DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1, 7-12, and 18 are pending.
Applicant’s arguments filed 05/05/2026 have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is FINAL.
Election/Restrictions
Applicant’s election without traverse of Group I, and the species of costimulatory domain, 41BB, in the reply filed on 12/22/2025 is acknowledged.
Claim(s) 13-17 were withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/22/2025.
Newly added claim 18 of the current claim set filed 05/05/2026 reads on Group I.
Claim(s) 1, 7-12, and 18 are under consideration.
Priority
Acknowledgement is made of Applicant’s claim for priority based on a provisional application filed as 63/327,189 on 04/04/2022.
All claims are given the priority date of 04/04/2022.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 05/05/2026 is/are acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action.
Response to Arguments – Specification
The previous objection to the specification were for the following:
Minor informalities
… “(Hi) a costimulatory domain” instead of (iii) at [0038]; and
“NanoPhotemeter” instead of “NanoPhotomer” at [0072];
Trade name or mark use
Incucyte [0008], [0009], [0010], [0011];
Glutamax [0069];
RosetteSep [0070];
Countess [0070], [0074];
ImmunoCult [0070], [0071], [0074], [0080], [0083];
AMPure [0072], [0079], [0082];
NanoPhotemeter” [0072];
Nanodrop [0072];
Nucleovuvette [0074];
Nucleofector [0074];
Ghost Dye [0075];
FCS Express 7 Software [0075];
Q5 (both TM and ® listed, see comment below) [0072], [0076];
These objections to the specification have been withdrawn in view of Applicant’s
amendments filed 05/05/2026.
Claim Objections
Claim 1 objected to because of the following informalities:
Line 8 recites, “. . .second self-cleaving peptide polynucleotide or)”; it would be remedial to remove the “or”;
Line 11 lacks a semicolon to divide the three embodiments, it would be remedial for the claim to recite, “– (right HA);”;
Line 26 recites “. . . (optional second second selection marker polynucleotide) . . .”, it would be remedial to remove one of the “second”; and
Line 51 recites “. . . for a detectable protein; and . . .”, however, the following sentence is not the last “wherein”, thus it would be remedial to remove the “and” in line 51, remove the comma in line 53 after “transcriptional unit” and add an “; and” in line 53 after “transcriptional unit”.
Appropriate correction is required.
Response to Arguments – Claim Objections
The previous objection to claim(s) 1 and 8 have been withdrawn in view of Applicant’s amendments filed 05/05/2026.
The previous objection to claim(s) 2 and 5 are moot in view of Applicant’s cancellation of the claims filed 05/05/2026.
Claim Interpretation
Claim 1 recites in line 54, “. . . wherein the HDR template includes no retroviral vector sequence.”
It is well-understood by one in the art that “Sequence” in molecular biology refers broadly to the ordered arrangement of nucleotides in a DNA or RNA molecule, without an
inherent lower or upper numerical limit on length. BOC Sciences (Nucleotide Sequence: Definition, Classification, and Detection – Boc Sciences, Pages 1-8; Accessed May 27th, 2026) defines a nucleotide sequence as “[T]he order of the bases in DNA or RNA.”, (see page 1) and similarly defines bases (nucleotides), as “Nucleotide sequences include the sequence of A, T, G, and C in DNA. . .” Because these definitions are based on ordered arrangement, of ATGC, rather than length, even very short arrangements of nucleotides constitute a “sequence”.
For example, the National Human Genome Research Institute (Definition of Codon, www.genome.gov/genetics-glossary/Codon; Accessed May 27th, 2026) defines a codon as “[A] DNA or RNA sequence of three nucleotides (a trinucleotide) that forms a unit of genomic information encoding a particular amino acid or signaling the termination of protein synthesis (stop signals). There are 64 different codons: 61 specify amino acids and 3 are used as stop signals.”, (see page 2). Hence, a sequence may consist of as few as three nucleotides. Thus, “. . . wherein the HDR template includes no retroviral vector sequence.”, is interpreted as, “. . . wherein the HDR template includes no retroviral vector sequences of three or more nucleic acids.”
Claim Rejections - 35 USC § 112(b) – Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 9 and 18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 9 recites the limitation ". . . wherein the first and second secreted factors . . ." in lines 1 and 2. There is insufficient antecedent basis for “first secreted factor” in the claim. Claim 9 depends upon claim 1, which was amended in the claims filed 05/05/2026 to remove “first secreted factor” in lines 9, 17, and 24.
Claim 18 recites “The template of claim 1, wherein the human uPAR binding fragment comprises SEQ ID NO: 5.”. As defined in the specification at paragraph [0043], SEQ ID NO: 5 contains DNA sequence domains in addition to the human uPAR binding fragment, i.e., h28z (reading on hinge domain polynucleotide, transmembrane domain polynucleotide, and intracellular domain polynucleotide), and mCherry (reading on “selection marker polynucleotide”). When SEQ ID NO: 51, the human uPAR binding fragment encoded by a nucleic acid sequence, is aligned against SEQ ID NO: 5, the uPAR binding fragment aligns 100% from nucleic acid 64 to 804 (see alignment below).
PNG
media_image1.png
152
628
media_image1.png
Greyscale
PNG
media_image2.png
152
632
media_image2.png
Greyscale
Thus, it is unclear if the claim is requiring the subsequence of the human uPAR binding fragment within SEQ ID NO: 5, or requiring the human uPAR binding fragment, the hinge domain, the transmembrane domain, the intracellular domain, and a further introduction the limitation of an mCherry selection marker.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 1, 7-12, and 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection.
Claim 1 was amended to recite, “. . . wherein the HDR template includes no retroviral vector sequence.” The reply asserts that this additional limitation can be found in the specification in example 1 (page 7 of Applicant remarks).
Example 1 recites, “To avoid the use of viral vectors in our manufacturing process we began by cloning a second generation huPAR CAR sequence with an appended mCherry fluorescent protein with homology arms at the desired cut site for the start of the first encoding exon, exon 6, of the TRAC locus (FIG. 2A). We next generated double-stranded DNA (dsDNA) HDR templates via PCR amplification and performed a two-step purification process first with a Solid Phase Reversible Immobilization (SPRI) with AMPureXP beads followed by an ethanol precipitation to purify and concentrate the templates. Primary human T cells from healthy donors were electroporated with the purified HDR templates and SpyCas9 ribonucleoproteins (RNPs) targeting the human TRAC locus. Cells were recovered for 24 hours at a 1 million/mL density in round-bottom 96-well plates and were expanded in Immunocult™ xeno-free human T cell expansion medium. The cell viability and proliferation of VFC-huPAR-mCh was monitored over 9 days throughout the manufacturing process. Cells were then assayed on day 7 post-isolation to confirm the integration of the VFC-huPAR-mCh CAR T cell products as well as a virus-free CRISPR mCherry only control (VFC-mCh), in place of the huPAR-mCherry CAR sequence. We achieved consistently high genome editing with the dsDNA templates across 2 donors and demonstrated up to 70% knock-in efficiency, with an average of 20% uPAR+ and >90% total TCR- cells, as measured by flow cytometry (FIG. 2B).”
Example 1 describes avoiding use of “viral vectors, however, it does not avoid or mention avoiding the use of “viral vector sequences.”
BioIntron (What is a Vector? Pages 1-3, Published December 11th, 2024; Accessed May 27th, 2026) defines “Vector” as “A vector is a molecular biology tool used to carry genetic material into a host cell.”, (See page 1). BioIntron further discloses the key characteristics of a vector, “(1) Origin of Replication (ori): This sequence allows the vector to replicate independently within the host cell. (2) Selectable Marker: A gene that confers resistance to a specific antibiotic or provides another selective advantage. (3) Multiple Cloning Site (MCS): A region containing various restriction enzyme recognition sites, enabling the insertion of foreign DNA.”, (see page 1).
As defined above in the claim interpretation of claim 1, “sequence” of “. . . wherein the HDR template includes no retroviral vector sequence.”, is being interpreted as “. . . wherein the HDR template includes no retroviral vector sequences of three or more nucleic acids.”
Looking to the specification to teach “wherein the HDR template includes no retroviral vector sequences of three or more nucleic acids.”, the Applicant references “retroviral vectors” three times when describing a 2020 publication, such as “As described in Amor et al., "Senolytic CAR T cells reverse senescence-associated pathologies", Nature, 583, pp. 127-132 (2020), uPAR is induced on the surface of senescent cells. Amor also described uPAR specific CAR T cells prepared using retroviral vectors for the treatment of senescence-associated diseases. These cells drove expression of uPAR by retroviral promoters and did not modify the TRAC gene, resulting in intact TCR protein on the surface and intact signaling by the receptor.”, (see paragraph [0022]), but does not mention retroviral vector sequences.
Looking to the disclosure for sequences that could positively recite retroviral vector sequences, SEQ ID NO: 5 (as recited in claim 18), SEQ ID NO: 15 (huPAR.h28z APOE2), SEQ ID NO: 51, 55, and 56 (uPAR binding fragments) were chosen to compare against two known retroviral vectors, Addgene724 (Addgene pBABE-neo large TcDNA Sequencing Result, pages 1-18; www.addgene.org/browse/sequence/122724/; Accessed May 27, 2026) and Addgene437(Addgene pMSCV-IRES-mCherry FP Sequencing Result – Sequence Analyzer, pages 1-14; www.addgene.org/browse/sequence/354437/; Accessed May 27, 2026).
Addgene724 is a plasmid named pBABE-neo largeTcDNA and contains long terminal repeats (LTR) from Moloney murine leukemia virus and a Moloney murine leukemia virus packaging sequence. One of the two LTRs was selected to align against the instant sequences listed above. The LTR chosen of Addgene724 is the following sequence:
CTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA
Addgene437 is a plasmid named pMSCV-IRES-mCherry FP and contains a 5’ LTR and a 3’ LTR from murine embryonic stem cell virus and a murine embryonic stem cell virus packaging sequence. The 5’ LTR was selected to align against the instant sequences listed above. The 5’ LTR chosen of Addgene437 is the following sequence:
AATGAAAGACCCCCGAGGTGGGCAGTCAATCAATCTGAGGAGACCCTCCCAAGGATCAGCGAGTCCACGATTCGGATGCAAACAGCAAGAGGCTTTATTGGGAATACGGGTACCCGGGCGACGCAGTCTATCGGAGGACTGGCGCGCCGAGTGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCATTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACTGCTGAGGGCGGGACCGCATCTGGGGACCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCTGCTGTCTCTCTGTTCCTAACCTTGATCTGAACTTCTCTATTCTCAGTTATGTATTTTCCATGCCTTGCAAAATGGCGTTACTTAAGCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATT
The alignments below that contain dotted boxes are the instant sequences (on top) aligned against Addgene724. The alignments below that contain solid boxes are the instant sequences (on top) aligned against Addgene437. Boxes indicate 3 or more nucleotides in alignment between the instant application’s sequences and retroviral sequences from a retroviral vector.
PNG
media_image5.png
246
648
media_image5.png
Greyscale
PNG
media_image6.png
248
648
media_image6.png
Greyscale
SEQ ID NO: 5 – huPAR.h28z mCherry [0043]
PNG
media_image9.png
168
642
media_image9.png
Greyscale
PNG
media_image10.png
232
638
media_image10.png
Greyscale
SEQ ID NO: 15 – huPAR.h28z APOE2 [0043]
PNG
media_image13.png
248
626
media_image13.png
Greyscale
PNG
media_image14.png
174
646
media_image14.png
Greyscale
SEQ ID NO: 51 – uPAR binding fragment [0030]
PNG
media_image17.png
248
648
media_image17.png
Greyscale
PNG
media_image18.png
170
642
media_image18.png
Greyscale
SEQ ID NO: 55 – uPAR binding fragment [0030]
PNG
media_image21.png
246
632
media_image21.png
Greyscale
PNG
media_image22.png
154
622
media_image22.png
Greyscale
SEQ ID NO: 56 – uPAR binding fragment [0030]
The addition of the recitation, “wherein the HDR template includes no retroviral vector sequence” is considered new matter because the Applicant does not have basis in the original disclosure for “no retroviral vector sequence”, especially when interpreted as “wherein the HDR template includes no retroviral vector sequences of three or more nucleic acids.”
Accordingly, claim(s) 7-12 and 18 are rejected for being dependent upon claim 1.
Claim 18 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection.
Claim 18 recites, “The template of claim 1, wherein the human uPAR binding fragment comprises SEQ ID NO: 5.” As defined in the specification at paragraph [0043], SEQ ID NO: 5 is named and contains DNA sequence domains in addition to the human uPAR binding fragment, i.e., h28z (reading on hinge domain polynucleotide, transmembrane domain polynucleotide, and intracellular domain polynucleotide), and mCherry (reading on “selection marker polynucleotide”). When SEQ ID NO: 51, the human uPAR binding fragment encoded by a nucleic acid sequence, is aligned against SEQ ID NO: 5, the uPAR binding fragment aligns 100% from nucleic acid 64 to 804 (see alignment above in claim interpretation). This sequence was originally disclosed as more than the uPAR binding fragement, thus the introduction into claim 18 with the recitation of “wherein the human uPAR binding fragment comprises SEQ ID NO: 5.”, constitutes new matter on the grounds that SEQ ID NO: 5 is being renamed and reclassified as such.
Claim(s) 1, 7-12, and 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, Applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
Claim 1 is drawn to a genus of retroviral vector sequence for not being included [said sequence] in the HDR template. The rejected claims thus comprise a genus of retroviral vector sequence and are defined as belonging to the broad class of sequence and as having the function of not being including [said sequence] in the HDR template.
To satisfy the written description requirement, MPEP §2163 states, in part “… a patent
specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.” Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “… disclosure of relevant, identifying characteristics, i.e.,
structure or other physical and/or chemical properties, by functional characteristics coupled with
a known or disclosed correlation between functional and structure, or by a combination of such
identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.”
Looking to the specification, Applicant references “retroviral vectors” three times when describing a 2020 publication, such as “As described in Amor et al., "Senolytic CAR T cells reverse senescence-associated pathologies", Nature, 583, pp. 127-132 (2020), uPAR is induced on the surface of senescent cells. Amor also described uPAR specific CAR T cells prepared using retroviral vectors for the treatment of senescence-associated diseases. These cells drove expression of uPAR by retroviral promoters and did not modify the TRAC gene, resulting in intact TCR protein on the surface and intact signaling by the receptor.”, (see paragraph [0022]), but does not mention “retroviral vector sequences”.
Looking to the disclosure for sequences that could positively recite retroviral vector sequences, SEQ ID NO: 5 (as recited in claim 18), SEQ ID NO: 15 (huPAR.h28z APOE2), SEQ ID NO: 51, 55, and 56 (uPAR binding fragments) were chosen to compare against two known retroviral vectors, Addgene724 (Addgene pBABE-neo large TcDNA Sequencing Result, pages 1-18; www.addgene.org/browse/sequence/122724/; Accessed May 27, 2026) and Addgene437(Addgene pMSCV-IRES-mCherry FP Sequencing Result – Sequence Analyzer, pages 1-14; www.addgene.org/browse/sequence/354437/; Accessed May 27, 2026).
Alignments can be found above in the new matter rejection.
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims in regard to structure and function, the examples are only representative of 49 “retroviral vector sequences” used for not being included [said sequence] in the HDR template. These results are not necessarily predictive of all “retroviral vector sequences” capable of not being included [said sequence] in the HDR template. Thus, it is impossible for one to extrapolate from the 49 examples (# of boxes highlighting three or more nucleic acids aligning) of “retroviral vector sequence” described herein that the genus would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of retroviral vector sequences capable of not being including [said sequence] in the HDR template.
PNG
media_image25.png
358
760
media_image25.png
Greyscale
First, HOPAX (The four kinds of viral vectors which most use in gene therapy – blog – Hopax Fine Chemicals; pages, 1-7, published March 19th, 2021; Accessed May 27th, 2026) discloses that there are four kinds of viruses and their characteristics (see image below):
Chen et al (WO 2020/092057 A1; on 892 filed 02/05/2026) discloses AAVs, a non-retroviral virus vector (as shown above by HOPAX), used with HDR templates to produce CarT cells.
When aligning SEQ ID NO: 28 of Chen et al with either Addgene724 (Addgene pBABE-neo large TcDNA Sequencing Result, pages 1-18; www.addgene.org/browse/sequence/122724/; Accessed May 27, 2026) or Addgene437(Addgene pMSCV-IRES-mCherry FP Sequencing Result – Sequence Analyzer, pages 1-14; www.addgene.org/browse/sequence/354437/; Accessed May 27, 2026), Chen’s non-retroviral sequence also contains stretches of three or more nucleic acids that are conducive to retroviral vector sequences. The alignments below that contain dotted boxes are the SEQ ID NO: 28 of Chen et al (on top) aligned against Addgene724. The alignments below that contain solid boxes are SEQ ID NO: 28 of Chen et al (on top) aligned against Addgene437. Boxes indicate 3 or more nucleotides in alignment between the instant
PNG
media_image26.png
240
648
media_image26.png
Greyscale
PNG
media_image27.png
328
634
media_image27.png
Greyscale
application’s sequences and retroviral sequences from a retroviral vector.
Therefore, the art does not appear to offset the deficiencies of the specification. Merely describing a “retroviral vector sequences” capable of not being included [said sequence] in the HDR template without sufficient detail relating to the genus of “retroviral vector sequences” in for not being included [said sequence] in the HDR template does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim(s) 1, 7-12, and 18.
Response to Arguments - Claim Rejections - 35 USC § 103
The previous rejection of claim(s) 2-6 under 35 U.S.C 103 for Anticipation is moot in view of Applicant’s cancellation of the claim filed 05/05/2026.
The previous rejection of claim(s) 1 and 7-12 under 35 U.S.C 103 for Anticipation has been withdrawn in view of Applicant’s amendments of the claim filed 05/05/2026. Specifically, the amendment to claim 1 in line 54 which adds “. . . wherein the HDR template includes no retroviral vector sequence.”
Regarding claim(s) 1 and 3-12, Applicant states that the claims have been amended to include that the HDR template includes no retroviral vector. Applicant contends that this is a significant different between the present claims and the present prior art. Applicant contends that because Muller, Chen, and Sadelain do not perform HDR without vector integration that it is unknown if the constructs of Muller, Chen, and Sadelain could be used with any efficiency in a nonviral method such as HDR template delivery by electroporation. Applicant contends that the suitability of the constructs of Muller, Chen, and Sadelain for nonviral methods are unknown.
Applicant contends that Muller was concerned with the impact of the hinge domain and the transmembrane domain on a CD19 CAR and that Muller uses either CD28 or 4-1BB and does not appear to notice a significant difference with either intracellular domain. Applicant states that the present claims contrast Muller in that the intracellular domain of the instant claim 1 is CD3-zeta and that the present application uses CD3-zeta to provide the right level of activation for uPAR antigen density on human uPAR positive cells. Applicant contents that tuning CARs is very challenging and that there is no way to known whether the expression level, affinity of the receptor, and co-stimulatory combination would function effectively in a T cell and that this is what the Applicant has shown, the combination of elements claimed provide the right level of activation of uPAR.
The examiner would like to also point to Figure 5A of Muller, as the Applicant did in the response to arguments. It is well-known in the art that when a “zeta” symbol is added to an intracellular domain, e.g., CD28 or 4-1BB, that this indicates that a portion of CD3-zeta is combined with said intracellular domain to produce a “CD28-CD3-zeta” or “4-1BB-CD3-zeta” domain. Applicant’s own specification at paragraph [0043] recites “z” aka “zeta” after h28 (CD28), furthering the fact that zeta, regardless of if CD-3 proceeds it, represents CD3-zeta. Moreover, the instant specification recites, “FIG. 1A is a schematic of an anti-huPAR-CAR-2A-mCh targeting strategy. FIG.3 is a schematic of an anti-muPAR-CAR-2A-NGFR targeting strategy. muPAR is the scFVVH and VL of mouse anti-uPAR binding fragment with a CD8 linker. The CD28 hinge and transmembrane domain were used. The zeta chain is a CD3 zeta chain. NGFR is a truncated nerve growth factor affinity receptor. mCh is the mCherry fluorescent protein.”, (see [0042]).
PNG
media_image28.png
250
982
media_image28.png
Greyscale
Thus, Muller teaches the claimed CD3-zeta, and would thus inherently have the properties of the claimed invention that the Applicant stated in the arguments, i.e., “. . . [T]o provide the right level of activation for uPAR antigen density on human uPAR positive cells.”
Applicant contends that even if one were to include the splice acceptor of Chen in the HDR template of Muller, one would still not know whether the expression level, affinity of the receptor, and co-stimulatory combination would function in a T cell. Applicant contends that one would not know if the CD19 of Muller could be replaced with uPAR to provide a successful HDR template without significant experimentation. Applicant submits that the combination of Muller, Chen and Sadelein provide no expectation of success for the claimed non-viral anti-uPAR HDR construct. Applicant contends that Muller, Chen, Sadelein and Gottschalk provide no expectation of success for the claimed non-viral anti-uPAR HDR construct.
Despite the fact that the argument provided has drawn merely conclusory statements, the rejection under 35 U.S.C. 103 for claims 1 and 7-12 being unpatentable over Muller et al in view of Chen et al, and in further view of Sadelain et al has been withdrawn in view of Applicant’s amendments of the claim filed 05/05/2026. Specifically, the amendment to claim 1 in line 54 which adds “. . . wherein the HDR template includes no retroviral vector sequence.”
Response to Arguments – Double Patenting
The previous rejection of claim 2 for Nonstatutory Double Patenting is moot in view of Applicant’s cancellation of the claim filed 05/05/2026.
The previous rejection of claim(s) 1, 7-12 for Nonstatutory Double Patenting has been withdrawn in view of Applicant’s amendments of the claim filed 05/05/2026.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights