Prosecution Insights
Last updated: July 17, 2026
Application No. 18/294,577

HYBRID PROMOTERS FOR GENE EXPRESSION IN MUSCLES AND IN THE CNS

Non-Final OA §103§112
Filed
Feb 02, 2024
Priority
Aug 04, 2021 — EU 21306089.0 +1 more
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
INSERM
OA Round
1 (Non-Final)
69%
Grant Probability
Favorable
1-2
OA Rounds
6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 69% — above average
69%
Career Allowance Rate
44 granted / 64 resolved
+8.8% vs TC avg
Strong +43% interview lift
Without
With
+43.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
52 currently pending
Career history
115
Total Applications
across all art units

Statute-Specific Performance

§101
4.1%
-35.9% vs TC avg
§103
55.2%
+15.2% vs TC avg
§102
2.5%
-37.5% vs TC avg
§112
14.6%
-25.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 64 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made of Applicant’s National Stage entry of PCT Application PCT/US2022/072028 filed on 8/04/2022 and Foreign Application EP 21306089.0 filed on 8/04/2021. An English language copy of certified priority document EP 21306089.0 has been properly added to the priority chain. The copy has been made available from the WIPO Digital Access Service. The certified copy provides support for the priority date to be the filing date of the foreign application; i.e., August 4th, 2021. Election/Restrictions Applicant's election with traverse of group I and species: Group A: a plurality of liver-selective enhancers having the same sequence, SEQ ID NO: 1 (i.e. HS-CRM8), Group B: 3 liver-selective enhancers (HS-CRM8, SEQ ID NO: 1), Group C: SPC5-12 promoter (SEQ ID NO: 7), Group D: the second muscle-selective promoter (spC5-12) consists of SEQ ID NO: 6; and Group E: the nucleic acid consists of SEQ ID NO: 29, in the reply filed on 3/10/2026 is acknowledged. The election/restriction is made Final. Claims 31-32 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group or species, there being no allowable generic or linking claim. Election was made with traverse in the reply filed on 3/10/2026. However, no argument or reasoning was provided. Accordingly, claims 16-30 are being examined. Drawings The drawings are objected to as failing to comply with 37 CFR 1.84(u)(1) because: i) the labels for Figures 1 - 12 are preceded by the word "Figure" instead of the abbreviation "FIG.". MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG.". AND ii) the partial views for Figure 4, which appear on several sheets, are followed by "Continued" instead of the same number followed by a capital letter such as FIG. 4A, FIG. 4B, etc. C.F.R. 1.84(u)(1) requires that “partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” See MPEP 608.02. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification Applicant is reminded of the proper content of an abstract of the disclosure. A patent abstract is a concise statement of the technical disclosure of the patent and should include that which is new in the art to which the invention pertains. The abstract should not refer to purported merits or speculative applications of the invention and should not compare the invention with the prior art. If the patent is of a basic nature, such as instant, the entire technical disclosure may be new in the art, and the abstract should be directed to the entire disclosure. If the patent is in the nature of an improvement in an old apparatus, process, product, or composition, the abstract should include the technical disclosure of the improvement. The abstract should also mention by way of example any preferred modifications or alternatives. Where applicable, the abstract should include the following: (1) if a machine or apparatus, its organization and operation; (2) if an article, its method of making; (3) if a chemical compound, its identity and use; (4) if a mixture, its ingredients; (5) if a process, the steps. Extensive mechanical and design details of an apparatus should not be included in the abstract. See MPEP § 608.01(b) for guidelines for the preparation of patent abstracts. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text, in accordance with 37 CFR 1.72(b). See MPEP § 608.01(b). In addition, Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. In the instant case, the invention is drawn to a liver-selective enhancer juxtaposed with a first and second muscle-selective promoter that promote transgene expression in the muscle. The abstract does not state any of this. Claim Interpretation functional variant: The specification does not describe these terms. Therefore, these terms are being given the plain English meaning of the terms to mean any difference from the original sequences with the proviso that the function of the original sequence is maintained. It does not take into consideration that the Inventors have found another unpublished function for the original sequence. It is noted that the subject matter of a properly construed claim is defined by the terms that limit its scope. It is this subject matter that must be examined. As a general matter, the grammar and intended meaning of terms used in a claim will dictate whether the language limits the claim scope. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Claim Rejections - 35 USC § 112 (a) Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 16-30 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This analysis pertains to the elected species only. The purpose of the written description requirement is to “ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1353-54 (Fed. Cir. 2010) (en banc) (quoting Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 920 (Fed. Cir. 2004)). To satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163.04. For a claim to a genus, a generic statement that defines a genus of substances by only their functional activity does not provide an adequate written description of the genus. Reagents of the University of California v. Eli Lilly, 43 USPQ2d 1398 (CAFC 1997). An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163. Scope of the Invention In the instant case, the genera are A, or a plurality of, liver-selective enhancer(s) comprising several recited SEQ ID NOs, or functional variants thereof having 80% identity to the recited sequences…said functional variant having liver-selective enhancer activity (recited in claims 16, 18, and 21-24). A muscle-selective promoter or functional variants thereof having at least 80% identity to spC5-12 (SEQ ID NO: 6) or SPC5-12 (SEQ ID NO: 7) (recited in claims 16-18 and 20). The combination of three groups of regulatory elements linked to each other wherein there are two muscle-specific promoters; i.e., (i) one or a plurality of liver-selective enhancers, (ii) a first muscle-selective promoter …; and (iii) a second muscle-selective promoter (recited in claim 16). The broadest reasonable interpretation of the scope of the genera listed above encompasses a hybrid promoter made up of a liver-selective enhancer and a muscle-selective promoter that drives expression of a transgene in the muscle. This interpretation is based on definitions on pg. 10: "liver-selective enhancer" includes natural or synthetic liver-selective enhancers that preferentially drives expression of a gene operably linked to said transcription regulatory element in the liver AND when present in a hybrid nucleic acid molecule with a muscle-selective promoter, drives expression of a gene operably linked to it in the muscle. Thus, such a hybrid nucleic acid molecule is suitable for gene therapy of neuromuscular diseases [Summary of Invention, pg. 2]. Disclosure of a Complete or Partial Structure Regarding 1) liver-selective enhancer, Applicant lists several liver-selective enhancers by SEQ ID NO and describes a preferential liver-selective enhancer(s) to be SEQ ID NO: 1 consisting of 72 bases [pg. 16, last 2 paras]. In the specification, various variants include: having at least 80% identity to SEQ ID NO: 1 [pg. 16, last 2 paras]. Functionally, the enhancer and variants must have liver-selective enhancer activity [pg. 2, first para]. The inventive concept requires the enhancer and variants to retain their ability to drive expression of a gene even in the muscle so as to function in gene therapy of neuromuscular diseases [Summary of Invention]. Further description includes combining a plurality of this liver-selective enhancer with a or plurality of muscle-selective promoter(s). In any case, the enhancer(s) are combined with a muscle-selective promoter to result in a novel hybrid promoter [pgs. 3-4, Fig. 1]. The working examples of hybrid promoters (Figures 1 and 3- 12) shows that some combinations of a particular liver-selective enhancer with different muscle-selective promoters work better than others. Specifically, H3 (three copies of HSCRM8 (SEQ ID NO: 1)) with 2 muscle-selective promoters is more efficacious than H3 juxtaposed with 1 muscle-selective promoter (one copy of spC5-12 or one copy of CK6) when the (liver) enhancer is present in a hybrid promoter along with these muscle-selective promoters. However, it is not clear how the remaining recited SEQ IDs, other than SEQ ID NO: 1, correspond to these superiorly working liver-selective enhancers, and it is not clear how the sequences within the recited SEQ IDs may be varied so that they retain 80% identity to the original sequences, as recited, yet retain the two functions that define them; i.e., driving liver and muscle-specific transgene expression, as described by the rest of the disclosure. Regarding 2) muscle-selective promoter, as recited in claim 20, Applicant describes i) first muscle-selective promoter(s) to be preferentially SEQ ID NO: 7 (CK6) consisting of 575 bases and ii) SEQ ID NO: 6 (SPC5-12) consisting of 35 bases. Various variants include: having at least 80% identity to a SEQ ID NO: 6/7 [pg. 28-29]. Functionally, the promoter and variants must have muscle-selective promoter activity [bridging pgs. 2-3]. The inventive concept requires the muscle-selective promoter, when juxtaposed with a liver-specific enhancer and functional variants, retain their ability to drive expression of a gene in the muscle so as to function in gene therapy of neuromuscular diseases [Summary of Invention]. Further description includes combining a plurality of enhancers with a muscle-selective promoter. In any case, the enhancer(s) are combined with a muscle-selective promoter to result in a novel hybrid promoter [pg. 2]. The working examples of hybrid promoters utilizes i) spC5-12 promoter, SEQ ID NO: 6 and ii)the CK6 muscle-selective promoter (SEQ ID NO 7); (Fig. 1), as the muscle-selective promoters (Figures 1, 3-12). All tested muscle-selective promoters show enhanced expression when juxtaposed near SEQ ID NO 1, the liver-selective enhancer(s). However, it is not clear how SEQ ID NO: 6 or 7 (elected species) compares with SEQ ID NO: 2 or any other muscle-selective promoter and it is not clear how the SEQ ID NO: 6 or 7 may be varied so that it retains 80% identity to its original sequence yet retains its ability to drive muscle-specific transgene expression, as described by the rest of the disclosure. Regarding 3) the combination of a liver-specific enhancer with two muscle-selective promoters, as recited in claim 16, Applicant describes two muscle-selective promoters in combination with one liver-specific enhancer, SEQ ID NO: 1, as discussed in 1) and 2) above. Species Not Described SEQ ID NO: 1 is 72 nucleotides in length. A sequence having at least 80 % identity to SEQ ID NO: 1 includes a large genus of sequences comprising nucleotide sequences that may be ≤20% different from SEQ ID NO: 1; i.e., 14 nucleotides could be different. Furthermore, a nucleotide sequence could be or have: up to 20% of the nucleotides removed from SEQ ID NO: 1; a single chunk comprising ≤20% of the nucleotides different from SEQ ID NO: 1; every 20th nucleotide (starting at any position) different from SEQ ID NO: 1; every 20th nucleotide (starting at any position) removed from SEQ ID NO: 1; any other combination of nucleotides mutated or removed as long as the total adds up to ≤20% of total nucleotides. Similarly, SEQ ID NO: 6 is 359 nucleotides in length and SEQ ID NO: 7 is 575 nucleotides in length. A sequence having at least 80 % identity to SEQ ID NO: 6/7 includes a large genus of sequences comprising nucleotide sequences that may be ≤20% different from SEQ ID NO: 7; i.e., 60-114 nucleotides could be different. Furthermore, a nucleotide sequence could be or have: up to 20% of the nucleotides removed from SEQ ID NO: 7; a single chunk comprising ≤20% of the nucleotides different from SEQ ID NO: 7; every 20th nucleotide (starting at any position) different from SEQ ID NO: 7; every 20th nucleotide (starting at any position) removed from SEQ ID NO: 7; any other combination of nucleotides mutated or removed as long as the total adds up to ≤20% of total nucleotides. With respect to the combination, other than H3 (three copies of HSCRM8 (SEQ ID NO: 1)) with 2 muscle-selective promoters (one copy of spC5-12 or one copy of CK6), no other combination of a liver-specific enhancer is present in a hybrid promoter along with any other muscle-selective promoters. Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. Some of those structures may have altered regulatory activity or other altered function(s). Structure/Function Correlation Regarding the genera, as discussed above, Applicant’s claims encompass particular sequences of promoter and a dependent claim (claim 21) encompasses a particular sequence of enhancer element with the proviso that they allow for the sequences, working alone or in combination with each other, to enhance transgene expression so as to function in gene therapy of neuromuscular diseases [Summary of Invention], while only specific sequences are described in the instant specification without any correlation to what core sequence is encompassed by the recited sequences; i.e., there is no evidence of a common domain/sequences between all sequences recited. The breadth of the claimed genera is enormously broad with an unfathomable number of structurally divergent and diverse ASOs and agents. Such structure-function correlation is required so as to allow one skilled in the art to vary sequences to allow for construction of a nucleic acid molecule that would possess the claimed function. Regarding all the sequences claimed, Applicant has not demonstrated possession of any nucleic acid molecule comprising a liver-selective enhancer operably linked to a muscle-selective promoter that will work to enhance transgene expression in the muscle, other than a molecule where the liver-selective enhancer is the full-length sequence identified as SEQ ID NO: 1. Similarly, Applicant does not describe a muscle-selective promoter that will enhance transgene expression in the muscle, other than where the muscle-selective promoter is the full-length sequence identified as SEQ ID NO: 6 or 7. The examples do not provide support for the entire genus/subgenera of sequences claimed because the examples show only individual species. The Specification does not provide sufficient evidence that each member of the entire genus of sequences claimed would produce the intended outcome of enhance transgene expression in the muscle. The Specification does not provide specific guidance for determining what the structure of species of sequences should be that will enhance transgene expression in the muscle while still being 80% identical to original sequence; the functional characteristic is not coupled with a known structure. i.e., any result seen for SEQ ID NO: 1 cannot be extrapolated to any liver-selective enhancer and any result seen for SEQ ID NO: 6/7 cannot be extrapolated to any muscle-selective promoter The Spec. does not identify a core structure necessary for being a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle. Among the evidences provided for a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle, no core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for the a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle is disclosed in such a way to demonstrate possession of the full invention as claimed at time of filing. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genus of a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle claimed. These are broad genera with diverse members and different structures that underly their functions. Although the claims recite compounds that inherently possess a functional characteristic, i.e., enhance transgene expression in the muscle, the functional characteristic is not coupled with a known structure. Knowledge from the State of the Art Wang (Gene Therapy (2008) 15, 1489–1499). Wang teaches construction and analysis of compact muscle-specific promoters for AAV vectors (title). Wang’s teaches AAV vectors comprise natural promoters: CK6 and C2C12, and synthetic promoters: C5-12 that allow for expression of transgenes LacZ or minidystrophin, in vitro and in vivo (see abstract). When used singly, these promoters do not express as strongly as CMV promoters (200-fold weaker than the CMV promoter, abstract). Therefore, Wang combine these promoters with tissue specific enhancers for tissue specific expression of a transgene of interest. When MCK enhancer is combined with promoter C5-12, it increased its strength in muscle by two- to threefold (abstract). In the 1st paragraph, for example, Wang teach that such combinations provide for directed expression of a transgene in specific tissues desired to treat disease such as Duchenne Muscular Dystrophy thus providing suitable vectors for Gene Therapy. Further, it is clear from the teachings of Wang that any known muscle-specific promoter can be combined with a suitable enhancer, and will tremendously improve the in vitro and in vivo expression ability of muscle-specific promoters. However, size is a major consideration for packaging expression cassettes into AAV: PNG media_image1.png 200 400 media_image1.png Greyscale Therefore, at least for size considerations, a randomly picked enhancer with a randomly picked promoter(s) will not be packaged in to AAV. Chuah (Chuah et al., Molecular Therapy, Volume 22, Issue 9, September 2014, Pages 1605-1613), which would be considered the closest prior art teaches cis-acting regulatory modules (CRMs) identified in a genome-wide bio-informatics strategy. This data-mining approach identifies instant SEQ ID NO: 1 as a cis-regulatory module (CRMs) with robust regulatory activity and further analyze expression patterns from an AAV construct bearing the CRMs in vivo. Chuah teach that for a CRM to act, the modules within that function as transcription factor binding sites (TFBs) must be preserved. This teaching is derived from computationally determining consensus regions of TFBs within CRMs across species (Fig. 1). While the consensus sites are deemed important, nothing in the art teaches one of skill how to vary the regions in between such sites. Re: functional variants thereof having at least 80% identity to the recited sequence, what one learns from the art is that it is quite unlikely that if the nucleotides in the regulatory elements were varied, the elements would still be functional. In fact, Chuah states, “high degree of phylogenetic conservation among 44 divergent species, this suggests a strong evolutionary selective pressure to maintain these particular TFBS combinations for high tissue-specific expression”(pg. 1607, right col). Further, Chuah indicate, there is unpredictability in taking (testing) HS-CRM element (instant SEQ ID NO: 1) out of context and testing in any routine lab cell line (HS-CRM8 element was subsequently evaluated …hFIX mRNA expression was restricted to the liver (Figure 3d,e), even upon administration of extremely high vector doses (3 × 1012 vg), despite the detection of viral genomes in non-hepatic tissues (i.e., heart, spleen, muscle, etc.) (data not shown)., pg. 1608, right col). Dependent Claims Claims 17-30 do not further limit the genus of nucleic acid molecules comprising one or a plurality of liver-selective enhancer(s) operably linked to two muscle-selective promoters so as to resolve the issues above, and are therefore, not sufficiently described for at least the reasons above. Claims19-21 and 24 are additionally rejected for not describing the genus of liver-selective enhancers that are at least 80% identical to SEQ ID NO:1, the genus of spC5-12 promoters that are at least 80% identical to SEQ ID NO:6, or the genus of CK6 promoters that are at least 80% identical to SEQ ID NO:7. Conclusion of Written Description While none of these elements is specifically required to demonstrate possession, in combination their lack means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of an invention of any oligonucleotide sequence of liver-selective enhancer(s) comprising several of the recited SEQ ID NOs, or functional variants thereof having 80% identity to the recited sequences or a combination thereof or with any two muscle-selective promoters (or functional variants thereof having 90% identity to the recited sequences), or any combination thereof. Therefore, the examiner concludes there is insufficient written description support for the instantly claimed genera of nucleic acid molecules comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, and combinations with each other as stated. Only nucleic acid molecules comprising the combination of SEQ ID NO: 1 (elected species) as the one or a plurality of liver-selective enhancer(s) and SEQ ID NO: 6 and 7 (elected species) as the muscle-selective promoters but not the full breadth of the claims is supported by Applicant’s disclosure. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 16-30 are rejected under 35 U.S.C. 103 as being unpatentable over Mingozzi (WO 2020208032 A1, IDS) in view of Skopenkova (VOL. 13 № 1 (48) 2021 | ACTA NATURAE) and Gray (US 2021/0162073 A1, priority date 02/05/2018). Regarding claim 16, Mingozzi’s invention relates to hybrid promoters to drive gene expression in muscles. Mingozzi’s novel hybrid promoters are based on the combination of one or more liver-selective enhancer(s) operably linked to a muscle-selective promoter. Mingozzi teach that the expression of a transgene is increased in muscle cells when placed under the control of such a hybrid promoter including a liver-selective enhancer (bridging pgs 1-2). Mingozzi test two liver-selective enhancers: fibrinogen alpha chain, F, and three copies of the liver-specific enhancer; i.e., SEQ ID NO: 1, (HS-CRM8) operably linked to muscle-specific promoters, which are either spC5-12 promoter or CK6 and CK8 promoter, respectively, and show that the combinations perform better in transgene expression (mSEAP) in the muscle than the promoters used without the liver-specific enhancers (Table 1, Figure 7, last para on pg. 43; Figure 5-6, last para on pg. 43, 2nd para). Regarding claim 19, Mingozzi teaches the muscle-specific promoter, CK6 promoter (Table. 1, SEQ ID NO: 6). Mingozzi’s CK6 promoter is 100% identical to instant SEQ ID NO: 7. RESULT 1 US-17-601-934-6 Query Match 100.0%; Score 575; DB 1; Length 575; Best Local Similarity 100.0%; Matches 575; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGT 60 Qy 61 TATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAG 120 Qy 121 CGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGC 180 Qy 181 TCTAAAAATAACCCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTAAAAATAACCCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGC 240 Qy 241 TGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTC 300 Qy 301 CATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGA 360 Qy 361 ACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTG 420 Qy 421 CACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCT 480 Qy 481 CAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTAT 540 Qy 541 ATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 575 ||||||||||||||||||||||||||||||||||| Db 541 ATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC 575 Regarding claim 20, Mingozzi teaches the spC5-12 promoter is represented by SEQ ID NO: 2-4 (pg. 3, 2nd para; Table. 1, SEQ ID NO: 2). Mingozzi’s spC5-12 promoter represented by SEQ ID NO: 2 is at least 80% identical to instant SEQ ID NO: 6. RESULT 1 US-17-601-934-2 Query Match 81.2%; Score 291.4; DB 1; Length 315; Best Local Similarity 97.5%; Matches 307; Conservative 0; Mismatches 6; Indels 2; Gaps 1; Qy 2 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 62 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 122 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 182 AAATATGGCGAC--GGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGG 239 |||||||||||| | | | ||| |||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACCGGTTCCTCAACCGGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGG 240 Qy 240 CCGCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGG 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CCGCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGG 300 Qy 300 CGGCGGCCCACGAGC 314 ||||||||||||||| Db 301 CGGCGGCCCACGAGC 315 Mingozzi’s spC5-12 promoter represented by SEQ ID NO: 4 is 100% identical to instant SEQ ID NO: 6. RESULT 1 US-17-601-934-4 Query Match 99.7%; Score 358; DB 1; Length 358; Best Local Similarity 100.0%; Matches 358; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 62 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 122 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 182 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 240 Qy 242 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 300 Qy 302 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 358 Regarding claim 21, Mingozzi teaches SEQ ID NO: 1, which is one copy of a liver-specific enhancer (Table. 1, SEQ ID NO: 1), is 100% identical to instant SEQ ID NO: 1. RESULT 1 US-17-601-934-1 Query Match 100.0%; Score 72; DB 1; Length 72; Best Local Similarity 100.0%; Matches 72; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 Qy 61 GGCTAAGTCCAC 72 |||||||||||| Db 61 GGCTAAGTCCAC 72 Regarding claims 22-24, Mingozzi teaches three copies of SEQ ID NO: 1, the liver-specific enhancer (Table. 1, H3 is three copies of SEQ ID NO: 1). Regarding claims 26 – 29, Mingozzi teaches design, construction, and testing of muscle-specific promoters operably linked to enhancers cassettes, packaged in AAV vectors, wherein such a cassette increases transcription of a heterologous gene expression, as discussed above, and detailed in the materials and methods section (materials and methods, pgs. 40-46; Fig. 1-7; abstract). Regarding claim 30, Mingozzi teaches a cell comprising the expression cassette of claim 26 (In a particular embodiment, the invention involves introducing the nucleic acid molecule or the expression cassette of the invention into cells of the subject to be treated, and administering back to the subject said cells into which the nucleic acid or expression cassette has been introduced, pg. 34). Mingozzi does not teach juxtaposition of two muscle-specific promoters or the specific order of combination of the two muscle-specific promoters, as recited in the claim (claim 16). However, before the effective filing date of the claimed invention, Skopenkova discussed the critical role of muscle-specific promoters in gene therapy for inherited muscle disorders. Skopenkova discussed synthetic muscle-specific promoters were engineered to be shorter and more efficient and they were combined with other vector elements to enhance tissue-specific expression. Specifically, in Fig. 5 Skopenkova discussed the SPc5-12 synthetic promoter. SPc5-12 synthetic promoter consists of a combination of four muscle-specific TFBSs (TEF1, SRE, MEF1, and MEF2) and the core promoter (a fragment of the promoter of the chicken skeletal muscle α-actin gene). Skopenkova discussed how the promoter was created, from pg. 54: PNG media_image2.png 200 400 media_image2.png Greyscale Skopenkova discussed, the MCK promoter (creatine kinase, M-type) has been characterized well both in vitro and in vivo. From pg. 50: PNG media_image3.png 200 400 media_image3.png Greyscale The construct CK6, consisting of an enhancer (206 bp) and a proximal promoter (358 bp) (Fig. 3) of MCK, ensured high muscle specificity. PNG media_image4.png 200 400 media_image4.png Greyscale Skopenkova also discuss CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof (at least Figs 2-5). Before the effective filing date of the claimed invention, Gray taught ApoE enhancer in combination with other regulatory elements. In paragraphs 0035, Gray taught that the ApoE enhancer is a liver-specific enhancer (hepatic control region). In paragraphs 95 and 135, for example Gray taught that such combinations provide for directed expression of a transgene in specific tissues such as muscle and CNS and also provide for a reduced immune response (para 0095). Specifically, Gray taught promoters of the instant invention include the synapsin promoter, desmin promoter, and alph-1 anti-trypsin promoter, in combination with the liver-specific enhancer. Further, Gray have taught that functional portion thereof the muscle-specific promoters may be used (para 0066).Thus, it is clear from the teachings of Gray that a functional fragment of any known muscle specific promoter can be used when promoters are being combined. This teaching of Gray reiterates Skopenkova’s teachings of combining regulatory elements. Gray taught up to three regulatory elements may be combined: PNG media_image5.png 200 400 media_image5.png Greyscale PNG media_image6.png 200 400 media_image6.png Greyscale Gray had taught vectors, including AAV, lentiviral, retroviral, adenoviral, and lentivral vectors (see paragraphs 29, 83, and claim 84) that comprised tissue specific enhancers and promoters for tissue specific expression of a transgene of interest. Regarding claims 17-18, Gray taught that the regulatory elements may be combined in the order 5’ to 3’ (discussed above, [0004] and [0017]. It would have been prima facie obvious to an artisan of ordinary skill to link a liver-specific enhancer as taught by Mingozzi with muscle-specific promoters as taught by Skopenkova and Gray into a single nucleic acid molecule because Gray provides ample motivation and direction to make combinations of a liver-specific enhancer with two different promoters and Skopenkova provides ample motivation and direction to make rearrange regulatory elements from varied sources such as enhancers with promoters or functional fragments of various promoters as has been done to create the known spC5-12 promoter. All of the enhancers and promoters recited in the instant invention were known at the time applicant effectively filed the application. One would be motivated to make the combination because a teaching to make such a combination (library of constructs) was also known in the art to exist, and combining the elements as claimed by known methods with no change in their respective functions would have yielded predictable results for the combination; i.e., nucleic acid molecule comprising (i) a liver-specific enhancer and (ii) a muscle-specific promoter comprising a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof. See MPEP 2143 (A) and (G). One of ordinary skill in the art would have reasonable expectation of success because all references are in the field of producing nucleic acid molecules for gene therapy especially requiring expression in muscle tissue. Thus, Mingozzi in view of Skopenkova and Gray, make obvious instant claims 16-24 and 26-30. Regarding claim 25, Mingozzi (WO2020208032-A1) taught HS-CRM8x3 enhancer-CK6 promoter DNA, SEQ ID NO: 36. Shown below: Query Match 68.6%; Score 803; Length 803; Best Local Similarity 100.0%; Matches 803; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 Qy 61 GGCTAAGTCCACAAGCTTGGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGCTAAGTCCACAAGCTTGGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTT 120 Qy 121 ATCGGAGGAGCAAACAGGGGCTAAGTCCACGGGGGAGGCTGCTGGTGAATATTAACCAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATCGGAGGAGCAAACAGGGGCTAAGTCCACGGGGGAGGCTGCTGGTGAATATTAACCAAG 180 Qy 181 GTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACACTAGTCTACGGGTCTAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACACTAGTCTACGGGTCTAG 240 Qy 241 GCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCC 300 Qy 301 CAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCAC 360 Qy 361 CCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAAC 420 Qy 421 CCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CCTGTCCCTGGTGGGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTT 480 Qy 481 GGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGC 540 Qy 541 GAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAA 600 Qy 601 GTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTC 660 Qy 661 CGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTC 720 Qy 721 CCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGG 780 Qy 781 CACAGGGGCTGCCCCCGGGTCAC 803 ||||||||||||||||||||||| Db 781 CACAGGGGCTGCCCCCGGGTCAC 803 RESULT 1 US-17-601-934-4 When the above is combined with spC5-12 promoter DNA, SEQ ID NO: 4, as disclosed for claim 20, the combination would yield a sequence that is 100% identical to instant SEQ ID NO: 29. See remaining of SEQ ID NO: 29 not shown in alignment above, as aligned with Mingozzi’s SEQ ID NO: 4: Query Match 30.6%; Score 358; DB 1; Length 358; Best Local Similarity 100.0%; Matches 358; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 814 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 873 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCGCGGTGGCGGCCGTCCGCCCTCGGCACCATCCTCACGACACCCAAATATGGCGACG 60 Qy 874 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 933 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTG 120 Qy 934 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 993 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCC 180 Qy 994 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 1053 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCC 240 Qy 1054 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 1113 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCG 300 Qy 1114 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 1171 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCT 358 Thus, Mingozzi in view of Skopenkova and Gray, make obvious instant claims 25. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Double Patenting 17601934 Claims 16-30 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 20 – 26, 28, 30, 32, and 34-39 of copending Application No. 17601934 (reference application) in view of Skopenkova (VOL. 13 № 1 (48) 2021 | ACTA NATURAE) and Gray (US 2021/0162073 A1, priority date 02/05/2018). The claims of both applications require a hybrid promoter comprising a liver-selective enhancer in combination with a muscle-selective promoter. Furthermore, the sequences recited for each of the liver-selective enhancers and muscle-selective promoters are the same. The reference application further comprises a broader genus of regulatory elements than instant. Instant claim 16 Reference claim 20 A nucleic acid molecule comprising, operatively linked to each other: (i) one or a plurality of liver-selective enhancer(s); (ii) a first muscle-selective promoter, which is a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof. A nucleic acid molecule comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, wherein: the liver-selective enhancer comprises a sequence selected from the group consisting of SEQ ID NO: 1 SEQ ID NO: 30 or functional variants thereof having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 30 and having liver selective enhancer activity; and the muscle-selective promoter comprises SEQ ID NOs: 2, 3, 4, 6, 7, 8 or functional variants thereof having at least 95% sequence identity to SEQ ID NOs: 2, 3, 4, 6, 7 or 8 and having selective expression in muscle cells. The reference application does not teach three groups of regulatory elements linked to each other wherein there are two muscle-specific promoters; i.e., ref app does not teach: (ii) a first muscle-selective promoter …; and (iii) a second muscle-selective promoter. However, before the effective filing date of the claimed invention, Skopenkova discussed the critical role of muscle-specific promoters in gene therapy for inherited muscle disorders. Skopenkova discussed synthetic muscle-specific promoters were engineered to be shorter and more efficient and they were combined with other vector elements to enhance tissue-specific expression. Specifically, in Fig. 5 Skopenkova discussed the SPc5-12 synthetic promoter. SPc5-12 synthetic promoter consists of a combination of four muscle-specific TFBSs (TEF1, SRE, MEF1, and MEF2) and the core promoter (a fragment of the promoter of the chicken skeletal muscle α-actin gene). Skopenkova discussed how the promoter was created, from pg. 54: Before the effective filing date of the claimed invention, Gray taught ApoE enhancer in combination with other regulatory elements. In paragraphs 0035, Gray taught that the ApoE enhancer is a liver-specific enhancer (hepatic control region). In paragraphs 95 and 135, for example Gray taught that such combinations provide for directed expression of a transgene in specific tissues such as muscle and CNS and also provide for a reduced immune response (para 0095). Specifically, Gray taught promoters of the instant invention include the synapsin promoter, desmin promoter, and alph-1 anti-trypsin promoter, in combination with the liver-specific enhancer. Further, Gray have taught that functional portion thereof the muscle-specific promoters may be used (para 0066).Thus, it is clear from the teachings of Gray that a functional fragment of any known muscle specific promoter can be used when promoters are being combined. This teaching of Gray reiterates Skopenkova’s teachings of combining regulatory elements. Gray taught up to three regulatory elements may be combined: PNG media_image5.png 200 400 media_image5.png Greyscale PNG media_image6.png 200 400 media_image6.png Greyscale Gray had taught vectors, including AAV, lentiviral, retroviral, adenoviral, and lentivral vectors (see paragraphs 29, 83, and claim 84) that comprised tissue specific enhancers and promoters for tissue specific expression of a transgene of interest. It would have been prima facie obvious to an artisan of ordinary skill to link a liver-specific enhancer as taught by Ref App with muscle-specific promoters as taught by Skopenkova and Gray into a single nucleic acid molecule because Gray provides ample motivation and direction to make combinations of a liver-specific enhancer with two different promoters and Skopenkova provides ample motivation and direction to make rearrange regulatory elements from varied sources such as enhancers with promoters or functional fragments of various promoters as has been done to create the known spC5-12 promoter. All of the enhancers and promoters recited in the instant invention were known at the time applicant effectively filed the application. One would be motivated to make the combination because a teaching to make such a combination (library of constructs) was also known in the art to exist, and combining the elements as claimed by known methods with no change in their respective functions would have yielded predictable results for the combination; i.e., nucleic acid molecule comprising (i) a liver-specific enhancer and (ii) a muscle-specific promoter comprising a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof. One of ordinary skill in the art would have reasonable expectation of success because all references are in the field of producing nucleic acid molecules for gene therapy especially requiring expression in muscle tissue. Thus, the combination of reference application claims in view of Skopenkova and Gray would read on instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Any additional limitations of the ‘934 claims are encompassed by the open claim language “comprises” found in the instant claims. US 12171843 B2 Claims 16-30 are rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1 - 13 of U.S. Patent No. 12171843 (reference application of 16/968196) in view of Skopenkova (VOL. 13 № 1 (48) 2021 | ACTA NATURAE) and Gray (US 2021/0162073 A1, priority date 02/05/2018). The independent claims have the following patentably indistinct recitations: Instant claim 20 Reference claim 1 A nucleic acid molecule comprising, operatively linked to each other: (i) one or a plurality of liver-selective enhancer(s); (ii) a first muscle-selective promoter, which is a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Acta1 promoter, MCK promoter, desmin promoter, and functional variants thereof. A nucleic acid sequence comprising: (i) a first transcription regulatory element capable of driving or enhancing tissue-selective expression in a first tissue, wherein said first tissue is the liver; and (ii) a second transcription regulatory element capable of driving or enhancing tissue-selective expression in a second tissue, wherein said second tissue is not the liver; wherein the first and second transcription regulatory elements are fused together; and wherein the second transcription regulatory element is a muscle-selective promoter; wherein the first transcription regulatory element is a combination of ApoE enhancer and alpha-1 antitrypsin (hAAT) promoter; and wherein the second transcription regulatory element is spC5.12 promoter. While instant claim 20 and reference application’s claim 1 recite different SEQ ID NOs. and different names of regulatory sequences, the sequence of nucleotides for the liver-selective enhancer; i.e., SEQ ID NO: 1 is 100% identical to the regulatory sequence in reference application. See alignment. Further, instant claim requires the second muscle-selective promoter to also be spC5.12 promoter. RESULT 1 SEQ ID 6 of US12171843B2 Query Match 100.0%; Score 72; DB 1; Length 1121; Best Local Similarity 100.0%; Matches 72; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 635 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 576 Qy 61 GGCTAAGTCCAC 72 |||||||||||| Db 575 GGCTAAGTCCAC 564 The reference application does not teach three groups of regulatory elements linked to each other wherein there are two muscle-specific promoters; i.e., ref app does not teach: (ii) a first muscle-selective promoter …; and (iii) a second muscle-selective promoter. However, before the effective filing date of the claimed invention, Skopenkova and Gray had taught the missing limitations. The missing limitations and motivation to combine were discussed in the double patenting rejection above and similarly apply. Thus, the combination of reference application claims in view of Skopenkova and Gray would read on instant claims. Any additional limitations of the ‘843 claims are encompassed by the open claim language “comprises” found in the instant claims. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/Examiner, Art Unit 1635 /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Feb 02, 2024
Application Filed
May 22, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680103
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jul 14, 2026
Patent 12644124
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jun 02, 2026
Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
1y 10m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 4m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
69%
Grant Probability
99%
With Interview (+43.0%)
2y 11m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 64 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month