. Response to Arguments 4. Applicants argue, arguments filed 8/24/2026, pg. 16, last para to pg. 17, last para: There is no TSM in the applied ref application of 17/601934. There are unexpected results in instant application. This is not persuasive for the same reasons as discussed in the Response to Arguments section to the 103 rejection. 5. Applicants argue, arguments filed 8/24/2026, pg. 17, last para to pg. 18, last para: Claim 1 of the 853 patent recites an ApoE enhancer (not a HS-CRM enhancer as recited in claim 16), an alpha-I antitrypsin (hAAT)promoter. This is persuasive. The NSDP rejection of instant application over US 12171843 B2 is withdrawn. Conclusion No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/Examiner, Art Unit 1635 /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635