See DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of group I (claims 1-17 and species (SEQ ID NO: 7) in the reply filed on 7/15/26 is acknowledged.
Claims 18, 25, and 26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/15/26.
Upon further consideration, SEQ ID NOs: 5 and 6 are rejoined with the elected species.
SEQ ID NOs: 3-4 in claim 1 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/15/26.
Information Disclosure Statement
The report on patentability of the IPEA and/or ISA has been considered by the examiner.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 4 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 4 depends on claim 1 and claim 1 embraces SEQ ID NOs: 3-7 and all of the sequences are at least 18 nucleotides in length. SEQ ID NO: 5 is 34 nts in length. SEQ ID NO: 6 is 18 nts in length and SEQ ID NO: 7 is 21 nucleotides in length. However, claim 1 embraces a nucleotide sequence having at least 80% identity to SEQ ID NO: 5, 6 ,or 7. A sequence that is at least 80% to SEQ ID NO: 5 has to have at least 28 nucleotides. A sequence that is at least 80% identity to SEQ ID NO: 6 has to have at least 15 nucleotides. A sequence that is at least 80% identity to SEQ ID NO: 7 has to have at least 17 nucleotides. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Interpretation
The nucleotide sequence in instant claims 1 and 2 and claims dependent therefrom has to have at least 15 nucleotides of SEQ ID NO: 6 or at least 17 nucleotides of SEQ ID NO: 7 and at least one nucleotide having a 2’-flouro modification.
Instant claim 4 limits the length of the nucleic acid to 15 to 40 nucleotides in length.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 5, 6, 15, and 17 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lee et al. (claims 1-71 of WO 2012065143, pages 3028-3039) in view of Lee (US 20170037396). NOTE: WO2012065143 is over 3000 pages in length and the program used to process the office action does not allow attachment of the WO document to the instant office action due its size. US 20170037396 is provided in its place since other than the claims cited in ‘143 being cancelled in the ‘396 publication, the disclosure of ‘396 contains the same disclosure as the ‘143 document. If the applicant would like a copy of the WO document they can access the WO document on the PATENTSCOPE website. The applicant can request a copy from the examiner and the examiner will figure out a way to provide a copy of the WO document to the applicant.
Claim 61 on page 3038 embraces a composition comprising an inhibitory nucleic acid of claim 53, comprising a 2’-OMe, 2’-F, LNA, PNA, FANA, ENA, or morpholino, wherein the inhibitory nucleic is an RNA molecule and a pharmaceutically acceptable carrier. Claim 53 recites an inhibitory nucleic acid of any claim from claims 1-51. Claims 1 and 22 embrace tables 1-8 and one of the sequences in tables 1-8 is SEQ ID NO: 820807, which has at least 80% identity to instant SEQ ID NO: 7.
If a skilled artisan wrote out the limitations to the claims of ‘143, for example claim 53 or 61, they would arrive at the claimed invention because SEQ ID NO: 820807 reads on the claimed product having at least one 2’ F modification. See MPEP 2131.02(III).
Instant SEQ ID NO: 7 (Db). See SEQ ID NO: 820807 (Qy)
Qy 2 AAAATGCATATGTATCTTTG 21
Db 15 AAAAUGUAUAUGUAUGUUUG 34
The modified nucleic acid made taught by Lee et al. would inherently have the functional limitation in instant claim 15 because the limitation in the claim is directed to a ‘wherein’ clause that does not add any additional structural limitations required to be taught by Lee et al.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 5, 6, 7, 9, 10, 15, and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Guelly (US20050262577) and Tarveda (US 20180273948), both cited on an IDS.
The instant application claims priority to an international application PCT/US2022/74414 and a written opinion in the international application was filed on 2/2/24. NOTE: instant claims 1-17 and claims 1-17 from the international application appear to embrace the same subject matter. There does not appear to be any arguments and/or amendments in the international application to address the lack of inventive step based on '577 and '948. The reasons set forth on pages 3-6 of the written opinion are incorporated herein.
Guelly teaches a nucleic acid or variant thereof, wherein the nucleic acid comprises SEQ ID NO: 11 (Db). Nucleotides 183-200 has 100% identity to instant SEQ ID NO: 6 (Qy).
Qy 183 AAATGCATATGTATCTTT 200
Db 1 AAATGCATATGTATCTTT 18
Paragraphs 119-120 disclose: "a nucleic acid according to the invention or a nucleic acid which is a non-functional mutant variant the nucleic acid or a nucleic acid having a sequence complementary to one of the aforementioned nucleic acids, which has been modified by attachment of chemical moieties to the nucleic acid the introduction of one or more internucleotide phosphorus groups or by the introduction of one or more non-phosphorus internucleotides Preferred suitable modified internucleotides are known in the prior art.
Guelly does not specifically teach the modification is a 2'-fluoro base modification.
However, Tarveda teaches RNA nucleic acids comprising modifications to improve stability and targeted delivery. See abstract. "The RNAi agents may be modified to increase stability, prevent nuclease degradation, and reduce off-target effects for in vivo applications, including 2'-fluoro base modifications (paragraphs 32-33). Some non-limiting examples, include an RNA molecule having at least one modified ribonucleoside including. a 2'-deoxy-2'-fluoro modified nucleoside. Sugar modifications include but not limited to 2'-fluoro (2'-F).
Since Guelly teaches the modified nucleic acids are RNA nucleic acids for therapeutic uses (paragraphs 68 and 117), it would have been obvious to one of ordinary skill in the art to have applied the modifications taught by Tarveda to improve the stability of the Guelly nucleic acids. A person of ordinary skill in the art would have been motivated to try making at least 25% of the nucleotides have a 2’F base modification to study the bioavailability of the nucleic acid in a cell. One of ordinary skill in the art would have been motivated to attach a phosphorothioate to either the 5’ and 3’ ends of the nucleic acid since to make them more resistance to exonucleases. The modified nucleic acid made obvious by Guelly and Tarveda would inherently have the functional limitation in instant claim 15 because the limitation in the claim is directed to a ‘wherein’ clause that does not add any additional structural limitations required to be made obvious by Guelly and Tarveda. It would have been obvious to make the a composition comprising the modified nucleic acid and a pharmaceutically acceptable carrier for future usage.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 1, 2, 4-11, and 15-17 are rejected under 35 U.S.C. 103 as being unpatentable over CRISPR THERAPEUTICS (WO 2018154439) taken with Ryan et al. (US 20160289675).
‘439 teaches compositions and methods for treating spinocerebellar ataxia type 1 (SCA1) using a CRISPR-Cas system comprising a spacer that reads on instant SEQ ID NO: 6 in claims 1 and 2. See pages 1-8, 24-30, 36-50, and 233-242. For example, see SEQ ID NOs: 84264 and 219870.
SEQ ID NO: 6 (Qy) and SEQ ID NO: 219870 (84264)
Qy 1 AAATGCATATGTATCTTT 18
Db 2 AAATGCATATGTTTTTTT 19
The spacer is 20 nucleotides in length and for targeting within or near a ATXN1 gene or DNA that encodes a regulatory element of the ATXN1 gene. The spacer can be chemically modified, including 2’ fluoro. The spacer can comprise phosphorothioate residues at or near each of its 5’ and 3’ ends. The system can be delivered using a lipid nanoparticle or a pharmaceutical composition comprising the system and a pharmaceutically acceptable carrier.
However, ‘439 does not specifically that that ribonucleotide sequence comprises at least one 2’ fluoro (2’F) modified nucleotide.
However, Ryan teaches that a 2’-F base modification is one of the most commonly used chemical modifications for a RNA sequence. The 2’F base modification can provide thermostability for a guide RNA (pages 130-131).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘439 taken with Ryan to add at least one 2’-fluoro base modification to the gRNA. One of ordinary skill in the art would have been motivated to combine the teaching to try modifying at least one ribonucleotide to all of the ribonucleotides with 2’F to optimize the bioavailability or thermostability of the RNA. Since there are only 20 nucleotides in the spacer it would be a finite and predictable number of nucleotides to try and make having the 2’F modification(s) with a reasonable expectation of success. See MPEP 2143(I)E. A person of ordinary skill in the art would have been motivated to add a phosphorothioate bond to the 5’ and/or 3’ terminal nucleotide to increase the stability of the RNA. One of ordinary skill in the art would have been motivated to attach a tag (targeting moiety) to the RNA to assist in delivery to the insects. The modified nucleic acid made obvious by would inherently have the functional limitation in instant claim 15 because the limitation in the claim is directed to a ‘wherein’ clause that does not add any additional structural limitations required to be made obvious by. One of ordinary skill in the art would have been motivated to try making a nanoparticle comprising the RNA to increase the stability of the RNA. One of ordinary skill in the art would have been motivated to make a pharmaceutical composition comprising the RNA and a pharmaceutically acceptable carrier for storage for future usage or for assisting in delivery of the RNA to cells.
Therefore, the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
Claims 12-14 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
The prior art does not teach or suggest attaching a tag comprising apolipoprotein E peptide or N-acetylgalactosamine to the modified nucleic acid recited in instant claim 1. In addition, the prior art of record does not appear to teach or suggest a modified nucleic acid comprising a nucleotide sequence having at least 80% identity to SEQ ID NO: 5. A search of publicly available databases does not result in a hit for any sequence having at least 80% identity to SEQ ID NO: 5.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636